Application of MAPK4 as a target in the preparation of a drug for treating endometrial cancer and a targeted inhibitor for treating endometrial cancer

Abstract

The present invention provides an application of MAPK4 as a target in the preparation of a drug for treating endometrial cancer and a targeted inhibitor for treating endometrial cancer. Among them, the present invention finds that MAPK4 can be used as a target to prepare a drug for treating endometrial cancer. Based on the above application of the present invention, the problem of the lack of effective drugs for targeted treatment of endometrial cancer in the prior art can be solved, and the present invention is applicable to the field of medicine and health.

Description

Technical Field

[0001] The present invention relates to the field of medicine and health, and in particular to an application of MAPK4 as a target in the preparation of a drug for treating endometrial cancer and a targeted inhibitor for treating endometrial cancer. Background Art

[0002] Endometrial cancer (EC) is an epithelial malignant tumor that originates in the endometrium. It is also called uterine body cancer and mostly occurs in perimenopausal and postmenopausal women. Cancer statistics show that the incidence of EC has ranked first among malignant tumors of the female reproductive system and continues to rise[1]. The treatment of EC is mainly surgical, supplemented by comprehensive treatments such as radiotherapy, chemotherapy, and hormones. Although the prognosis of early patients is good, patients rapidly progress to the terminal stage after tumor recurrence or metastasis, and there is a lack of effective therapeutic drugs in clinical treatment. For advanced and metastatic EC, the standard first-line treatment is systemic chemotherapy, with a progression-free survival of approximately 13 months[2], and about half of patients experience disease recurrence or progression[3]. In order to effectively improve the survival rate of patients with advanced, recurrent, or metastatic EC, it is necessary to clarify the occurrence and development mechanism of EC, identify effective drug targets, and find prognostic markers, which are key technical bottlenecks that need to be broken through.

[0003] The mitogen-activated protein kinase (MAPKs) signaling pathway is activated by extracellular signals such as growth factors, oxidative stress, and inflammatory factors. It transmits cell signals through a three-level kinase cascade (MAPKKK→MAPKK→MAPK), regulates the transcription and expression of related genes in mammalian cells, and thus regulates biological processes such as cell proliferation, differentiation, apoptosis, inflammatory response, and angiogenesis [4,5]. In about 30% of tumors, molecules related to the RAS-RAF-MEK-ERK signaling pathway are in an abnormally activated state [6]. Mutations and abnormal expressions of molecules in each family of this pathway play a key regulatory role in the occurrence and development of a variety of malignant tumors. At present, a number of RAF inhibitors and MEK inhibitors have been used in clinical treatment and have achieved good therapeutic effects. Compared with RAF and MEK inhibitors, the development of ERK inhibitors is relatively lagging, but the targeted treatment strategy of specifically blocking the RAS-RAF-MEK-ERK signaling pathway with ERK as the target is attracting the attention of researchers. As a key downstream molecule in the signaling pathway, inhibiting ERK can not only block the ERK signaling pathway, but also overcome drug resistance caused by mutations in upstream molecules, so it has more important application value. Although no ERK inhibitor has been officially approved for clinical treatment, some small molecule compounds targeting ERK are in the clinical or preclinical research stage. Among them, the ERK1 / 2 inhibitor Ulixertinib has undergone multiple clinical trials. The intended indications for development cover gastrointestinal tumors, pancreatic cancer, acute myeloid leukemia, breast cancer, non-Hodgkin's lymphoma, bladder cancer, melanoma and other diseases, including 2 Phase II clinical trials, which is currently the fastest-progressing drug of its kind.

[0004] MAPK4, also known as ERK4 or P63MAPK4, is an atypical MAPK that lacks the typical Thr-X-Tyr activation motif for phosphorylation and activation by MAPK kinase (MAPKK)[7]. Currently, little is known about the physiological functions of MAPK4 and its role in diseases including cancer. Studies have shown that MAPK4 directly binds to and phosphorylates the T308 site of AKT, while activating mTORC2 to phosphorylate the S473 site of AKT, fully activating it and promoting tumor progression through an atypical AKT / mTOR activation pathway that is independent of PI3K / PDK1[7]. In prostate cancer, MAPK4 activates androgen receptor signaling by enhancing GATA2 expression and inhibiting GATA2 protein ubiquitination and degradation, and synergizes with the AKT pathway to promote prostate cancer cell growth[8]. In most triple-negative breast cancers (TNBC), MAPK4 is highly expressed. Inhibiting MAPK4 in human TNBC cells that highly express MAPK4 can greatly inhibit AKT activation, inhibit cell proliferation, cell growth, and xenograft growth in vivo, and enhance their sensitivity to PI3K inhibitors [9]. In TNBC and cervical cancer cells, knocking out MAPK4 can inhibit AKT activity, promote DNA double-strand breaks, and enhance their sensitivity to radiotherapy and PARP1 inhibitors [10,11]. On the other hand, MAPK4 can cooperate with ERK3 to co-activate MK5, thereby activating MK5 downstream molecules such as HSP27 to promote cancer

[12] . In contrast, in gastric cancer cells, inhibiting MAPK4 mediates a positive feedback loop between cancer cells and tumor-associated macrophages, which promotes gastric cancer liver metastasis

[13] . Therefore, MAPK4 plays an important role in the progression of cancer, and its role is different in different cancer types. There is no research report on the role of MAPK4 in endometrial cancer.

[0005] Arenobufagin (ARE) is one of the main bufadienoic acid lactone compounds in toad skin. It is the main pharmacological component of the traditional Chinese medicine toad venom and several well-known Chinese patent medicines such as toad venom injection and cinobufagin injection. It is used in chemotherapy or combined treatment of tumors in China

[14] . At present, many experimental and clinical studies have shown that ARE has significant anti-tumor activity against breast cancer, non-small cell lung cancer, liver cancer and gastric cancer [15-19]. A patent has preliminarily proved that ARE inhibits the proliferation of human endometrial cancer cell line (ishikawa). However, the biological characteristics of different tumor cell lines are different. No study has verified the effect of ARE on other EC cell lines, especially primary cultured cells. In addition, no study has reported the molecular mechanism by which ARE inhibits EC cell proliferation. Summary of the invention

[0006] The main purpose of the present invention is to provide an application of MAPK4 as a target in the preparation of a drug for treating endometrial cancer and a targeted inhibitor for treating endometrial cancer, so as to solve the problem of lack of effective drugs for targeted treatment of endometrial cancer in the prior art.

[0007] In order to achieve the above object, according to a first aspect of the present invention, there is provided a use of MAPK4 as a target in the preparation of a drug for treating endometrial cancer.

[0008] Furthermore, the application includes the use of an agent that targets and inhibits MAPK4 in the preparation of a drug for treating endometrial cancer.

[0009] Furthermore, the reagent includes a nucleic acid molecule or bufotoxin that can target and inhibit MAPK4.

[0010] Furthermore, the nucleic acid molecule includes siRNA or shRNA.

[0011] Further, the siRNA includes the sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; SEQ ID NO: 1: UGUCGAUGGCUUUGGUGUAGU; SEQ ID NO: 2: AUCUUCUUCACAGCGACCUUC; SEQ ID NO: 3: UGUCGAUGGCUUUGGUGUAGUTT; SEQ ID NO: 4: AUCUUCUUCACAGCGACCUUCTT.

[0012] Further, the target nucleotide of shRNA is as shown in SEQ ID NO: 5 or SEQ ID NO: 6; SEQ ID NO: 5: gatcgcgcagtgggtcaagag; SEQ ID NO: 6: gcgacctcaatggtgcgtgca; preferably, the DNA chain of shRNA is as shown in SEQ ID NO: 7 or SEQ ID NO: 8; SEQ ID NO: 7: CCGGgatcgcgcagtgggtcaagagTTCAAGAGActcttgacccactgcgcgatcTTTTTT; SEQ ID NO: 8: CCGGgcgacctcaatggtgcgtgcaTTCAAGAGAtgcacgcaccattgaggtcgcTTTTTT.

[0013] Furthermore, drugs for treating endometrial cancer include endometrial cancer cell proliferation inhibitors.

[0014] Furthermore, drugs for treating endometrial cancer include endometrial cancer cell G2 / M cycle inhibitors.

[0015] To achieve the above object, according to a second aspect of the present invention, a targeted inhibitor for treating endometrial cancer is provided. The targeted inhibitor comprises a nucleic acid molecule or bufotoxin capable of targeted inhibition of MAPK4.

[0016] Further, the nucleic acid molecule includes siRNA or shRNA; preferably, the siRNA includes the sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; SEQ ID NO: 1: UGUCGAUGGCUUUGGUGUAGU; SEQ ID NO: 2: AUCUUCUUCACAGCGACCUUC; SEQ ID NO: 3: UGUCGAUGGCUUUGGUGUAGUTT; SEQ ID NO: 4: AUCUUCUUCACAGCGACCUUCTT. Preferably, the target nucleotide of shRNA is as shown in SEQ ID NO: 5 or SEQ ID NO: 6; SEQ ID NO: 5: gatcgcgcagtgggtcaagag; SEQ ID NO: 6: gcgacctcaatggtgcgtgca; Preferably, the chain of DNA expressing shRNA is as shown in SEQ ID NO: 7 or SEQ ID NO: 8; SEQ ID NO: 7: CCGGgatcgcgcagtgggtcaagagTTCAAGAGActcttgacccactgcgcgatcTTTTTT; SEQ ID NO: 8: CCGGgcgacctcaatggtgcgtgcaTTCAAGAGAtgcacgcaccattgaggtcgcTTTTTT.

[0017] In the present application, the inventors have discovered that endometrial cancer can be treated by inhibiting MAPK4. By applying the technical solution of the present invention, the above-mentioned reagent for targeted inhibition of MAPK4 can be used to prepare a drug for treating endometrial cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0019] Figure 1A Immunohistochemical results of EC tumor and normal tissues are shown.

[0020] Figure 1BThe Western Blot protein detection results of EC patient tumors and paired normal tissues are shown.

[0021] Figure 2A The qRT-PCR experiment according to Example 3 of the present invention verifies the efficiency of siRNA knockdown of MAPK4.

[0022] Figure 2B The figure shows the efficiency of knocking down MAPK4 by siRNA verified by Western blot according to Example 3 of the present invention.

[0023] Figure 2C It was shown that knocking down MAPK4 according to Example 3 of the present invention significantly inhibited the proliferation activity of EC cells.

[0024] Figure 2D It was shown that knocking down MAPK4 according to Example 3 of the present invention significantly inhibited the EC cell clone formation ability.

[0025] Figure 2E It is shown that knocking down MAPK4 according to Example 3 of the present invention can induce G2 / M cell cycle arrest in cells.

[0026] Figure 2F It is shown that knocking down MAPK4 according to Example 3 of the present invention can induce G2 / M cell cycle arrest in cells.

[0027] Figure 3A The figure shows the Western blot verification of the stable knockout efficiency of MAPK4 according to Example 4 of the present invention.

[0028] Figure 3B It is shown that knocking out MAPK4 according to Example 4 of the present invention can significantly inhibit cell proliferation activity.

[0029] Figure 3C It is shown that knocking out MAPK4 according to Example 4 of the present invention can significantly inhibit the growth of nude mouse transplanted tumors.

[0030] Figure 4A A volcano plot of differentially expressed genes in RNA-seq sequencing between the ARE treatment group and the control group according to Example 5 of the present invention is shown.

[0031] Figure 4B The KEGG enrichment analysis of differentially regulated genes after ARE treatment according to Example 5 of the present invention is shown.

[0032] Figure 4C The results show that EC cells were treated with different concentrations of ARE for 24 hours to detect changes in cell proliferation activity according to Example 5 of the present invention.

[0033] Figure 4DThe results show the changes in cell proliferation activity detected after EC cells were treated with different concentrations of ARE for 48 hours according to Example 5 of the present invention.

[0034] Figure 4E The figure shows the changes in the cell cycle after cells were treated with 0.2 μM and 0.4 μM ARE according to Example 5 of the present invention for 12 hours.

[0035] Figure 4F The figure shows the changes in the cell cycle after cells were treated with 0.2 μM and 0.4 μM ARE according to Example 5 of the present invention for 12 hours.

[0036] Figure 4G The figure shows that cells were treated with 0.2 μM and 0.4 μM ARE according to Example 5 of the present invention for 24 hours, and G2 / M cell cycle proteins were detected by Western blot.

[0037] Figure 4H The figure shows the changes in cell proliferation activity detected by treating EC primary cells with different concentrations of ARE for 48 hours according to Example 5 of the present invention.

[0038] Fig. 4I It shows that EC cells were treated with 0.2 μM and 0.4 μM ARE according to Example 5 of the present invention, and the clone formation ability of the cells was detected.

[0039] Figure 4J It is shown that according to Example 5 of the present invention, AN3 CA and HEC-1-B cells were subcutaneously injected to form transplanted tumors, and the changes in the size and weight of the transplanted tumors were observed after intraperitoneal injection at a dose of 3 mg / Kg.

[0040] Figure 5A The graph shows that EC cells were treated with 0.2 μM and 0.4 μM ARE according to Example 6 of the present invention to detect the protein expression level of MAPK4.

[0041] Figure 5B The figure shows that EC cells were treated with 0.2 μM ARE and then transfected with a MAPK4 overexpression plasmid according to Example 6 of the present invention, and the transfection efficiency was verified by Western blot.

[0042] Figure 5C It is shown that the proliferation activity of the cells was restored by overexpressing MAPK4 in EC cells treated with 0.2 μM ARE according to Example 6 of the present invention.

[0043] Figure 5D It is shown that the clone formation ability of the cells was restored by overexpressing MAPK4 in EC cells treated with 0.2 μM ARE according to Example 6 of the present invention. DETAILED DESCRIPTION

[0044] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0045] As mentioned in the background art, there is a lack of effective drugs in the prior art that can achieve targeted treatment of endometrial cancer. In this application, the inventor attempts to explore the mechanism of action of targeted treatment of endometrial cancer and finds that endometrial cancer can be treated by inhibiting MAPK4. This mechanism of action can be used to develop drugs for the treatment of endometrial cancer, and thus proposes a series of protection schemes for this application.

[0046] In a first typical embodiment of the present application, a method for using MAPK4 as a target in the preparation of a drug for treating endometrial cancer is provided.

[0047] MAPK4, also known as ERK4 or P63MAPK4, is an atypical MAPK that lacks the typical Thr-X-Tyr activation motif for phosphorylation and activation by MAPK kinase (MAPKK). At present, little is known about the physiological functions of MAPK4 and its role in diseases including cancer, and the effects of MAPK4 in different diseases, including cancer, vary, and there is heterogeneity in different cancer types. For example, inhibition of MAPK4 in gastric cancer cells mediates a positive feedback loop between cancer cells and tumor-associated macrophages, which promotes gastric cancer liver metastasis; in most triple-negative breast cancers (triple-negative BCa, TNBC), MAPK4 is highly expressed, and inhibition of MAPK4 in human TNBC cells that highly express MAPK4 can greatly inhibit the activation of AKT, inhibit cell proliferation, cell growth, and xenograft growth in vivo. Knockout of MAPK4 in TNBC cells and xenografts with high MAPK4 expression makes them sensitive to PI3K inhibitors. In the present application, the inventors discovered the role of MAPK4 in endometrial cancer cells. The proliferation of endometrial cancer cells can be inhibited by inhibiting the expression of MAPK4. Therefore, agents that target the inhibition of MAPK4 can be used as drugs for the treatment of endometrial cancer and can be used in the preparation of drugs for the treatment of endometrial cancer.

[0048] In a preferred embodiment, the above application includes the use of an agent for targeted inhibition of MAPK4 in the preparation of a drug for the treatment of endometrial cancer; preferably, the agent includes a nucleic acid molecule or toad venom that can target and inhibit MAPK4; preferably, the nucleic acid molecule includes siRNA or shRNA; preferably, the siRNA includes the sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQID NO: 3 or SEQ ID NO: 4.

[0049] SEQ ID NO: 1: UGUCGAUGGCUUUGGGUAGU; SEQ ID NO: 2: AUCUUCUUCACAGCGACCUUC; SEQ ID NO: 3: UGUCGAUGGCUUUGGUGUAGUTT; SEQ ID NO: 4: AUCUUCUUCACAGCGACCUUCTT.

[0050] Compared with the siRNA shown in SEQ ID NO: 1, the siRNA shown in SEQ ID NO: 3 has two T bases (dT, deoxythymidine dinucleotide) extended at the 3' end of the RNA fragment, which can enhance the stability of the siRNA double-stranded complex during use, thereby increasing the knockdown efficiency of the siRNA. The siRNA shown in SEQ ID NO: 1 without the two T bases can also achieve the effect of targeted inhibition of MAPK4. Similarly, the difference between the siRNA shown in SEQ ID NO: 2 and SEQ ID NO: 4 is only the two T bases extended at the 3' end.

[0051] In a preferred embodiment, the target nucleotide of shRNA is shown as SEQ ID NO: 5 or SEQ ID NO: 6.

[0052] SEQ ID NO: 5: gatcgcgcagtgggtcaagag; SEQ ID NO: 6: gcgacctcaatggtgcgtgca;

[0053] Preferably, the DNA strand of the shRNA is as shown in SEQ ID NO:7 or SEQ ID NO:8.

[0054] SEQ ID NO: 7: CCGGgatcgcgcagtgggtcaagagTTCAAGAGActcttgacccactgcgcgatcTTTTTT;

[0055] SEQ ID NO: 8: CCGGgcgacctcaatggtgcgtgcaTTCAAGAGAtgcacgcaccattgaggtcgcTTTTTT.

[0056] The above-mentioned reagents capable of targeted inhibition of MAPK4 include but are not limited to nucleic acid molecules or bufotoxin, which is a small molecule compound. The above-mentioned reagents can reduce the transcription level of genes capable of expressing MAPK4, reduce the translation level of mRNA capable of translating MAPK4, or reduce the protein activity of MAPK4.

[0057] Arenobufagin (ARE for short) is one of the main bufadienolide compounds in toad skin. Some scholars have screened the anti-tumor effects of more than 60 kinds of bufalide compounds isolated from toad venom and toad skin, and found that arenobufagin has significant activity and can inhibit the growth of various tumor cells, with the strongest inhibitory effect on liver cancer; the compound can also inhibit the growth of HepG2 / ADM nude mouse transplanted tumors, and at non-toxic doses, it can inhibit the adhesion, movement, invasion and migration of liver cancer cells. In addition, ARE has good anti-tumor activity in various malignant tumors such as breast cancer and prostate cancer. However, the prior art has not found the activity of arenobufagin against endometrial cancer cells. In this application, it was found through experiments that arenobufagin can reduce the transcription level of MAPK4 and the protein level of MAPK4.

[0058] siRNA (small interfering RNA) and shRNA (short hairpin RNA) are tools for mediating RNA interference (RNA interference) and can play a key role in inhibiting protein expression. The above-mentioned siRNA and shRNA can achieve targeted inhibition of MAPK4 by specifically base-pairing with the mRNA of MAPK4, thereby causing the degradation or translation inhibition of such mRNA.

[0059] In a preferred embodiment, the drug for treating endometrial cancer includes an endometrial cancer cell proliferation inhibitor.

[0060] In a preferred embodiment, the drug for treating endometrial cancer includes an endometrial cancer cell G2 / M cycle inhibitor.

[0061] The above-mentioned drug for treating endometrial cancer can inhibit the proliferation of endometrial cancer cells, reduce or even stop the proliferation of endometrial cancer cells. Furthermore, the above-mentioned drug can block the cell cycle of endometrial cancer cells in the G2 / M cycle, thereby affecting the proliferation ability of endometrial cancer cells and achieving the treatment of endometrial cancer.

[0062] In a second typical embodiment of the present application, a targeted inhibitor for treating endometrial cancer is provided, wherein the targeted inhibitor comprises a nucleic acid molecule or bufotoxin capable of targeted inhibition of MAPK4.

[0063] In a preferred embodiment, the nucleic acid molecule comprises siRNA or shRNA; preferably, the siRNA comprises the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0064] SEQ ID NO: 1: UGUCGAUGGCUUUGGGUAGU; SEQ ID NO: 2: AUCUUCUUCACAGCGACCUUC; SEQ ID NO: 3: UGUCGAUGGCUUUGGUGUAGUTT; SEQ ID NO: 4: AUCUUCUUCACAGCGACCUUCTT.

[0065] Preferably, the target nucleotide of the shRNA is shown in SEQ ID NO:5 or SEQ ID NO:6.

[0066] SEQ ID NO: 5: gatcgcgcagtgggtcaagag; SEQ ID NO: 6: gcgacctcaatggtgcgtgca;

[0067] Preferably, the DNA strand of the shRNA is as shown in SEQ ID NO:7 or SEQ ID NO:8.

[0068] SEQ ID NO: 7: CCGGgatcgcgcagtgggtcaagagTTCAAGAGActcttgacccactgcgcgatcTTTTTT;

[0069] SEQ ID NO: 8: CCGGgcgacctcaatggtgcgtgcaTTCAAGAGAtgcacgcaccattgaggtcgcTTTTTT.

[0070] The beneficial effects of the present application will be further explained in detail below in conjunction with specific embodiments.

[0071] Example 1 Experimental method

[0072] 1. Cell culture and operation procedures

[0073] Human endometrial cancer cell lines AN3 CA and HEC-1-B were routinely maintained by the Department of Gynecological Oncology, Cancer Hospital, Chinese Academy of Medical Sciences. Both cell lines were cultured in MEM medium containing 10% fetal bovine serum. 293FT cells were cultured in MEM+NEAA+G418 medium containing 10% FBS. All cell lines were cultured in a 37°C, 5% CO2 incubator.

[0074] Required experimental materials: cell culture medium and PBS; fetal bovine serum, trypsin and Opti-MEM medium (Gibco); penicillin, streptomycin and Lipofectamine 2000 (Invitrogen); T25 cell culture flasks and cell culture plates (Corning);

[0075] In cell experiments, the following experimental procedures are involved:

[0076] 1.1 Cell recovery

[0077] (1) Open the water bath in advance and adjust the temperature to 37°C;

[0078] (2) Quickly take out the frozen cells from the liquid ammonia tank and place them in a 37°C water bath for 3 to 5 minutes. Centrifuge at 1000 rpm for 5 minutes to obtain a cell pellet;

[0079] (3) Take out 1 mL of culture medium from the 5 mL culture medium that has been rewarmed in the T25 flask in advance to resuspend the cell pellet and place the T25 flask containing the cell suspension in a cell culture incubator for culture.

[0080] 1.2 Cell passaging

[0081] (1) When the cells in the T25 flask grow to 80% to 90%, wash the cells twice with 2 mL of 1× PBS and discard the PBS;

[0082] (2) Digest the cells with 0.6 mL of 2× trypsin for 3–5 minutes. Final digestion with 1.5 mL of culture medium;

[0083] (3) Transfer an equal volume of the above 2.1 mL of cell suspension to three T25 cells and add 4.3 L of culture medium to each cell to continue culturing the cells.

[0084] 1.3 Cell cryopreservation

[0085] (1) Wash T25 cells in the logarithmic growth phase twice with 2 mL of 1× PBS and discard the PBS;

[0086] (2) Digest the cells with 0.6 mL of 1× trypsin for 3–5 min and terminate the digestion with 1.5 mL of culture medium;

[0087] (3) centrifuging the cell solution at 1000 rpm for 5 minutes and discarding the supernatant to obtain a cell pellet;

[0088] (4) Resuspend the cells in 0.7 mL of freezing solution, transfer to a cryovial, and then place in a 4°C refrigerator for 30 minutes, in a -20°C refrigerator for 2 hours, and in a -80°C refrigerator overnight. Then, transfer to a liquid nitrogen tank for long-term storage.

[0089] 1.4 Lipofectamine 2000 transfection of siRNA into mammalian cells

[0090] (1) Well-growing cells were seeded into a 6 cm dish one day before transfection. After overnight culture, the cell confluence should reach 30% to 40% before transfection.

[0091] (2) Replace the 6 cm dish with 3 mL of OptiMEM and culture the cells at 37°C for half an hour;

[0092] (3) Take 10 μL of transfection reagent Lipo 2000 and add it to 500 μL of OptiMEM medium without serum and antibiotics, mix gently, and leave it at room temperature for 5 minutes; at the same time, add 10 μL of siRNA (stock concentration 20 μM) to another 500 μL of Opti-MEM medium without serum and antibiotics, mix gently, and leave it at room temperature for 5 minutes;

[0093] The siRNA related sequences are shown in Table 1.

[0094] Table 1

[0095]

[0096] Note: The siRNA used in the experiment exists in the form of a DNA-RNA hybrid chain formed by a sense chain and an antisense chain (i.e., a siRNA double-stranded complex). In actual use, the antisense chain plays a role and targets the MAPK4 gene.

[0097] In SEQ ID NO: 3 and SEQ ID NO: 4, the 1st to 21st nucleotides are ribonucleotides (RNA), and the 22nd and 23rd nucleotides (ie, the two nucleotides at the 3' end are deoxyribonucleotides dT).

[0098] (4) Add the transfection reagent dropwise into the siRNA solution and leave at room temperature for 15 minutes;

[0099] (5) The above mixture was evenly added dropwise into a 6 cm dish containing OptiMEM medium;

[0100] (6) Culture at 37°C for 4-6 hours, and replace with 4 mL of MEM medium containing 10% fetal bovine serum. Collect cells after 48 hours, extract proteins and detect the expression of each molecule protein.

[0101] 1.5 Construction of cell lines with stable gene expression or gene deletion

[0102] (1) Well-growing 293FT cells were seeded into a 6 cm dish one day before transfection. After overnight culture, the cell confluence should reach 70-80% before transfection.

[0103] (2) Discard the original culture medium and add 3.8 mL of OptiMEM medium without serum and antibiotics to each dish for starvation treatment for 30 minutes;

[0104] (3) Prepare solution A (500 μL Opti-MEM plus 18 μL Lipo2000) and solution B (mix 6 g of the vector plasmid containing the target gene fragment with 3 g of the packaging plasmid pMD2G and 3 g of the packaging plasmid psPAX2). Simultaneously transfect an empty vector as a control;

[0105] The fragments used to express shRNA in the vector plasmid are:

[0106] S (sense chain, sense): CCGGgatcgcgcagtgggtcaagagTTCAAGAGActcttgacccactgcgcgatcTTT TTT (SEQ ID NO: 7),

[0107] A (antisense strand, antisense): AATTAAAAAAgatcgcgcagtgggtcaagagTCTCTTGAActcttgacccac tgcgcgatc (SEQ ID NO: 11);

[0108] or

[0109] S (sense chain, sense): CCGGgcgacctcaatggtgcgtgcaTTCAAGAGAtgcacgcaccattgaggtcgcTTT TTT (SEQ ID NO: 8),

[0110] A (antisense strand, antisense): AATTAAAAAAgcgacctcaatggtgcgtgcaTCTCTTGAAtgcacgcaccat tgaggtcgc (SEQ ID NO: 12).

[0111] (4) Incubate the mixture at room temperature for 15 minutes, mix well and add dropwise to 293FT cells;

[0112] (5) After 4 to 6 hours, replace with 5 mL of DMEM medium containing 20% ​​FBS;

[0113] (6) 48 hours after transfection, the supernatant containing lentivirus was collected and stored at 4°C;

[0114] (7) Filter the virus supernatant with a 0.22 μM syringe filter and aliquot it. Store it at 4°C and use it up within one week. Store the virus that is not in use at -80°C to avoid repeated freezing and thawing.

[0115] (8) The cancer cells to be infected with the virus were inoculated into a 6-well plate. When the cell confluence was about 50%, each well was replaced with 1.5 mL of fresh culture medium and 500 μL of virus supernatant mixture, and 2 μL of polybrene was added to promote transfection;

[0116] (9) After 8 to 12 hours of virus infection of target cells, fresh culture medium without polybrene was replaced;

[0117] (10) After 24 hours, appropriate concentrations of the corresponding antibiotics are added to the culture medium again for screening; after 14 days of screening, cells with stable deletion and expression of the corresponding resistance gene can be obtained;

[0118] (11) Western blot was used to detect changes in the expression levels of corresponding gene proteins and to detect whether the related genes were stably expressed in the cells.

[0119] 2. Cell proliferation detection (Cell Counting Kit-8)

[0120] (1) Take cells in the logarithmic growth phase, discard the culture medium, wash twice with 1× PBS, digest the cells with trypsin, and add MEM medium containing 10% fetal bovine serum to terminate the digestion;

[0121] (2) Count cells and adjust the cell density to 2×10 4 100 μL of cell suspension was added to each well of a 96-well culture plate, i.e., 2×10 3 Each group was set up with 6 parallel wells. A total of 7 96-well plates were inoculated and cultured in a 37°C incubator containing 5% CO2. The surrounding was sealed with 1×PBS water;

[0122] (3) About 12-24 hours after inoculation, take a 96-well plate for testing. When checking, discard the old culture medium first, add 90 μL of fresh culture medium to 10 μL of CCK-8 to prepare the test mixture and add it to each well. After incubation in a 37°C incubator without CO2 for 1 hour, use an enzyme reader to measure the absorbance value at 450nm (OD450) and define it as 1 day;

[0123] (4) Take a 96-well plate every 24 hours and measure the OD450 value to obtain the OD450 values ​​at six time points from 2 to 6 days;

[0124] (5) The cell growth curve was drawn with the average OD450 value of each replicate well of cells in different treatment groups at each time point as the ordinate and the culture time as the abscissa.

[0125] 3. Plate colony formation assay

[0126] (1) The cells in each group in the logarithmic growth phase were digested with trypsin to prepare a single cell suspension, counted, and 500 cells were inoculated into each well of a six-well plate. Each group had three replicate wells and was placed in a 5% CO2 constant temperature incubator at 37°C for about 12 to 14 days;

[0127] (2) Change the medium every 5 to 6 days for about 14 days. When colonies are visible to the naked eye, stop culturing and start preparing for fixation and staining.

[0128] (3) Rinse twice with PBS, fix with methanol for 30 min, discard the fixative, stain with 0.5% crystal violet for 20 min after drying slightly, rinse with distilled water to remove residual stain, and air dry;

[0129] (4) A positive colony was defined as a cluster containing more than 50 cells. The colonies were photographed and the number of clones was counted.

[0130] 4. Cell cycle detection

[0131] In this embodiment, the kit used is a cell cycle detection kit (Keygen Biotechnology, KGA511).

[0132] (1) The cells in each group in the logarithmic growth phase were digested with trypsin to prepare a single cell suspension, which was inoculated into a six-well plate the day before, with three replicate wells in each group, and placed in a 5% CO2 constant temperature incubator at 37°C for incubation. After overnight incubation, the cell confluence should reach 30-40% before transfection;

[0133] (2) Lipofectamine 2000 was used to transfect siRNA into mammalian cells and cultured for 24 h;

[0134] (3) Calculate the required volume of staining working solution and incubate each sample with 500 μl of working solution; prepare the staining working solution by mixing RNase A and PI working solution at a ratio of 1:9 before use;

[0135] (4) Discard the culture medium, wash twice with 1×PBS, digest the cells with trypsin, and add MEM medium containing 10% fetal bovine serum to terminate the digestion. Wash the cells once with PBS (centrifuge at 2000 rpm for 5 min), collect and adjust the cell concentration to 1×10 6 / ml, take 1ml of single cell suspension;

[0136] (5) After centrifugation of the prepared single-cell suspension, the supernatant was removed and 500 μL of 70% cold ethanol was added to the cells for fixation (2 hours to overnight);

[0137] (6) Store at 4°C. Wash away the fixative with PBS before staining. Centrifugal washing conditions can refer to 1000 rpm for 3 min.

[0138] (7) Add 500 μL of the PI / RNase A staining solution prepared in advance and incubate at room temperature away from light for 30-60 minutes;

[0139] (8) Flow cytometry detection, recording the red fluorescence at an excitation wavelength of 488 nm.

[0140] 5. Animal Experiments

[0141] In this embodiment, the in vitro experimental model used is female Balb / c mice about six weeks old (purchased from Beijing Huafukang Biotechnology Co., Ltd.).

[0142] In this experiment, the following experimental operation procedures are involved:

[0143] (1) SPF six-week-old female Balb / c mice were weighed one day before the experiment and grouped according to their weight so that mice of various weights were evenly distributed in each group.

[0144] (2) The cells that are in good growth condition and in the logarithmic growth phase are completely digested, washed twice with 1× PBS and fully suspended to prepare a single cell suspension.

[0145] (3) Count the cells and calculate the total number to be 3.5×10 6 The number of cells / mouse (0.1 mL) was inoculated into the axilla of the upper limb of mice to establish a subcutaneous tumor transplantation model in mice.

[0146] (4) The mice were weighed and observed continuously during the experiment. Measurements were started when the tumor diameter reached about 4 mm. The length and width of the subcutaneous transplanted tumor were measured and recorded every 2 days. The tumor volume was calculated using the formula: tumor volume = (π / 6) × (length × width × width).

[0147] (5) When the subcutaneous tumor volume reaches 1 cm 3 After about 1 h, the experiment was terminated and the mice were killed by cervical dislocation, and the tumor tissues were removed, photographed, and weighed.

[0148] 6. Western blot detection

[0149] In this method, the antibodies used to detect MAPK4, GFP, and GAPDH are from Proteintech, with catalog numbers 26102-1-AP, 50430-2-AP, and 60004-1-Ig, respectively.

[0150] The reagents used for Western blot detection were purchased from Beijing Pulilai Biotechnology Co., Ltd.

[0151] In this experiment, the following experimental operation procedures are involved:

[0152] (1) Total cell protein extraction;

[0153] (2) Protein quantification and preparation of protein loading samples;

[0154] (3) SDS-PAGE gel electrophoresis and protein blotting, including gel preparation, electrophoresis, and membrane transfer;

[0155] (4) Detection of the target protein, including blocking, incubation with primary antibody, incubation with secondary antibody, and exposure and development;

[0156] (5) Scan or photograph the film and use a gel imaging system to analyze the molecular weight and net optical density of the target band.

[0157] 7. Primary culture (drug treatment)

[0158] (1) Shear the tissue. Wash the obtained tissue with physiological saline to remove blood stains on the surface, and use surgical forceps to remove adherent connective tissue and other tissues not required for culture.

[0159] (2) After washing again, cut the tissue into several small pieces with a scalpel, transfer them to a culture dish, add an appropriate amount of physiological saline, and use elbow ophthalmic scissors to repeatedly cut the tissue until it becomes a paste, about 1 mm 3 After standing for a while, use a pipette to remove the upper liquid, add appropriate buffer and wash again;

[0160] (3) Use tissue digestion enzymes to digest and separate small tissue fragments into cell clusters or dispersed single cells to facilitate further culture;

[0161] (4) Add drug-containing culture medium into a 96-well plate and set a drug concentration gradient;

[0162] (5) Count the cells in the cell suspension using a counting plate, adjust the cell number to the required density with culture medium, and add them to a 96-well plate. Place the plate in a CO2 incubator at 5% CO2 and 37°C for static culture.

[0163] (6) After 48 hours, the cell proliferation was detected using the CCK method.

[0164] 8. Transcriptome Sequencing

[0165] (1) Sample preparation

[0166] Prepare AN3 CA MAPK4 knockdown group and control group cells (≥5×10 6 indivual).

[0167] (2) RNA extraction

[0168] Total RNA was extracted by Trizol extraction method, and then quality tested (concentration and purity were tested by nanodrop, and integrity was tested by RNA-specific agarose electrophoresis).

[0169] (3) Library construction

[0170] After the quality inspection meets the requirements for library construction, the mRNA is separated from the total RNA using magnetic beads with oligo-dT, and the captured mRNA is fragmented. Then, the first and second strands of cDNA are synthesized using reverse transcriptase, and the reverse transcription products are repaired at the end, and then the A base is added to the 3' end. Subsequently, the fragment is connected to the sequencing adapter. After the connection product is purified, the incomplete connection product and the empty adapter self-connection product are removed, and PCR amplification is performed using primers complementary to the adapter sequence. Finally, the sequencing library is purified using magnetic beads.

[0171] (4) Inventory inspection

[0172] After the library construction was completed, the library concentration was detected by Qubit and the library fragment length was detected by Agilent fragment analyzer to ensure the quality of the library.

[0173] (5) Sequencing

[0174] After the library is qualified, the library is sequenced by PE150 using the lumina Novaseg 6000 sequencing platform. PE150 (Pair end 150bp) refers to high-throughput double-end sequencing, a sequencing strategy that measures 150bp at each end.

[0175] (6) Data analysis

[0176] Data analysis was performed using R 4.2.1.

[0177] Example 2

[0178] We performed immunohistochemical tests on 42 paraffin-embedded EC tissues and 42 normal tissues. Figure 1A and Figure 1B Among them, it was found that normal tissue (Normal, Figure 1B MAPK4 is not expressed or expressed at a very low level in tumor tissues (abbreviated as N), while Figure 1B Compared with normal tissues, the expression of MAPK4 in T cells was significantly increased, and MAPK4 expression was mainly localized in the cytoplasm ( Figure 1A ). Eight groups of EC tumor and normal tissue samples were randomly selected, and total protein was extracted to detect MAPK4. It was also found that MAPK4 was abnormally highly expressed in cancer tissues compared with normal tissues ( Figure 1BThe above research results preliminarily indicate that MAPK4 is abnormally highly expressed in EC, and its increased protein expression level is positively correlated with poor prognosis of patients.

[0179] Example 3 Transient knockdown of MAPK4 can induce G2 / M cycle arrest and inhibit cell proliferation

[0180] In order to explore the role of MAPK4 in EC, the cell culture and operation procedures, cell proliferation detection, plate colony formation test and cell cycle detection in Example 1 were used. The test results are as follows Figure 2A-2F As shown. Among them, we used specific siRNA to transiently knock down MAPK4 expression ( Figure 2A and Figure 2B ), CCK-8 and clone formation assays showed that cell proliferation slowed down ( Figure 2C and Figure 2D ). The results of the cell cycle detection experiment showed that transient knockdown of MAPK4 could induce G2 / M cell cycle arrest in cells ( Figure 2E and Figure 2F ).

[0181] Example 4 Stable knockout of MAPK4 can inhibit cell proliferation and growth of nude mouse transplanted tumors

[0182] In order to fully demonstrate the effect of MAPK4 on cell function, we then used the cell lines constructed with stable or missing gene expression in Example 1. The experimental results are as follows: Figure 3A-3C As shown. Among them, a MAPK4 stable knockout cell line was constructed ( Figure 3A Stable knockout of MAPK4 also significantly inhibited cell proliferation activity ( Figure 3B ). Using the animal experiment in Example 1, the HEC-1-B stable knockout MAPK4 cell line was used to perform a nude mouse transplant tumor experiment in vivo. It was found that compared with the control group, the growth of the subcutaneous transplant tumor in the knockout group was significantly inhibited, while there was no significant difference in the weight of the mice between the knockout group and the control group ( Figure 3C ).

[0183] Example 5 The cell phenotype changes caused by ARE treatment are highly consistent with the cell phenotype mediated by MAPK4

[0184] EC cells were treated with 0, 0.2 and 0.4 μM ARE for 24 hours and then the cell mRNA was extracted for RNA-seq sequencing analysis. The volcano plot results showed that the transcription level of MAPK4 was significantly downregulated in the drug treatment group ( Figure 4A ). Genes whose mRNA levels were downregulated after treatment with two drug concentrations (log|FC|>1, P<0.05) were screened and KEGG enrichment analysis was performed. The results showed that the most significantly enriched downregulated genes were in the MAPK signaling pathway ( Figure 4B).

[0185] Using the cell culture and operation procedures, cell proliferation detection, plate colony formation test and cell cycle detection in Example 1, EC cells were treated with different concentrations of ARE, and CCK8 detection was performed after 24 hours and 48 hours, respectively. It was found that ARE could significantly inhibit the proliferation ability of EC cells at low concentrations, and the inhibitory effect was dose-dependent ( Figure 4C and Figure 4D Flow cytometry results showed that 0.2μM and 0.4μM ARE treatment for 12 hours could induce G2 / M cell cycle arrest in cells ( Figure 4E and Figure 4F ). Consistent with this, Western blot was used to detect G2 / M cell cycle-related proteins and found that the expression level of Cyclin B1 protein was significantly increased ( Figure 4G ). Using human endometrial cancer tissue for primary culture, it was also found that low concentrations of ARE could significantly inhibit the proliferation of primary cells, and the inhibitory effect was dose-dependent ( Figure 4H ). When EC cells were treated with 0.2μM and 0.4μM ARE, it was found that the clone formation ability of the cells was also significantly reduced in a dose-dependent manner ( Fig. 4I ). Using the animal experiment in Example 1, AN3 CA and HEC-1-B cells were further inoculated into nude mice subcutaneously for tumor formation experiments. The mice were intraperitoneally injected with 3 mg / kg of drug concentration. In addition, normal saline was injected as a control group to observe the changes in the weight and volume of the transplanted tumors. Compared with the control group, the growth of subcutaneous transplanted tumors in the drug-treated group was significantly inhibited ( Figure 4J ). It can be seen that the cell phenotype changes caused by ARE treatment are highly consistent with the cell phenotype mediated by MAPK4.

[0186] Example 6 ARE inhibits cell proliferation by inhibiting MAPK4

[0187] To further verify that ARE affects cell proliferation by inhibiting MAPK4, we used Western blot to detect the expression level of MAPK4 in EC cells treated with 0.2μM and 0.4μM ARE, and found that both were downregulated compared with the control group ( Figure 5A EC cells were treated with 0.2 μM ARE and then transfected with MAPK4 overexpression plasmid ( Figure 5B ) and found that the proliferation and clone formation abilities of EC cells were restored ( Figure 5C and Figure 5D). Based on the above studies, it was found that ARE can significantly reduce the transcription and protein expression levels of MAPK4. The cell phenotype changes caused by ARE treatment are highly consistent with the cell phenotype changes mediated by the inhibition of MAPK4. The recovery experiment can prove that ARE inhibits cell proliferation by inhibiting MAPK4. Based on the above research findings, ARE may be a candidate small molecule inhibitor of MAPK4.

[0188] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: In the present application, the inventors found that endometrial cancer can be treated by inhibiting MAPK4, including inhibiting the expression of MAPK4 in endometrial cancer cells to inhibit the proliferation of endometrial cancer cells. Therefore, agents that target the inhibition of MAPK4 can treat endometrial cancer, and such agents can be used to prepare drugs for the treatment of endometrial cancer. Further, the inventors found that bufotoxin and any one or more of the nucleic acid molecules shown in SEQ ID NO: 1-6 can target the inhibition of MAPK4 and reduce the transcription of mRNA used to translate MAPK4.

[0189] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

[0190] The references involved in this application are as follows:

[0191] 1.Siegel RL,Miller KD,Wagle NS,Jemal A:Cancer statistics,2023.CA:acancer

[0192] journal for clinicians 2023,73(1):17-48.

[0193] 2.Crosbie EJ,Kitson SJ,McAlpine JN,Mukhopadhyay A,Powell ME,Singh N:

[0194] Endometrial cancer.Lancet(London,England)2022,399(10333):1412-1428.

[0195] 3.Tronconi F, Nero C, Giudice E, Salutari V, Musacchio L, Ricci C, CarboneMV,

[0196] Ghizzoni V,Perri MT,Camarda F et al:Advanced and recurrentendometrial cancer:

[0197] State of the art and future perspectives.Crit Rev Oncol Hematol 2022,180:103851.4.Menon MB,Gaestel M:TPL2 meets p38MAPK:emergence of a novelpositive

[0198] feedback loop in inflammation.Biochem J 2016,473(19):2995-2999.

[0199] 5.Lei Z,van Mil A,Brandt MM,Grundmann S,Hoefer I,Smits M,El AzzouziH,

[0200] Fukao T,Cheng C,Doevendans PA et al:MicroRNA-132 / 212family enhances

[0201] arteriogenesis after hindlimb ischaemia through modulation of theRas-MAPK

[0202] pathway.Journal of cellular and molecular medicine 2015,19(8):1994-2005.

[0203] 6.Kim EK,Choi EJ:Compromised MAPK signaling in human diseases:anupdate.

[0204] Arch Toxicol 2015,89(6):867-882.

[0205] 7.Wang W,Shen T,Dong B,Creighton CJ,Meng Y,Zhou W,Shi Q,Zhou H,ZhangY,Moore DD et al:MAPK4 overexpression promotes tumor progression via

[0206] noncanonical activation of AKT / mTOR signaling.The Journal of clinical

[0207] investigation 2019,129(3):1015-1029.

[0208] 8.Shen T,Wang W,Zhou W,Coleman I,Cai Q,Dong B,Ittmann MM,CreightonCJ,Bian Y,Meng Y et al:MAPK4 promotes prostate cancer by concerted activationof

[0209] androgen receptor and AKT.The Journal of clinical investigation 2021,131(4).9.Wang W,Han D,Cai Q,Shen T,Dong B,Lewis MT,Wang R,Meng Y,Zhou W,Yi

[0210] P et al:MAPK4 promotes triple negative breast cancer growth andreduces tumor

[0211] sensitivity to PI3K blockade.Nature communications 2022,13(1):245.

[0212] 10.Zeng X,Jiang S,Ruan S,Guo Z,Guo J,Liu M,Ye C,Dong J:MAPK4silencing

[0213] together with a PARP1 inhibitor as a combination therapy in triple-negative breast

[0214] cancer cells.Mol Med Rep 2021,24(2).

[0215] 11.Tian S,Lou L,Tian M,Lu G,Tian J,Chen X:MAPK4 deletion enhancesradiation

[0216] effects and triggers synergistic lethality with simultaneous PARP1inhibition in

[0217] cervical cancer.J Exp Clin Cancer Res 2020,39(1):143.

[0218] 12. N, M,Lederer M,Glass M,Reinke C,Singer RH,Hüttelmaier S:

[0219] IGF2BP1 promotes cell migration by regulating MK5 and PTENsignaling.Genes

[0220] Dev 2012,26(2):176-189.

[0221] 13.Li S,Guo D,Sun Q,Zhang L,Cui Y,Liu M,Ma X,Liu Y,Cui W,Sun L et al:

[0222] MAPK4 silencing in gastric cancer drives liver metastasis by positivefeedback

[0223] between cancer cells and macrophages.Exp Mol Med 2023,55(2):457-469.

[0224] 14.Yu Z,Guo W,Ma X,Zhang B,Dong P,Huang L,Wang X,Wang C,Huo X,Yu Wetal:Gamabufotalin,a bufadienolide compound from toad venom,suppresses COX-2

[0225] expression through targeting IKKβ / NF-κB signaling pathway in lungcancer cells.

[0226] Mol Cancer 2014,13:203.

[0227] 15.Zhang L,Nakaya K,Yoshida T,Kuroiwa Y:Induction by bufalin ofdifferentiation ofhuman leukemia cells HL60,U937,and ML1 toward macrophage / monocyte-like

[0228] cells and its potent synergistic effect on the differentiation ofhuman leukemia cells

[0229] in combination with other inducers.Cancer Res 1992,52(17):4634-4641.

[0230] 16.Chen Z,Zhai XF,Su YH,Wan XY,Li J,Xie JM,Gao B:[Clinicalobservation of

[0231] cinobufacini injection used to treat moderate and advanced primaryliver cancer].

[0232] Zhong Xi Yi Jie He Xue Bao 2003,1(3):184-186.

[0233] 17.Meng Z,Yang P,Shen Y,Bei W,Zhang Y,Ge Y,Newman RA,Cohen L,Liu L,

[0234] Thornton B et al:Pilot study of huachansu in patients withhepatocellular carcinoma,

[0235] nonsmall-cell lung cancer,or pancreatic cancer.Cancer 2009,115(22):5309-5318.18.Zhang DM,Liu JS,Deng LJ,Chen MF,Yiu A,Cao HH,Tian HY,Fung KP,

[0236] Kurihara H,Pan JX et al:Arenobufagin,a natural bufadienolide fromtoad venom,

[0237] induces apoptosis and autophagy in human hepatocellular carcinomacells through

[0238] inhibition of PI3K / Akt / mTOR pathway.Carcinogenesis 2013,34(6):1331-1342.19.Deng LJ,Peng QL,Wang LH,Xu J,Liu JS,Li YJ,Zhuo ZJ,Bai LL,Hu LP,Chen

[0239] WM et al:Arenobufagin intercalates with DNA leading to G2 cell cyclearrest via

[0240] ATM / ATR pathway.Oncotarget 2015,6(33):34258-34275.

Claims

1. Application of nucleic acid molecules capable of targeted inhibition of MAPK4 in the preparation of drugs for the treatment of endometrial cancer; The nucleic acid molecule is siRNA or shRNA; The siRNA is a sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; SEQ ID NO: 1:UGUCGAUGGCUUUGGGUAGU; SEQ ID NO: 2: AUCUUCUUCACAGCGACCUUC; SEQ ID NO: 3:UGUCGAUGGCUUUGGUGUAGUTT; SEQ ID NO: 4: AUCUUCUUCACAGCGACCUUCTT; The target nucleotide of the shRNA is shown in SEQ ID NO: 5 or SEQ ID NO: 6; SEQ ID NO: 5: gatcgcgcagtgggtcaagag; SEQ ID NO: 6: gcgacctcaatggtgcgtgca.

2. The use according to claim 1, characterized in that: The strand of the DNA expressing the shRNA is shown in SEQ ID NO: 7 or SEQ ID NO: 8; SEQ ID NO: 7: CCGGgatcgcgcagtgggtcaagagTTCAAGAGActcttgacccactgcgcgatcTTTTTT; SEQ ID NO: 8: CCGGgcgacctcaatggtgcgtgcaTTCAAGAGAtgcacgcaccattgaggtcgcTTTTTT.

3. A targeted inhibitor for treating endometrial cancer, characterized in that: The targeted inhibitor is a nucleic acid molecule capable of targeted inhibition of MAPK4; The nucleic acid molecule is siRNA or shRNA; The siRNA is a sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; SEQ ID NO: 1:UGUCGAUGGCUUUGGGUAGU; SEQ ID NO: 2: AUCUUCUUCACAGCGACCUUC; SEQ ID NO: 3:UGUCGAUGGCUUUGGUGUAGUTT; SEQ ID NO: 4: AUCUUCUUCACAGCGACCUUCTT; The target nucleotide of the shRNA is shown in SEQ ID NO: 5 or SEQ ID NO: 6; SEQ ID NO: 5: gatcgcgcagtgggtcaagag; SEQ ID NO: 6: gcgacctcaatggtgcgtgca.

4. The targeted inhibitor according to claim 3, characterized in that The strand of the DNA expressing the shRNA is shown in SEQ ID NO: 7 or SEQ ID NO: 8; SEQ ID NO:7:CCGGgatcgcgcagtgggtcaagagTTCAAGAGActcttgacccactgcgcgatcTTTTTT; SEQ ID NO:8:CCGGgcgacctcaatggtgcgtgcaTTCAAGAGAtgcacgcaccattgaggtcgcTTTTTT。

Images