Composition for preventing and controlling PEDV infection in piglets and its application

Abstract

The present invention provides a composition for preventing and controlling PEDV infection in piglets and its application, and relates to the field of microorganisms, and specifically to a composition of microorganisms. The present invention provides a composition for preventing and controlling PEDV infection in piglets, which is a co-fermentation product of Andrographis paniculata and Clostridium butyricum, obtained by co-fermenting Clostridium butyricum with Andrographis paniculata, especially with Andrographis paniculata decoction. The co-fermentation product of Andrographis paniculata and Clostridium butyricum can inhibit the replication of PEDV in the host intestine, reduce pathological damage to the small intestine of piglets, reduce inflammatory response, increase the percentage of T / B lymphocytes, NK cells and DC cells in peripheral immune organs, increase the secretion level of IFN-β and the secretion level of sIgA in the intestine, thereby improving the host's antiviral level and enhancing the piglet's ability to resist PEDV infection.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to a composition for preventing and controlling PEDV infection in piglets and an application thereof. Background Art

[0002] Any discussion of the prior art throughout the specification should not be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0003] Porcine epidemic diarrhea (PED) is one of the common diseases in intensive farming. It can cause diarrhea, vomiting, and dehydration in infected piglets. In severe cases, it can cause shock and death in piglets. With the rapid development of pig farming, the prevalence of porcine epidemic diarrhea virus (PEDV) has brought serious economic losses and production pressure to the pig industry. PEDV is confined to pigs. Pigs of all ages are susceptible, but unweaned piglets have the worst prognosis. The incubation period is generally 2 to 4 days, and diarrhea symptoms generally last for 4 to 14 days. Newborn piglets will have watery gray or grayish yellow diarrhea after infection. In severe cases, vomiting, bloody stools, or sloughed intestinal mucosa can be seen after eating, and most pigs die of exhaustion due to dehydration. The main symptoms of weaned pigs are watery diarrhea, vomiting, loss of appetite, and weight loss. PEDV is mainly transmitted through the fecal-oral route. After infection, the virus binds to receptors on the cell membrane through the spike protein (S) and proliferates in the small intestinal epithelial cells, causing damage and shedding of small intestinal epithelial cells and atrophy of intestinal villi. In addition, PEDV can inhibit the expression of type I interferon, causing immunosuppression, thereby causing co-infection with multiple pathogens. At present, there is no chemical specific drug for PED. In order to control the spread of PED, scientists have successively constructed various new genetic engineering vaccines, such as virus-like particle vaccines and nucleic acid vaccines, but the protective effects are unsatisfactory due to the continuous mutation and evolution of the virus. Faced with the increasingly severe PED epidemic, it is urgent to find a new method to prevent and control PED. Summary of the invention

[0004] The present invention provides a composition for preventing and controlling PEDV infection in piglets and its application. The composition of the present invention has a good immune effect on piglets infected with porcine epidemic diarrhea virus, can significantly alleviate the clinical discomfort symptoms caused by porcine epidemic diarrhea virus infection, inhibit the replication of porcine epidemic diarrhea virus in the intestine of piglets, reduce pathological damage to the small intestine, reduce inflammatory response, and improve the mucosal immune level and immune cell secretion of the animal body, such as increasing the percentage of T / B lymphocytes, NK cells and DC cells in peripheral immune organs, increasing the secretion level of IFN-β and the secretion level of sIgA in the intestine, thereby improving the host's antiviral level and enhancing the ability to resist porcine epidemic diarrhea infection.

[0005] Specifically, the present invention provides the following technical solutions.

[0006] In a first aspect of the present invention, a composition for preventing and controlling PEDV infection in piglets is provided, wherein the composition is a co-fermentation product of Andrographis paniculata and Clostridium butyricum, and in particular, the Andrographis paniculata is a decoction of Andrographis paniculata.

[0007] In a second aspect of the present invention, a method for preparing the composition for preventing and controlling PEDV infection in piglets described in the first aspect is provided, comprising: co-fermenting Clostridium butyricum with Andrographis paniculata to obtain a co-fermentation product.

[0008] In one embodiment, the method comprises: preparing a decoction of Andrographis paniculata, and co-fermenting the decoction of Andrographis paniculata with Clostridium butyricum in a liquid culture medium to obtain a fermentation product.

[0009] In one embodiment, the co-fermentation conditions include a fermentation time of 12-36 hours, a fermentation temperature of 28-40° C., an initial fermentation pH of 6.0-7.5, an inoculum amount of Clostridium butyricum of 0.05-50% (v / v), and an addition amount of Andrographis paniculata decoction of 4-8% (v / v).

[0010] In the above embodiment, the preferred fermentation time is 20-36 h.

[0011] In the above embodiment, the preferred fermentation temperature is 33-40°C.

[0012] In the above embodiment, the preferred initial pH of the fermentation is 6.0-7.0.

[0013] In the above embodiment, the preferred inoculation amount of Clostridium butyricum is 0.05-5% (v / v).

[0014] In the above embodiment, the preferred addition amount of Andrographis paniculata decoction is 5-6%.

[0015] In a preferred embodiment, the co-fermentation conditions include a fermentation time of 32 hours, a fermentation temperature of 37° C., an initial fermentation pH of 6.5, an inoculation amount of Clostridium butyricum of 5% (v / v), and an addition amount of Andrographis paniculata decoction of 6% (v / v).

[0016] In one embodiment, the preparation method of the Andrographis paniculata decoction comprises: grinding Andrographis paniculata, soaking it in water and then boiling it, taking the supernatant and centrifuging it, and continuing to boil and concentrate it to a desired volume.

[0017] In a specific embodiment, the preparation method of the Andrographis paniculata decoction comprises: taking Andrographis paniculata and crushing it, weighing 10 g and putting it into an electric decoction pot, adding 20 times the volume of distilled water, soaking it for half an hour and then boiling it. After 45 minutes, use a sieve to filter out the Chinese medicine residue, take out the supernatant after standing for 3 hours and put it into a centrifuge at 8000 rpm for 5 minutes. After centrifugation, take out the supernatant and continue to boil the Chinese medicine liquid until the Chinese medicine liquid is concentrated to 10 mL, and the drug concentration of the Andrographis paniculata decoction at this time is 1g / mL. Preferably, the Andrographis paniculata decoction is sterilized. For example, sterilize it in a high-pressure steam sterilizer at 115°C for 25 minutes and store it in a refrigerator at 4°C for use.

[0018] In the third aspect of the present invention, a compound formulation is provided, wherein the compound formulation comprises the composition for preventing and controlling PEDV infection in piglets as described in the first aspect above.

[0019] In some embodiments of the present invention, the compound formulation is a medicine or a feed additive.

[0020] In some embodiments of the present invention, the compound preparation is a liquid preparation or a solid preparation. The liquid preparation or the solid preparation may contain healthy and harmless preparation excipients, for example, when preparing the solid preparation, spray drying or freeze drying may be adopted, and a protective agent such as milk powder may be added.

[0021] In the fourth aspect of the present invention, provided is the use of the composition for preventing and controlling PEDV infection in piglets described in the first aspect or the composite formulation described in the third aspect in the preparation of a drug or feed additive for preventing and / or controlling porcine epidemic diarrhea.

[0022] The composition for preventing and controlling PEDV infection in piglets of the present invention covers both preventive effects (used before exposure to porcine epidemic diarrhea virus) and potential control effects (used after exposure to porcine epidemic diarrhea virus).

[0023] In the present invention, the "prevention" refers to the oral administration of the co-fermentation product of Andrographis paniculata and Clostridium butyricum of the present invention before the piglets are exposed to porcine epidemic diarrhea virus (PEDV) to enhance the immunity and disease resistance of the piglets, thereby reducing the incidence of porcine epidemic diarrhea virus infection or reducing the severity of symptoms after infection. The purpose of preventive measures is to establish a defense mechanism before the virus invades.

[0024] In an embodiment of the present invention, the specific manifestations of the preventive effect include but are not limited to improving the resistance of piglets to porcine epidemic diarrhea virus, enhancing the immune function of the intestinal mucosa, regulating the immune system, increasing the secretion of antiviral factors and optimizing the intestinal microecological environment.

[0025] In the present invention, the control refers to the inhibition of virus replication and spread, alleviation of infection symptoms, acceleration of recovery process, and reduction of the risk of disease transmission in the group by continuous oral administration of the co-fermentation product of Andrographis paniculata and Clostridium butyricum of the present invention when the piglets have been exposed to porcine epidemic diarrhea virus or are in an environment where porcine epidemic diarrhea virus is prevalent. The purpose of the control measures is to manage the infection that has occurred and reduce its negative impact.

[0026] In an embodiment of the present invention, the specific manifestations of the control effect include but are not limited to inhibiting the replication of porcine epidemic diarrhea virus in the small intestine of piglets, reducing pathological damage to the small intestine, reducing inflammatory response, regulating the level of immune factors, maintaining the growth performance of piglets, reducing weight loss, and reducing the risk of virus transmission in the group.

[0027] The co-fermentation product of Andrographis paniculata and Clostridium butyricum provided by the present invention can be used for prevention or control, or for prevention and / or control at the same time, and the specific use method can be flexibly adjusted according to actual conditions.

[0028] In the fifth aspect of the present invention, provided is the use of the composition for preventing and controlling PEDV infection in piglets described in the first aspect or the composite preparation described in the third aspect in the preparation of antiviral drugs, immunopotentiators and / or anti-inflammatory preparations.

[0029] In an embodiment of the present invention, the immunopotentiator is an immunopotentiating feed additive. The present invention has verified in experiments that the co-fermentation product of Andrographis paniculata and Clostridium butyricum can increase the proportion of T / B lymphocytes, NK cells and DC cells, and improve the secretion levels of IFN-β and sIgA. This shows that it has a significant immunopotentiating effect.

[0030] In an embodiment of the present invention, the anti-inflammatory preparation is a feed additive for alleviating inflammatory bowel disease or a therapeutic drug for intestinal inflammation. In the experiments of the present invention, it has been verified that the co-fermentation product of Andrographis paniculata and Clostridium butyricum can reduce the content of inflammatory factors such as TNF-α, IL-6 and IL-1β, and has significant anti-inflammatory ability.

[0031] In an embodiment of the present invention, the antiviral drug is an anti-porcine epidemic diarrhea drug. The antiviral drug is at least a drug that inhibits the replication of porcine epidemic diarrhea virus in the small intestine. In the experiments of the present invention, it has been verified that the co-fermentation product of Andrographis paniculata and Clostridium butyricum can directly inhibit viral replication, which is manifested in that the viral load of the group using the co-fermentation product of Andrographis paniculata and Clostridium butyricum is significantly reduced compared with the porcine epidemic diarrhea virus group in the duodenum, jejunum and ileum (*** P <0.001). Also, it enhances the host's antiviral immune response, for example, the levels of IFN-β (antiviral factor) in the serum of the Andrographis paniculata group and the co-fermentation group were significantly higher than those of the porcine epidemic diarrhea group (*P <0.05), can also enhance the antiviral ability of host cells. And activate immune cells, such as CD8 + IFN - γ + The number of T cells increased, these cells can directly kill virus-infected cells, the number of NK cells increased, NK cells also have the ability to kill virus-infected cells, and the number of DC cells increased, these cells can present viral antigens and activate specific immune responses. In addition, mucosal immunity is enhanced. According to the experiment, the content of sIgA in the colon contents of piglets in the co-fermentation product group was significantly higher than that in the porcine epidemic diarrhea virus group (*** P <0.001). sIgA can neutralize viruses on the mucosal surface and prevent viral invasion. In addition, it can regulate inflammatory responses. For example, co-fermentation products can reduce the levels of inflammatory factors such as TNF-α, IL-6 and IL-1β, thereby alleviating excessive inflammatory responses caused by viral infection and indirectly supporting the antiviral process.

[0032] Compared with the prior art, the advantages of the present invention include:

[0033] Synergistic effect: The present invention combines the Chinese medicine Andrographis paniculata with Clostridium butyricum to produce a synergistic effect through a fermentation process, which has better prevention and control effects than using Andrographis paniculata or Clostridium butyricum alone, and compared with other combinations of Chinese medicines and probiotics.

[0034] Multiple mechanisms of action: (1) Antiviral: Significantly inhibits the replication of PEDV in the small intestine (including the duodenum, jejunum and ileum) of piglets. (2) Immunomodulatory: Increases the IFN-β content in serum and increases the proportion of T / B lymphocytes, NK cells and DC cells in the spleen and mesenteric lymph nodes. (3) Anti-inflammatory effect: Reduces the content of inflammatory factors such as TNF-α, IL-6 and IL-1β in serum. (4) Enhances mucosal immunity: Increases the secretion level of sIgA in the small intestinal mucosa.

[0035] High safety: The present invention uses natural Chinese medicine and probiotics, avoids the use of antibiotics, and reduces the risk of drug residues and drug resistance.

[0036] Significant protective effect: Reduces pathological damage to the small intestine of piglets. Reduces the weight loss rate after infection with porcine epidemic diarrhea virus, and helps maintain the growth performance of piglets.

[0037] Flexible application: can be used for prevention and control, suitable for piglet health management at different stages.

[0038] Optimization of preparation method: The bioavailability of active ingredients was improved by optimizing fermentation conditions (time, temperature, pH value, inoculation amount, etc.).

[0039] Potential broad-spectrum effects: Although this study focused on porcine epidemic diarrhea virus, this approach may also have potential for the prevention and control of other enteroviral diseases.

[0040] Economic benefits: By preventing and controlling porcine epidemic diarrhea virus infection, the economic losses of the pig industry can be significantly reduced.

[0041] Comply with the requirements of antibiotic alternatives: As an alternative to antibiotics, it complies with the current trend of reducing the use of antibiotics in animal husbandry.

[0042] Potential for standardized production: Through clear preparation methods and optimized parameters, it provides a basis for standardized production and quality control of this product.

[0043] These advantages comprehensively reflect the innovation and practicality of the present invention in the prevention and control of porcine epidemic diarrhea, and provide a new and effective disease management strategy for the pig industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The drawings constituting part of the specification of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute an improper limitation of the present invention. The embodiments of the present invention are described in detail below in conjunction with the drawings, wherein: In the following drawings, * P <0.05;** P <0.01;*** P <0.001.

[0045] Figure 1 The cytopathic effect (CPE) is shown, where a: normal morphology of Vero cells; b: pathological morphology of Vero cells.

[0046] Figure 2 The results of screening of antiviral Chinese medicine on Vero cells are shown.

[0047] Figure 3 Shown are the effects of co-fermentation products and Clostridium butyricum on IPEC cells.

[0048] Figure 4 The daily weight gain of piglets before and after the challenge is shown.

[0049] Figure 5 Shown is a histopathological section of porcine small intestine.

[0050] Figure 6 The suicidal virus copy numbers are shown.

[0051] Figure 7 The piglet jejunovirus copy numbers are shown.

[0052] Figure 8The number of copies of porcine ileovirus is shown.

[0053] Fig. 9 The serum interleukin-6 (IL-6) content is shown.

[0054] Fig.10 The serum interferon-β (IFN-β) content is shown.

[0055] Fig.11 Serum tumor necrosis factor-α (TNF-α) levels are shown.

[0056] Fig.12 The serum interleukin-1β (IL-1β) content is shown.

[0057] Fig.13 The content of porcine secretory immunoglobulin (sIgA) is shown.

[0058] Fig.14 The IFN-γ levels in the spleen of piglets in each group are shown. + CD8 + Cell content.

[0059] Fig.15 The IgA in the mesenteric lymph nodes of piglets in each group is shown. + CD21 + The proportion of B cells.

[0060] Fig.16 The NK cell CD335 in the spleen of piglets in each group of the experiment is shown. + , dendritic cell CD14 + Cell content. DETAILED DESCRIPTION

[0061] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0062] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. The reagents or raw materials used in the present invention can be purchased through conventional channels. Unless otherwise specified, the reagents or raw materials used in the present invention are used in a conventional manner in the art or in accordance with the product instructions. In addition, any method and material similar to or equivalent to the described content can be applied to the method of the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0063] Example 1 Screening of anti-PEDV Chinese medicine and optimization of fermentation conditions

[0064] 1.1 Experimental Materials and Methods

[0065] 1.1.1 Materials

[0066] 1.1.1.1 Experimental materials: Prunus mume, Schisandra chinensis, pomegranate peel, Pueraria root, Coptis chinensis, Atractylodes macrocephala, Patchouli, Codonopsis pilosula, Magnolia officinalis, Rosa laevigata, Rhubarb, Astragalus membranaceus and Andrographis paniculata. PEDV CV777 strain and Vero cells were provided by Jilin Agricultural University (Jilin Provincial Animal Microecological Preparation Engineering Research Center). Clostridium butyricum was purchased from BNCC (BeNa Culture Collection, BeNa Biological Culture Collection Center), and its strain number is BNCC337239. The 16S rRNA gene of this strain is shown in SEQ ID NO:1.

[0067] 1.1.1.2 Main reagents: Fetal bovine serum was purchased from Gibco, USA. CCK8 kit was purchased from Shanghai Bio-Tech Biotechnology Co., Ltd. DMEM high glucose medium and double antibody were purchased from Wuhan Sewell Biotechnology Co., Ltd.

[0068] 1.1.1.3 Main instruments: cell culture incubator, constant temperature incubator, high pressure sterilizer, low temperature desktop high speed centrifuge, microplate spectrophotometer.

[0069] 1.1.2 Experimental methods

[0070] 1.1.2.1 Preparation of Chinese herbal medicine decoction

[0071] The 13 Chinese medicines include Wumei, Schisandra, Pomegranate peel, Pueraria root, Coptis chinensis, Atractylodes macrocephala, Patchouli, Codonopsis pilosula, Magnolia officinalis, Rosa laevigata, Rhubarb, Astragalus, and Andrographis paniculata. After each Chinese medicine was crushed, 10 g was weighed and put into an electric decoction pot, and 20 times the volume of distilled water was added. After soaking for half an hour, it was boiled. After 45 minutes, the Chinese medicine residues were filtered out using a sieve. After standing for 3 hours, the supernatant was taken out and put into a centrifuge at 8000 rpm for 5 minutes. After centrifugation, the supernatant was taken out and the Chinese medicine liquid was boiled until the Chinese medicine liquid was concentrated to 10 mL, and the drug concentration at this time was 1 g / mL. Finally, the concentrated Chinese medicine liquid was sterilized by high-pressure steam sterilization pot at 115 ℃ for 25 minutes and stored in a refrigerator at 4 ℃ for use.

[0072] 1.1.2.2 Toxic effects of Chinese herbal medicine decoction on Vero cells

[0073] This experiment tested the toxic effects of Chinese herbal decoctions on Vero cells at different concentrations and determined the maximum safe concentration of Chinese herbal decoctions. Vero cells in good condition were prepared into cell suspensions and plated on 96-well plates using DMEM medium (containing 10% fetal bovine serum and 1% double antibody). When the cells were fused to about 80%, the medium was discarded, and 13 single Chinese herbal decoctions were diluted in multiples using cell maintenance medium (containing 2% fetal bovine serum and 1% double antibody). The Chinese herbal decoctions were added to wells 1 to 10 in each row of the 96-well plate at different dilution concentrations, and the 11th well was set as a cell maintenance medium control. Five replicates were set for each dilution. After all Chinese herbal solutions and reagents were added, they were placed in a cell culture incubator at 37 °C and 5% CO2 for culture, and the results were observed and recorded daily. After 48 h of cell culture, the morphological changes of Vero cells were observed under a microscope, and finally the cell viability was determined by CCK8 method.

[0074] 1.1.2.3 PEDV virus amplification

[0075] Vero cells were prepared at 175 mm 2 DMEM medium (containing 10% fetal bovine serum and 1% double antibody) was added to the cell culture flask for culture. When the cells were about 80% confluent, the medium was discarded, and 5 mL of cell maintenance solution (containing 1% double antibody, without serum), 25 µL of trypsin (without EDTA), and 1 mL of virus stock solution were added to the culture flask. The virus stock solution needs to be sterilized by filtration using a 0.22 μm filter membrane in advance. After all reagents are configured, they are placed in a cell culture incubator set to 37°C and maintained in a 5% carbon dioxide environment. The cell culture flask was moderately shaken every 15 min. After 6 hours of treatment, 20 mL of cell maintenance solution containing 2% fetal bovine serum and 1% double antibody was added, and then the cells were cultured under the same culture conditions. Observe daily, and cytopathic phenomena can be observed after 36-48 hours. The culture flask was subjected to three freeze-thaw cycles, and then the culture solution was aliquoted in a biosafety cabinet and stored at -80°C.

[0076] 1.1.2.4 PEDV Virulence Determination

[0077] First, Vero cells were prepared into a cell suspension, then plated in a 96-well plate and cultured at 37 °C and 5% CO2. When the cells are fused to about 80%, they can be used for the experiment. The virus was diluted 10 times in a cell maintenance solution (containing 2% fetal bovine serum and 1% double antibody) and added to a 96-well plate, with 8 replicates for each dilution. At the same time, an 8-well control group was set up and an equal amount of cell maintenance solution was added. After that, the 96-well plate was returned to the cell culture incubator at 37 °C and 5% CO2, and the changes in the cell status were continuously observed and recorded every day until no new cell pathological phenomena appeared. Finally, the Reed-Muench formula was used to calculate the titer of the virus.

[0078] 1.1.2.5 Screening of antiviral Chinese medicine on Vero cells

[0079] First, 13 single Chinese herbal decoctions were used as the research objects. They were diluted according to the maximum safe concentration in result 1.1.2.2. Vero cells were used as the research model. When the cell density reached the ideal state (80% monolayer) in the 96-well plate, the Chinese herbal decoction diluted to the maximum safe concentration was added to the wells. Six replicates were set for each sample, and 100 µL of Chinese herbal decoction was injected into each well. A virus control group and a normal Vero cell control group were set up. 100 TCID 50 The virus solution was added to the control wells of normal Vero cells, while the cell culture medium was added to the control wells of normal Vero cells. Subsequently, the 96-well plate was placed in an incubator at 37 °C and 5% CO2 for 12 h. Finally, the virus was added to the cells. After 2 h of adsorption, the supernatant was removed, and the culture medium containing the drug was added to the cell wells. The culture was continued under the same culture conditions, and the cell pathological changes were monitored and recorded daily until the cells no longer showed signs of pathological changes. At this time, CCK8 detection was performed. Based on the defensive effect of the drug on viral invasion, the drug with significant antiviral effect was screened.

[0080] 1.1.2.6 Optimization test of lactic acid bacteria fermented Chinese medicine

[0081] 1.1.2.6.1 Optimization of the optimal fermentation time

[0082] In 10 mL of RCM liquid medium, add 6% of Andrographis paniculata decoction, sterilize with high pressure, and then add 4% of Clostridium butyricum solution. Static fermentation was performed at 37 °C for 12 h, 16 h, 20 h, 24 h, 28 h, and 32 h, respectively. The pH value and OD before and after fermentation were recorded. 450 Value, in OD 450 The value is used as the evaluation standard to determine the optimal fermentation time.

[0083] 1.1.2.6.2 Optimization of the optimal fermentation temperature

[0084] In 10 mL RCM liquid culture medium, add 6% of Andrographis paniculata decoction, sterilize under high pressure, and then add 4% of Clostridium butyricum solution. Use the optimal culture time determined in 1.1.2.6.1, set the culture environment to 28 ℃, 30 ℃, 33 ℃, 37 ℃, 40 ℃, and let it ferment statically. Measure the pH changes and OD before and after fermentation. 450 Value, in OD 450 The value is used as the evaluation standard to determine the optimal fermentation temperature.

[0085] 1.1.2.6.3 Optimization of the optimal initial fermentation pH

[0086] In 10 mL RCM liquid culture medium, add 6% of Andrographis paniculata decoction, and use NaOH and HCl to adjust the pH value of the culture medium to 7.5, 7, 6.5, 6.0 and 5.5 respectively. After high-pressure sterilization, add 4% Clostridium butyricum solution. According to the optimal culture time in 1.1.2.6.1 and the optimal fermentation temperature in 1.1.2.6.2, static fermentation was carried out under these conditions. During the fermentation process, the pH changes and OD before and after fermentation were measured. 450 Value. 450 The value was used as the evaluation criterion to screen the optimal initial pH value for fermentation.

[0087] 1.1.2.6.4 Optimization of the optimal bacterial inoculation amount

[0088] In 10 mL of RCM liquid culture medium, add 6% of Andrographis paniculata decoction, sterilize with high pressure, and then inoculate Clostridium butyricum liquid into the culture medium at 0.05%, 0.5%, 5%, and 50%, respectively. Perform static fermentation according to the determined optimal culture time, optimal fermentation temperature, and optimal fermentation pH. Measure the pH change and OD before and after fermentation. 450 Value, in OD 450 The value was used as the evaluation standard to screen the optimal bacterial inoculation amount.

[0089] 1.1.2.7 Effects of Clostridium butyricum and co-fermentation products on the viability of porcine intestinal epithelial cells (IPEC-J2)

[0090] IPEC-J2 cells were plated in a 96-well cell culture plate and grown to 80% confluence. 10 5 CFU / mL, 2×10 5 CFU / mL, 3×10 5 CFU / mL, 4×10 5 CFU / mL, 5×10 5 CFU / mL of Clostridium butyricum and Chinese medicine and Clostridium butyricum fermentation broth, each gradient was repeated 8 wells, and the culture medium was set as a control. After culturing for 6 h at 5% CO2 and 37 °C, the cells were washed once with 0.5 mg / mL gentamicin sulfate and twice with cell maintenance solution containing 1% double antibody to ensure that there were no residual Clostridium butyricum and its fermentation products under the microscope. 10 µL of CCK8 and 90 µL of cell maintenance solution (containing 2% fetal bovine serum and 1% double antibody) were added to each well and incubated in a 37 °C incubator in the dark for 1 h. Using a spectrophotometer, the OD of each well was detected. 450 The effects of Clostridium butyricum and co-fermentation products on cell viability were obtained.

[0091] 1.2 Results

[0092] 1.2.1 Test results of the toxicity of Chinese herbal medicine decoction on Vero cells

[0093] According to the CCK8 experimental results, taking Atractylodes macrocephala as an example, the lower the concentration of the Chinese medicine decoction, the higher the OD value of the drug addition hole. 450 The higher the value, the more the OD value is related to the cell survival rate. When the concentration of the Chinese medicine decoction drops to 7.813 mg / mL, the OD value of the drug addition well 450 The value was not significantly different from the blank control well, so 7.813 mg / mL was determined to be the maximum safe concentration of Atractylodes macrocephala decoction for Vero cells. The experiment showed that the maximum safe doses of 13 Chinese herbal decoctions on Vero cells were: Atractylodes macrocephala 7.813 mg / mL; Codonopsis pilosula 31.25 mg / mL; Pueraria lobata 31.25 mg / mL; Patchouli 1.953 mg / mL; Magnolia officinalis 31.25 mg / mL; Pomegranate peel 0.977 mg / mL; Andrographis paniculata 7.813 mg / mL; Astragalus 31.25 mg / mL; Plum ebony 31.25 mg / mL; Schisandra 3.906 mg / mL. The concentrations of Rosa laevigatae, Coptis chinensis, and Rhubarb in this experiment all had an effect on Vero cells, so Atractylodes macrocephala, Codonopsis pilosula, Pueraria lobata, Patchouli, Magnolia officinalis, Pomegranate peel, Andrographis paniculata, Astragalus, Plum ebony, and Schisandra chinensis were selected as subsequent experimental materials.

[0094] 1.2.2 Amplification of PEDV

[0095] Prepare Vero cells in a cell culture flask, add PED virus diluent, and culture in a 37°C incubator for 36-48 hours. Obvious lesions can be observed under a microscope (see Figure 1 ).

[0096] 1.2.3 Virulence assay of PEDV on Vero cells

[0097] By TCID 50 The virulence of the virus was determined by microassay. The results are shown in Table 1.

[0098] Table 1 TCID of porcine PEDV virus 50 Measurement results

[0099]

[0100] Distance ratio = (percentage of lesions above 50% - 50%) / (percentage of lesions above 50% - percentage of lesions below 50%) = (83-50) / (83-40) = 0.77

[0101] TCID 50= distance ratio × difference between the logarithms of dilution + logarithm of dilution with a lesion rate higher than 50% = 0.77 × (-1) + (-4) = -4.77

[0102] The final TCID of the virus was measured 50 The titer is 10 -4.77 .

[0103] 1.2.4 Evaluation of the anti-PEDV effect of Chinese herbal decoction on Vero cells

[0104] According to the results of 1.2.1, the 10 selected Chinese herbal medicine decoctions were diluted to the maximum safe concentration, added to a 96-well plate with a cell density of 80%, incubated for 12 h, and then infected with PEDV virus. After the virus was adsorbed on Vero cells for 2 h, the supernatant containing the virus was discarded, and the cell maintenance medium was added, and the OD was determined using the CCK8 method. 450 Values, such as Figure 2 On the third day, compared with the blank control wells, the Vero cells in the virus control group changed morphology and began to shed, with OD 450 Significantly lower values ​​(*** P <0.001); Comparison with the Chinese medicines after preliminary screening showed that Andrographis paniculata, Magnolia officinalis, Atractylodes macrocephala, and Codonopsis pilosula could significantly enhance cell activity (*** P <0.001) to prevent PEDV infection, but Andrographis paniculata had the best effect, so Andrographis paniculata was selected as the experimental medicinal material.

[0105] 1.2.5 Results of optimization test on decoction of traditional Chinese medicine fermented by Clostridium butyricum

[0106] 1.2.5.1 Screening of the optimal fermentation time for the decoction of traditional Chinese medicine fermented by Clostridium butyricum

[0107] Table 2 Effect of different culture time on bacterial solution OD 450 The impact of value

[0108]

[0109] According to the results in Table 2, when the fermentation solution contained 6% Chinese medicine decoction and 4% bacterial inoculation, the OD 450 Therefore, it can be determined that 32 h is the optimal culture time for the fermentation broth of Clostridium butyricum and Andrographis paniculata.

[0110] 1.2.5.2 Screening of the optimal fermentation temperature for Chinese medicine fermented by Clostridium butyricum

[0111] Table 3 Effect of different culture temperatures on bacterial solution OD 450 The impact of value

[0112]

[0113] According to the results in Table 3, when the Andrographis paniculata fermentation liquid contained 6% Chinese medicine decoction and 4% bacterial inoculation and fermented for 32 hours, the OD 450 Therefore, 37 ℃ can be determined as the optimal culture temperature for the fermentation broth of Clostridium butyricum and Andrographis paniculata.

[0114] 1.2.5.3 Screening of the optimal fermentation pH for Chinese medicine fermented by Clostridium butyricum

[0115] Table 4 Effect of different initial pH on bacterial solution OD 450 The impact of value

[0116]

[0117] According to the results in Table 4, the fermentation broth contained 6% Chinese medicine decoction and 4% bacterial inoculum. Under the condition of static fermentation at 37 °C for 32 h, when the pH value of the fermentation broth was 6.5, the OD 450 Therefore, it can be determined that pH 6.5 is the optimal fermentation pH for the fermentation broth of Clostridium butyricum and Andrographis paniculata.

[0118] 1.2.5.4 Screening of the optimal inoculum amount of fermentation liquid for Chinese medicine fermentation with Clostridium butyricum

[0119] Table 5 Effect of different seed solution inoculation amounts on bacterial solution OD 450 The impact of value

[0120]

[0121] The results in Table 5 show that when the Andrographis paniculata fermentation liquid contained 5% of the Clostridium butyricum seed liquid, the OD 450 Therefore, it can be determined that 5% inoculation amount is the optimal inoculation amount of Clostridium butyricum and Andrographis paniculata fermentation broth.

[0122] 1.2.6 Cytotoxicity test of Clostridium butyricum and co-fermentation products

[0123] By comparing the OD values ​​of IPEC-J2 cells and the empty cell control group after 6 h of culture by adding different concentrations of co-fermentation products and Clostridium butyricum, the 450 The ratio of the co-fermentation products was not statistically different from that of the control group, indicating that the co-fermentation products had no obvious cytotoxicity. 5 There was a significant difference between the control group (* P <0.05), and OD 450 higher than the control group, indicating that Clostridium butyricum has a growth-promoting effect on cells. Figure 3 .

[0124] Example 2 Evaluation of the effect of co-fermentation of Clostridium butyricum and Andrographis paniculata on preventing PEDV in piglets

[0125] In this example, the decoction of Andrographis paniculata, which has an antagonistic effect on PEDV, screened out in Example 1, was co-fermented with Clostridium butyricum, and the 3-day-old piglets divided into groups were gavaged with Clostridium butyricum and Andrographis paniculata decoction and fermentation broth daily to conduct a virus protection test. The study used a variety of detection techniques such as ELISA, flow cytometry, qPCR and H&E staining to detect and analyze indicators such as weight changes in piglets, IL-6, IFN-β, TNF-α, IL-1β in serum, sIgA content in intestinal contents, activation of peripheral and tissue-resident immune cells, and pathological changes in the small intestine of piglets. The final results showed that the fermentation broth of Andrographis paniculata and Clostridium butyricum showed significant efficacy in preventing porcine epidemic diarrhea.

[0126] 2.1 Materials and methods

[0127] 2.1.1 Materials

[0128] 2.1.1.1 Experimental animals: Twelve healthy 3-day-old newborn piglets were randomly divided into 4 groups, 3 in each group, and raised in isolation.

[0129] 2.1.1.2 Experimental strains: Clostridium butyricum was purchased from Beina Biotechnology (BNCC337239), and TOP10 competent cells were purchased from Shanghai Biotech Biotechnology Co., Ltd.

[0130] 2.1.1.3 Main reagents: ELISA kits for porcine interleukin 1β, porcine interleukin 6, porcine interferon β, porcine tumor necrosis factor α, and porcine secretory immunoglobulin A were purchased from ELISA (Jiangsu) Industrial Co., Ltd. EasyPureViral DNA / RNA Kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd. Agarose gel recovery kit and plasmid extraction kit were purchased from Omega. Reverse transcription kit and universal real-time fluorescence quantitative kit were purchased from Tianjin Yiyuan Likang Biotechnology Co., Ltd. pMD19-T ligation kit and 5×SDS PAGE Loading Buffer were purchased from Dalian TaKaRa Co., Ltd.

[0131] 2.1.1.4 Main instruments: CO2 incubator, microplate spectrophotometer, fluorescence inverted microscope, low-temperature desktop high-speed centrifuge, gel imaging analysis system, UV-visible spectrophotometer electrophoresis instrument, flow cytometer, fully automatic tissue homogenization system.

[0132] 2.1.2 Methods

[0133] 2.1.2.1 Experimental animal grouping and immunization procedures

[0134] Twelve newborn 3-day-old piglets were selected and randomly divided into 4 experimental groups, 3 piglets in each group, namely PEDV group, Andrographis group, Clostridium butyricum group, and Andrographis and Clostridium butyricum co-fermentation group. Except for the PEDV group, which was gavaged with PBS, the other groups were gavaged with the corresponding drugs at a dose of 1×10 9 cfu / mL of Clostridium butyricum and fermentation products, and the weight of each pig was monitored and recorded daily to evaluate the average daily weight gain. At the same time, the fecal status of each group was observed daily. PEDV was challenged 10 days later with a challenge dose of 10 4 TCID 50 After the virus attack, fecal samples were collected daily, blood was collected every three days, and survival status was recorded. When all the piglets in the PEDV group developed diarrhea, all piglets were slaughtered and all indicators were fully tested.

[0135] 2.1.2.2 Growth performance index testing

[0136] Measuring piglet weight: Measure the weight of piglets once a day and record the weight data to track weight changes and draw a weight change curve to better understand the growth and development of piglets.

[0137] 2.1.2.3 ELISA method

[0138] After the challenge, 5 mL of blood was collected from the anterior vena cava of each piglet, centrifuged at 4000 rpm for 10 min to separate the serum, and stored in a refrigerator at -80°C. The levels of IFN-β, TNF-α, IL-1β, and IL-6 in serum and the level of sIgA in intestinal contents were evaluated by ELISA.

[0139] 2.1.2.4 Flow cytometry

[0140] 1. Preparation of Cell Samples

[0141] Preparation of piglet spleen cell suspension: Take an appropriate amount of spleen tissue, cut into pieces, add 1 mL of 1640 culture medium, grind into cell suspension on a sterile copper mesh, and centrifuge at 4°C, 500×g for 5 min. After discarding the supernatant, add erythrocyte lysis buffer to lyse the red blood cells, and centrifuge at 4°C, 500×g for 5 min. Discard the supernatant, wash twice with PBS, and finally resuspend the cells with 1 mL PBS and count the cells. Preparation of piglet mesenteric lymph node cell suspension: No red blood cell lysis is required, and the rest of the steps are the same as above.

[0142] 2. Antibody staining for flow cytometry

[0143] (1) Dispense the prepared cell samples into flow cytometry tubes, ensuring that each tube contains 1×10 6cells. (2) According to the antibody concentration requirements, accurately add the corresponding cell surface marker fluorescent antibody. (3) Gently shake to mix to ensure that the antibody is evenly attached, and then stand at 4 ℃ for 30 min in a light-proof environment. (4) After incubation, add 1 mL PBS to the flow tube, centrifuge at 4 ℃, 500×g for 5 min, discard the supernatant, and resuspend the cells with PBS. (5) Repeat step (4) to completely remove unbound antibodies to reduce nonspecific cell surface staining.

[0144] 2.1.2.5 H&E staining to detect intestinal pathological changes

[0145] The intestinal segments of the duodenum, jejunum and ileum of piglets were collected and fixed in 4% paraformaldehyde solution for one week. The fixed tissues were sampled, dehydrated, embedded, and finally sliced, dewaxed, and stained with hematoxylin-eosin.

[0146] 2.1.2.6 Determination of viral load in small intestine of piglets by real-time fluorescence quantitative PCR

[0147] 2.1.2.6.1 Construction of standard plasmid:

[0148] 1) Extraction of PEDV viral RNA: PEDV viral RNA was extracted using the Beijing Quanshijin Biotechnology EasyPure Viral DNA / RNA Kit.

[0149] 2) Reverse transcription: Use a reverse transcription kit to reverse transcribe PED virus RNA into cDNA. The experimental method is as follows:

[0150] Step 1: Thaw the template RNA and reagents on ice, and centrifuge briefly before use to collect the liquid on the tube wall to the bottom of the tube. Step 2: Prepare the following reaction system on ice in an RNase free tube: Total RNA / mRNA 0.1-2 µg, 5×RTMasterMix 4 µL, 20×Oligo dT&Random Primer 1 µL, and RNase free H2O to make up to 20 µL. Step 3: Mix by gently pipetting, put into the PCR instrument and run the following program: 85 ℃, 5 min; 55 ℃, 45 min; 85 ℃, 5 min.

[0151] 3) Based on the GenBank gene sequence, the conserved region sequence of the S protein of PEDV was found using DNAStar software, and gene synthesis and PCR and qPCR universal primer design and synthesis were performed. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer names and sequences are as follows:

[0152] PEDV-NF: CGCAAAGACTGAACCCACTAACTT (SEQ ID NO: 2);

[0153] PEDV-NR:TTGCCTCTGTTGTTACTCGGGGAT (SEQ ID NO: 3).

[0154] 4) cDNA is amplified by PCR. The amplification system and procedure are as follows:

[0155] PCR reaction system: 2×SanTaq PCR Mix 25 µL, DNA template 1 µL, upstream primer 2 µL, downstream primer 2 µL, and RNase-Free ddH2O to make up to 50 µL.

[0156] PCR reaction program: pre-denaturation at 94 °C, 5 min; denaturation at 94 °C, 30 s; annealing at 60 °C, 30 s; extension at 72 °C, 30 s; denaturation, annealing, extension, 35 cycles; final extension at 72 °C, 10 min; storage at 4 °C.

[0157] 5) DNA agarose gel electrophoresis and product recovery

[0158] According to the instructions of the agarose gel DNA recovery kit, the amplified PCR product was electrophoresed on 1% agarose gel, and the subsequent steps were strictly carried out according to the instructions. In the last step, 30 µL ddH2O was added to dissolve it, and the recovered DNA was stored at -20℃ for later use.

[0159] 6) The gel-recovered product was connected to pMD19-T to construct the recombinant plasmid pMD-PEDV.

[0160] Use the pMD19-T ligation kit to ligate the gel-purified PCR product to the T vector to construct the recombinant plasmid. pMD19-T ligation system: pMD19-T Vecter 1 µL, Insert DNA 4 µL, Solution Ⅰ 5 µL.

[0161] The reaction conditions were: 16°C for 30 min, and all the above steps were performed on ice.

[0162] 7) Transformation and screening of recombinant plasmids

[0163] Add the recombinant plasmid pMD-PEDV to DH5α competent cells, incubate on ice for 30 min, then heat shock in a 42 ℃ metal bath for 90 s, and cool the reaction solution on ice. Finally, add LB liquid culture medium to the centrifuge tube and place it in a 37 ℃ shaker for 1 h. After 1 h, centrifuge the revived bacterial solution at 8000 rpm for 5 min, pour off the supernatant, and resuspend the precipitate in 200 µL LB liquid culture medium. Take 100 µL of bacterial solution and spread it on LB solid culture medium containing ampicillin, invert it in a 37 ℃ incubator, and culture it for 12-14 h. Pick a single colony on the plate, inoculate it in LB liquid culture medium containing ampicillin, and place it in a 37 ℃ shaker for 12-14 h.

[0164] 8) Extraction and identification of recombinant plasmid

[0165] The recombinant plasmid was extracted using a plasmid extraction kit according to the instructions and sent to Sangon Biotech Co., Ltd. for sequencing.

[0166] 9) Establishment of standard curve

[0167] Establishment of standard curve of fluorescence quantitative PCR: Use universal fluorescence quantitative PCR kit of biosharp company, with dilution of 10 -1 ~10 -8 The recombinant plasmid was used as a template for fluorescence quantitative PCR amplification to obtain the PEDV amplification standard curve. The primer design is shown in Table 2-1, and the qPCR reaction system and procedure are as follows;

[0168] qPCR reaction system: 2×Universal SYBR qPCR Mix 10 µL, Primer F (10 µm) 0.5 µL, Primer R (10 µm) 0.5 µL, cDNA template 1 µL, ROX Reference Dye 0.4 µL, and RNase-FreeddH2O 7.6 µL.

[0169] qPCR reaction program: pre-denaturation at 95 °C, 2 min; denaturation at 95 °C, 15 s; annealing at 60 °C, 30 s; extension at 72 °C, 30 s; the number of cycles of denaturation, annealing, and extension was 40.

[0170] 2.1.2.6.2 Piglet Intestinal qPCR Method:

[0171] 1) RNA extraction: Collect the duodenum, jejunum, and ileum of piglets, freeze them in liquid nitrogen, and store them at -80. When using, cut the intestinal segments into small pieces of equal weight, put them in a 1.5 mL centrifuge tube, add 1 mL Trizol to grind and homogenize, and extract tissue RNA. 2) Reverse transcription of cDNA: Same as the reverse transcription method above 3) qPCR determination of viral load: Same as the PCR system and reaction procedure constructed above.

[0172] 2.1.3 Statistical analysis of data

[0173] Graph Prism 10.0 software was used to collect and analyze the results, which were expressed as MEAN±SD. The differences between the groups were analyzed using one-way ANOVA (* P <0.05;** P <0.01;*** P <0.001).

[0174] 2.2 Results

[0175] 2.2.1 Growth performance index test results: During the experiment, the weight changes of piglets were recorded every day, such as Figure 4 It can be seen that before the virus attack, the overall weight of the piglets showed an upward trend, which indicates that the piglets are in good growth condition. On the tenth day of the experiment, the piglets were infected with PEDV, and it was found that the weight of the PEDV group and the Andrographis group showed a downward trend, among which the weight loss of the PEDV group was the most significant. The weight of the piglets in the Clostridium butyricum group and the co-fermentation group was still on an upward trend and was not affected by the PEDV virus infection. This shows that feeding Clostridium butyricum and Andrographis butyricum co-fermentation products can resist PEDV infection to a certain extent and alleviate the sudden weight loss caused by PEDV to a large extent.

[0176] 2.2.2 H&E staining: After the piglets were slaughtered, the corresponding intestinal segments of the jejunum and the middle ileum were selected from each experimental group, dehydrated and embedded, and made into paraffin sections. The pathological characteristics of these sections were carefully analyzed using the H&E staining technique. Figure 5 The results showed that the PEDV group had obvious pathological changes in the ileum, and the red arrows showed severe atrophy and shedding of the small intestinal villi. Shedding tissue and cell fragments were visible in the intestinal cavity, the height of the jejunal small intestinal villi was reduced, and the intestinal villi were slightly shedding; compared with the PEDV control group, the Andrographis paniculata-treated group showed relatively mild symptoms, characterized by local villus damage in the intestinal mucosa, bleeding spots in the jejunum and ileum, and an increase in the number of inflammatory cells. In contrast, the jejunal and ileal tissues of the Clostridium butyricum group and the combined fermentation product group did not show significant pathological changes. This suggests that the Clostridium butyricum group and the co-fermentation product group showed superior protective effects against pathological changes in the small intestine of piglets, and their effects were more significant than those of the PEDV group and the Andrographis paniculata group.

[0177] 2.2.3 Determination of PEDV viral load in the small intestine of piglets: RNA extracted from the duodenum, jejunum, and ileum of each group of piglets was reverse transcribed into cDNA, and the viral load was determined using real-time fluorescence quantitative PCR.

[0178] 1) Duodenum qPCR test results, from Figure 6 It can be seen that there are significant differences between the PEDV group and the Andrographis paniculata group, Clostridium butyricum group, and co-fermentation group (*** P <0.001), while the other groups had no significant differences. This indicates that the Chinese herbal medicine water extract of Andrographis paniculata, Clostridium butyricum, and the co-fermentation products of Andrographis paniculata Clostridium butyricum can inhibit the proliferation of viruses in the duodenum and have a protective effect on piglets.

[0179] 2) Jejunum qPCR test results, from Figure 7 It can be seen that the PEDV group was significantly different from the other three groups (*** P <0.001), indicating that the Chinese herbal medicine water extract of Andrographis paniculata, Clostridium butyricum, and the co-fermentation products of Andrographis paniculata Clostridium butyricum can inhibit the proliferation of viruses in the jejunum. Among them, the co-fermentation group had the lowest viral copy number, and the difference was significant compared with the Clostridium butyricum group (** P <0.01), which is speculated to have the best inhibitory effect on the virus.

[0180] 3) Ileum qPCR test results, from Figure 8 It can be seen that the PEDV group was significantly different from the other three groups (*** P <0.001), indicating that the Chinese herbal medicine water extract of Andrographis paniculata, Clostridium butyricum, and the co-fermentation product of Andrographis paniculata Clostridium butyricum can inhibit the proliferation of the virus in the ileum, among which the Andrographis paniculata group was significantly different from the Clostridium butyricum group and the co-fermentation product group (*** P <0.001). The co-fermentation product group had the best effect in terms of virus copy number, indicating that the co-fermentation product had a good preventive effect on PEDV virus and could be used as a drug to prevent PEDV infection in piglets.

[0181] 2.2.4 Test results

[0182] 2.2.4.1 IL-6 test results: Interleukin-6 (IL-6) is mainly secreted by immune cells and is related to inflammatory stimulation. When the body has an inflammatory response, the IL-6 index shows an upward trend. Fig. 9 The results showed that the IL-6 index in the serum of piglets after infection with PEDV was significantly increased (* P <0.05), and there were significant differences compared with the Andrographis paniculata group, Clostridium butyricum group, and co-fermentation product group (* P<0.05). This indicates that after piglets were infected with PEDV, the level of cytokine IL-6 in the body increased, and the levels of IL-6 in the serum of the Andrographis paniculata group, Clostridium butyricum group, and co-fermentation product group decreased significantly, indicating that it has the effect of reducing inflammatory response.

[0183] 2.2.4.2 IFN-β test results: Interferon-β (IFN-β) is a group of active proteins with multiple functions synthesized and released by immune cells in the body when the body is infected by a virus. It plays a very important role in the body's immune system. Virus-infected cells can release interferon, thereby improving the defense capabilities of surrounding cells against viruses. Fig.10 The results showed that there was a significant difference in IFN-β in the serum of piglets after the challenge. P <0.05) and co-fermentation group (** P <0.01) in the serum IFN-β content was significantly higher than that in the PEDV group, which indicates that feeding Andrographis paniculata and co-fermentation products can promote the secretion of IFN-β by cells to improve the antiviral ability of piglets, especially in the co-fermentation group.

[0184] 2.2.4.3 TNF-α test results: TNF-α, as a pro-inflammatory factor, not only participates in the systemic inflammatory response, but is also one of the cytokines that stimulate the acute phase response. The results showed that after the challenge, the TNF-α content in the serum of the Andrographis paniculata group and the co-fermentation product group was significantly lower than that of the PEDV group (* P <0.05), indicating that after the virus attack, a large number of inflammatory factors accumulated, leading to an inflammatory response in the body. The Andrographis paniculata group, Clostridium butyricum group and co-fermentation product group could significantly reduce the TNF-α content in the blood, thereby alleviating the inflammatory response of the animal body. Fig.11 .

[0185] 2.2.4.4 IL-1β test results: Interleukin-1β (IL-1β) is mainly produced by mononuclear macrophages and is an important cytokine and polypeptide regulator. As a key proinflammatory cytokine, IL-1β is involved in a variety of autoimmune inflammatory responses and a variety of cellular activities, including cell proliferation, differentiation and apoptosis. IL-1β is one of the most important mediators of inflammation and host response to infection. Increased IL-1β production has been found in patients with viral, bacterial, fungal and parasitic infections. Fig.12 It can be seen that after the virus attack, the content of IL-1β in the serum of the PEDV group was significantly higher than that of the Andrographis paniculata group (** P <0.01), co-fermentation product group (*** P <0.001) and Clostridium butyricum group (*** P<0.001). This indicates that after the virus attack, the piglets were infected by the virus, which stimulated the body to secrete a large amount of IL-1β, thereby producing an inflammatory response. Feeding Andrographis paniculata, Clostridium butyricum and co-fermentation products can reduce inflammatory symptoms by inhibiting the secretion of IL-1β by host immune cells, thus protecting the host infected with PEDV.

[0186] 2.2.4.5 sIgA test results: Secretory immunoglobulin (sIgA) is one of the main components of the body's mucosal immune system and is widely distributed in milk, saliva, and animal mucosal secretions. sIgA can slow down the reproduction of viruses by inhibiting their attachment to mucosal epithelial cells, and plays an important role in the mucosal immune barrier. sIgA has certain antibody activity against some viruses and bacteria, and is an important line of defense against viral infection of the body. The experiment collected colon contents from infected piglets and tested the sIgA content using an ELISA kit. The results are as follows: Fig.13 The levels of sIgA in the intestinal contents of piglets fed with Andrographis paniculata and co-fermented products after challenge were significantly higher than those in the PEDV group (* P <0.05). In addition, the content of sIgA in the colon contents of piglets in the co-fermentation product group was significantly higher than that in the PEDV group (*** P <0.001). This suggests that feeding Andrographis paniculata or co-fermentation products can inhibit PEDV infection by promoting the secretion of sIgA, thereby protecting the health of the intestinal mucosa.

[0187] 2.2.5 Flow cytometry to detect changes in T lymphocytes:

[0188] 2.2.5.1 Effect of co-fermentation products of Andrographis paniculata and Clostridium butyricum on T cells: When piglets are infected with PEDV, their immune system will produce a series of immune responses to eliminate the virus and protect the animal body from further damage, including cellular immune responses. Therefore, the experiment detected the percentage of activated T cells in the spleen by flow cytometry, such as Fig.14 The results showed that CD8 + IFN-γ + The cell content increased significantly (** P <0.01), among which CD8 + IFN-γ + The number of cells was the highest compared with other groups. This showed that after infection with PEDV, the co-fermentation products of Clostridium butyricum, Andrographis paniculata and Clostridium butyricum could stimulate T cell activation and produce a large number of cytokines, thereby enhancing the body's immune response and exerting immunomodulatory and antiviral effects.

[0189] 2.2.5.2 Effects of co-fermentation products of Andrographis paniculata and Clostridium butyricum on B cells: It is well known that B cells play a vital role in humoral immune response and intestinal mucosal immunity. They can protect the body from pathogens and maintain the function and stability of the immune system by producing antibodies and participating in other immune regulatory processes. IgA is the main antibody of intestinal mucosal immunity and plays an important role in intestinal mucosal immunity. It can neutralize pathogens, prevent them from binding to intestinal epithelial cells, promote the clearance of pathogens, and participate in regulating the balance of intestinal microbiota. Therefore, the experiment used flow cytometry to detect CD21 in piglet MLN. + IgA + The number of cells, such as Fig.15 The results showed that feeding Andrographis paniculata extract, Clostridium butyricum liquid, and Andrographis paniculata and Clostridium butyricum co-fermentation products could significantly increase the number of B cells in the mesenteric lymph nodes (** P <0.01), but the IgA content in the mesenteric lymph nodes of piglets fed with the co-fermentation product of Andrographis paniculata and Clostridium butyricum was the highest ( ***P <0.001). This indicates that after piglets are infected with PEDV, their intestinal B cells can protect the intestinal mucosal surface by producing a large amount of IgA, prevent the invasion and adhesion of the virus, and maintain the function and stability of the intestinal immune system.

[0190] 2.2.5.3 Effects of co-fermentation products of Andrographis paniculata and Clostridium butyricum on DC cells and NK cells: DC cells and NK cells in the spleen were detected by flow cytometry. Fig.16 The experimental results showed that the number of NK cells in the spleen of piglets in the co-fermentation product group was significantly higher than that in the PEDV group, while there was no difference in the number of NK cells in the PEDV group, the Andrographis group, and the Clostridium butyricum group, indicating that oral co-fermentation products can significantly increase the number of NK cells in piglets (* P <0.05). Similarly, the number of DC cells in the piglets fed with the co-fermented products group was significantly different from that in the PEDV group, the Andrographis group, and the Clostridium butyricum group (* P <0.05), indicating that the ability of the co-fermentation group in promoting DC cell proliferation was superior to that of the PEDV group, Andrographis paniculata group and Clostridium butyricum group.

[0191] The above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the above embodiments, those skilled in the art can still modify the technical solutions described in the above embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A composition for preventing and controlling PEDV infection in piglets, characterized in that: The composition is a co-fermentation product of Andrographis paniculata and Clostridium butyricum; Wherein, the Andrographis paniculata is Andrographis paniculata decoction, and the Clostridium butyricum is Clostridium butyricum BNCC337239; The co-fermentation product is obtained by co-fermenting Clostridium butyricum and Andrographis paniculata, wherein the co-fermentation conditions include a fermentation time of 12-36 hours, a fermentation temperature of 28-40° C., an initial fermentation pH of 6.0-7.5, an inoculation amount of Clostridium butyricum of 0.05-50% of the total volume of the liquid culture medium, and an addition amount of Andrographis paniculata decoction of 4-8% of the total volume of the liquid culture medium.

2. A method for preparing the composition for preventing and controlling PEDV infection in piglets according to claim 1, characterized in that: include: A decoction of Andrographis paniculata is prepared, and the decoction of Andrographis paniculata is co-fermented with Clostridium butyricum in a liquid culture medium to obtain a fermentation product; wherein the co-fermentation conditions include a fermentation time of 12-36 hours, a fermentation temperature of 28-40°C, an initial fermentation pH of 6.0-7.5, an inoculation amount of Clostridium butyricum of 0.05-50% of the total volume of the liquid culture medium, and an addition amount of the decoction of Andrographis paniculata is 4-8% of the total volume of the liquid culture medium.

3. The method according to claim 2, characterized in that The preparation method of the Andrographis paniculata decoction comprises: grinding the Andrographis paniculata, soaking it in water and then boiling it, taking the supernatant and centrifuging it, and continuing to boil and concentrate it to a required volume.

4. A composite preparation, characterized in that The compound formulation comprises the composition for preventing and controlling PEDV infection in piglets according to claim 1.

5. The composite formulation according to claim 4, characterized in that The compound preparation is a medicine or a feed additive.

6. Use of the composition for preventing and controlling PEDV infection in piglets according to claim 1 or the composite formulation according to claim 4 or 5 in the preparation of a drug or feed additive for preventing and / or controlling porcine epidemic diarrhea.

7. Use of the composition according to claim 1 or the composite preparation according to claim 4 or 5 in the preparation of antiviral drugs, immunopotentiators and / or anti-inflammatory preparations; in, The antiviral agent is anti-porcine epidemic diarrhea virus; The immunopotentiator is an immunopotentiating feed additive; The anti-inflammatory preparation is a feed additive for alleviating inflammatory bowel diseases or a therapeutic drug for intestinal inflammation.

Images