Application of oswrky45 gene in improving appearance quality of rice grain

By applying the OsWRKY45 gene for gene editing in rice, the grain shape of rice was regulated, solving the problems of insufficient rice appearance quality and yield in existing technologies, and achieving optimization of grain shape and increase in yield.

CN118995744BActive Publication Date: 2025-11-25SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411164842.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-23
Publication Date
2025-11-25
Estimated Expiration
2044-08-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control rice grain shape, which affects the appearance quality and yield of rice.

Method used

Gene editing was performed in rice using the OsWRKY45 gene and its homologs to regulate rice grain shape, including improving grain length and length-to-width ratio, through knockout or overexpression.

Benefits of technology

Significantly increasing or decreasing rice grain length and length-to-width ratio improves rice appearance quality and yield, providing precise crop breeding targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995744B_ABST
    Figure CN118995744B_ABST
Patent Text Reader

Abstract

The application discloses application of an OsWRKY45 gene in improving appearance quality of rice grains. It is found through comparison of different haplotypes of the OsWRKY45 gene that Huajiangxian 74 (HJX74) is an excellent haplotype with longer grains. The haplotype increases the grain length of plants, does not affect the grain width, and increases the length-width ratio of the grains. Meanwhile, knocking out the OsWRKY45 gene in the HJX74 background significantly reduces the grain length of plants, does not affect the grain width, and reduces the length-width ratio of the grains. The above results show that the haplotype of the OsWRKY45 gene in the HJX74 background can be used for improving the appearance quality of plant grains, has important significance for crop breeding, and provides a target site for precise molecular breeding of crops.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of plant genetic engineering and plant genetic breeding technology, and particularly relates to application of an OsWRKY45 gene in improving appearance quality of rice grains. BACKGROUND

[0002] Rice (Oryza Sativa L.) is one of the world's major food crops, and more than half of the world's population relies on rice as their main food. Improving rice yield and quality is of great significance to food security.

[0003] Data shows that rice grain type directly determines the thousand-grain weight of rice, and further determines the rice yield. At the same time, rice grain type traits including grain length, grain width and grain thickness are important factors affecting the appearance quality, milling quality and market competitiveness of rice. Rice grain type is a quantitative trait controlled by multiple genes, and identifying genes controlling grain type can provide theoretical support and material basis for analyzing the molecular mechanism of rice grain type formation, and further for utilizing relevant molecular modules to carry out efficient and precise design and cultivation of new rice varieties with high yield and quality. SUMMARY

[0004] The purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and to provide application of OsWRKY45 gene related biological materials.

[0005] The OsWRKY45 gene is located on chromosome 5 Chr5:14991579-14993800, and the gene locus number is LOC_Os05g25770 (phytozome database). The full-length genomic sequence is 2222 bp, including 3 exons, 2 introns, 5' untranslated region (5'UTR) and 3' untranslated region (3'UTR). The full-length cDNA is 981 bp (SEQ ID NO. 1), encoding 327 amino acids (SEQ ID NO. 3), and the nucleotide sequence of the promoter is shown in SEQ ID NO. 2.

[0006] The purpose of the present application is achieved by the following technical solutions:

[0007] Application of the OsWRKY45 gene related biological materials, wherein:

[0008] The biological material is any one or more of the following substances A, B, C, D, E and F:

[0009] A. OsWRKY45 gene full-length genomic DNA or its homologous nucleic acid molecule;

[0010] B. OsWRKY45 gene cDNA or its homologous nucleic acid molecule;

[0011] C. a protein encoded by the OsWRKY45 gene or a homologous protein thereof;

[0012] D. a promoter expressed by the OsWRKY45 gene or a homologous nucleic acid molecule thereof;

[0013] E. a substance capable of changing the expression amount and / or activity of the substances A, B or D;

[0014] F. a substance capable of changing the expression amount and / or activity of the substance C.

[0015] Further, the nucleotide sequence of the full-length genomic DNA described in A is as shown in the sequence of phytozome database locus number LOC_Os05g25770.

[0016] Further, the homologous nucleic acid molecule described in A refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the full-length genomic DNA.

[0017] Further, the nucleotide sequence of the cDNA described in B is as shown in SEQ ID NO. 1.

[0018] Further, the homologous nucleic acid molecule described in B refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the sequence shown in SEQ ID NO. 1.

[0019] Further, the amino acid sequence of the protein described in C is as shown in SEQ ID NO. 3.

[0020] Further, the homologous protein described in C refers to a protein having at least 60%, at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the sequence shown in SEQ ID NO. 3.

[0021] Further, the nucleotide sequence of the promoter described in D is as shown in SEQ ID NO. 2.

[0022] Further, the homologous nucleic acid molecule in D refers to a nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the sequence shown in SEQ ID NO. 2.

[0023] Further, the application is any one or more of the following applications 1), 2), 3):

[0024] 1) application in regulating grain shape of rice;

[0025] 2) application in improving rice varieties;

[0026] 3) application in breeding transgenic rice.

[0027] Further, the substance E includes any one of the following substances I, II:

[0028] I. a substance capable of increasing the expression amount and / or improving substance A, B or D;

[0029] II. a substance capable of decreasing the expression amount and / or reducing substance A, B or D.

[0030] Further, the substance F includes any one of the following substances i, ii:

[0031] i. a substance capable of increasing the expression amount and / or improving substance C;

[0032] ii. a substance capable of decreasing the expression amount and / or reducing substance C.

[0033] Further, the application in 1) includes but is not limited to: application in improving grain length of rice, and / or application in improving length-width ratio of rice.

[0034] Further, the application in 1) includes but is not limited to: application of substance II or ii in reducing grain length of rice, and / or application of substance II or ii in reducing length-width ratio of rice.

[0035] Further, the breeding method in 3) includes but is not limited to transgenesis, hybridization, backcrossing, selfing or vegetative reproduction.

[0036] Further, the substance I or i is selected from: a recombinant vector, an expression cassette, a transgenic cell line, a transgenic plant tissue or a recombinant bacteria containing the corresponding nucleic acid molecule.

[0037] Further, the substance II or ii is selected from: sgRNA or CRISPR system containing sgRNA for knocking out gene expression.

[0038] Further, the 5'-3' targeting sequence of the sgRNA is: CTCCGCGACTCGCCGGAGGC (SEQ ID-NO. 4).

[0039] Further, the CRISPR system uses a vector including SK-gRNA and pC1300-Cas9.

[0040] Further, the rice includes any one of long-grain type, medium-grain type and short-grain type wild rice or cultivated varieties.

[0041] Further, the rice includes Huajingxian 74 (HJX74).

[0042] The present application has the following advantages and effects relative to the prior art:

[0043] (1) The OsWRKY45 gene haplotype in the background of HJX74 can significantly increase the grain length of the plant, does not affect the grain width, and increases the length-width ratio of the grain, which is an excellent haplotype for grain quality.

[0044] (2) Knocking out the OsWRKY45 gene can significantly reduce the grain length of the plant, does not affect the grain width, and reduces the length-width ratio of the grain.

[0045] The present application finds that different haplotypes of the OsWRKY45 gene in rice can affect the grain length and the length-width ratio of the grain. The analysis of the grain size of different haplotype materials finds that the OsWRKY45 in the background of Huajingxian 74 (HJX74) is an excellent haplotype with longer grain and higher length-width ratio. Meanwhile, knocking out the OsWRKY45 gene significantly reduces the grain length of the rice, does not affect the grain width, and reduces the length-width ratio of the grain. The above results have important significance for crop breeding and provide target sites for precise molecular breeding of crops. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 Figure 1 is a diagram of the research results of the effects of different haplotypes of the OsWRKY45 gene on the grain size of rice; wherein, A. Basic information of different haplotypes, the W07 donor is derived from Suyunuo, the Hg1 donor is derived from Zhanjing wild rice, and the Hm3 donor is derived from Southern wild rice; B. Grain type diagram of HJX74 and different haplotype plants (scale = 1 cm); C. Grain length statistics of HJX74 and different haplotype plants (n = 80); D. Grain width statistics of HJX74 and different haplotype plants (n = 80); E. Grain length-width ratio statistics of HJX74 and different haplotype plants (n = 80); t-test is used for significance analysis, P < 0.05.

[0047] Figure 2Figure of the results of the study on the influence of knocking out OsWRKY45 gene on rice grain size; wherein, A. Mutation type of KO-OsWRKY45 strain; B. Grain type diagram of HJX74 and KO-OsWRKY45 plants (scale = 1 cm); C. Grain length statistics of HJX74, KO-OsWRKY45#1 and KO-OsWRKY45#2 plants (n = 35); D. Grain width statistics of HJX74, KO-OsWRKY45#1 and KO-OsWRKY45#2 plants (n = 35); E. Grain length-width ratio statistics of HJX74, KO-OsWRKY45#1 and KO-OsWRKY45#2 plants (n = 35); t-test was used for significance analysis, **P < 0.01. DETAILED DESCRIPTION

[0048] The application will be further described in detail below in conjunction with the examples and the accompanying drawings, but the embodiments of the application are not limited thereto.

[0049] The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0050] The m / v in the following examples is g / mL unless otherwise specified.

[0051] The various raw materials and equipment used in the application are all conventional commercially available products, which can be directly obtained by market purchase, and the primer sequences used are synthesized by Shanghai Jeery Biological Engineering Co., Ltd.

[0052] The OsWRKY45 gene is located on chromosome 5 Chr5: 14991579-14993800, and the gene locus number is LOC_Os05g25770 (phytozome database), and the full-length genomic sequence 2222 bp includes 3 exons, 2 introns, 5' untranslated region (5'UTR) and 3' untranslated region (3'UTR). The full-length cDNA is 981 bp (SEQ ID NO. 1), encoding 327 amino acids (SEQ ID NO. 3).

[0053] The double-target CRISPR editing vectors used in the following examples are intermediate / linearized vectors: SKm-gRNA (equivalent to SK-gRNA) and final vectors: pC1300-Ubi-Cas9 (equivalent to pC1300-Cas9), both of which have been disclosed in the literature "Wang C, Shen L, Fu Y, et al. A Simple CRISPR / Cas9 System for Multiplex Genome Editing in Rice [J]. Journal of Genetics and Genomics, 2015, 42(12) 703-706".

[0054] Example 1, haplotype analysis of OsWRKY45

[0055] The Single segment substitution line (SSSL) created by the laboratory in the early stage was used as the material for haplotype analysis. SSSLs are substitution fragments from different varieties carrying OsWRKY45, which are screened from HJX74-SSSL library by using HJX74 as the receptor parent and using the polymorphic molecular markers of HJX74 and the donor parent to detect substitution fragments. The sequences of the genome and promoter region of the target gene of all materials were obtained by sequencing, and the haplotype analysis of OsWRKY45 gene was carried out by referring to the website ECOGEMS (http: / / 150.109.59.144:3838 / ECOGEMS / ), and the 6 SSSL materials were divided into 2 haplotypes.

[0056] Example 2, construction of OsWRKY45 gene knockout vector

[0057] 1) Construction of pC1300-Ubi-Cas9::bZIP38 knockout vector

[0058] According to the structure characteristics of OsWRKY45 gene, a pair of specific target primers OsWRKY45-gRNA-F and OsWRKY45-gRNA-R were designed to mix and heat, and then cooled at room temperature to obtain double-stranded target. The SKm-gRNA vector was digested with AarI restriction endonuclease to form a sticky end, and the linearized SKm-gRNA vector was purified by agarose gel electrophoresis. The double-stranded target and the linearized SKm-gRNA vector were ligated with T4 ligase to obtain the recombinant vector SKm-gRNA-OsWRKY45. The SKm-gRNA-OsWRKY45 vector was digested with KpnI and NheI restriction endonucleases, and the obtained small fragment gRNA was recovered by gel. The pC1300-Ubi-Cas9 vector was double-digested with KpnI and BamHI restriction endonucleases, and the large fragment vector was recovered. The recovered linearized pC1300-Ubi-Cas9 vector and the obtained gRNA were ligated with T4 ligase to obtain the recombinant vector pC1300-Ubi-Cas9::OsWRKY45.

[0059] The sequences of OsWRKY45-gRNA-F and OsWRKY45-gRNA-R are as follows:

[0060] OsWRKY45-gRNA-F: 5'-GGCACTCCGCGACTCGCCGGAGGC-3' (SEQ ID-NO. 5)

[0061] OsWRKY45-gRNA-R: 5'-AAACGCCTCCGGCGAGTCGCGGAG-3' (SEO·ID·NO. 6).

[0062] Example 3, KO-OsWRKY45#1 and KO-OsWRKY45#2 transgenic plant creation

[0063] 1) Surface sterilization of rice (HJX74) seeds

[0064] Remove the husk of rice seeds, wash the seeds with washing liquid, rinse thoroughly, then soak in 70% ethanol for 1-2 min, rinse with sterile water for 3 times, soak in 30% sodium hypochlorite solution (volume percentage, active chlorine in sodium hypochlorite stock solution is not less than 5%) for 30 minutes, and rinse with sterile water for 3-5 times.

[0065] 2) Induction of callus

[0066] Surface sterilized seeds were placed on sterile filter paper, surface water was absorbed, and the seeds were placed on N6 medium containing 2 mg / L 2,4-D (2.5 mg / L) with sterile tweezers, and dark culture was performed at 26-28°C. Callus induction was performed for 2 weeks, and the callus was subcultured on NB medium for 2 weeks. The compact and bright yellow callus was subcultured for 1 week for selection of callus for transformation.

[0067] 3) Agrobacterium culture

[0068] Agrobacterium EHA105 of the recombinant vector pC1300-Ubi-Cas9::OsWRKY45 was streaked on a YM medium plate containing 50 mg / L kanamycin, and dark culture was performed at 28°C for 2-3 days. Agrobacterium was collected with a metal spoon, and the Agrobacterium was suspended in NB liquid medium. The concentration of the Agrobacterium was adjusted to 0.3-0.5 OD600, and AS was added to a final concentration of 100 μM. This was the Agrobacterium suspension for co-culture transformation of rice.

[0069] 4) Agrobacterium infection of callus

[0070] The callus was immersed in the Agrobacterium suspension for 10-20 min, and the callus was dried. The callus was transferred to sterile dry filter paper, and dark culture was performed at 26-28°C for 2-3 days. After co-culture, the callus was washed 5 times with 100 mL of sterile water containing 500 mg / L Cb, and the callus was dried with sterile filter paper. The callus was then transferred to selection medium (NB medium+2 mg / L 2,4-D+500 mg / L Cb+50 mg / L Hyg) for selection culture. The selection medium was replaced once after 2 weeks, and the callus was cultured for another 2-3 weeks. The callus was transferred to pre-differentiation medium (NB medium+5 mg / L ABA+1 mg / L 6BA+2 mg / L NAA+250 mg / L Cb+50 mg / L Hyg), and dark culture was performed at 26-28°C for about 1 week.

[0071] 5) Differentiation

[0072] The callus was transferred to differentiation medium (NB medium+2 mg / L 6BA+250 mg / L Cb+50 mg / L Hyg+1 g / L hydrolyzed casein+0.1 mg / L NAA), and light culture was performed at 26-28°C until regenerated plants were differentiated.

[0073] 6) Identification of positive plants

[0074] Total DNA was extracted from the transgenic rice, and specific primers were designed according to the tag gene of the vector and the target gene. PCR amplification was performed using the DNA as a template. The positive transgenic plants were determined according to the amplification bands and sequencing.

[0075] Example 4, Phenotype measurement and statistical analysis

[0076] HJX74, KO-OsWRKY45#1 and KO-OsWRKY45#2 plants were all planted in the field, with a vertical plant distance of 10-15 cm and a horizontal plant distance of 13-20 cm. After the seeds matured, the phenotype was photographed and measured, as follows:

[0077] Analysis of grain length and grain width: 35 grains were randomly collected for statistics.

[0078] All data were analyzed using Graphpad Prism 8 software, with SD representing standard deviation, and t-test for variance analysis.

[0079] Figure 1 Figure for the effect of different haplotypes of OsWRKY45 gene on rice grain size; A. Basic information of different haplotypes, W07 donor from Su Yunu, Hg1 donor from Zhan Xiang wild rice, and Hm3 donor from Southern wild rice; B. Grain type of HJX74 and different haplotype plants (scale = 1 cm); C. Grain length statistics of HJX74 and different haplotype plants (n = 80); D. Grain width statistics of HJX74 and different haplotype plants (n = 80); E. Grain length-width ratio statistics of HJX74 and different haplotype plants (n = 80); t-test for significance analysis, P < 0.05.

[0080] Figure 2 Figure for the effect of knockout OsWRKY45 gene on rice grain size; A. Mutation type of KO-OsWRKY45 lines; B. Grain type of HJX74 and KO-OsWRKY45 plants (scale = 1 cm); C. Grain length statistics of HJX74, KO-OsWRKY45#1 and KO-OsWRKY45#2 plants (n = 35); D. Grain width statistics of HJX74, KO-OsWRKY45#1 and KO-OsWRKY45#2 plants (n = 35); E. Grain length-width ratio statistics of HJX74, KO-OsWRKY45#1 and KO-OsWRKY45#2 plants (n = 35); t-test for significance analysis, **P < 0.01.

[0081] As can be seen from Figure 1 , the OsWRKY45 alleles in different haplotypes can significantly affect the grain length of plants, but not the grain width, and also affect the length-width ratio of plant grains. The haplotype in the HJX74 background is an excellent haplotype for increasing grain length and length-width ratio. In general, the OsWRKY45 gene can change the shape of plant grains.

[0082] From Figure 2 It can be seen from the above that knocking out the OsWRKY45 gene can significantly reduce the grain length of the plant, does not affect the grain width, and significantly reduces the length-width ratio of the grain of the plant. In general, knocking out the OsWRKY45 gene can change the shape of the grain of the plant.

[0083] The above embodiments are preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and are all included in the protection scope of the present application.

Claims

1. Knockout OsWRKY45 application of the gene in reducing grain length and / or grain length-width ratio of rice, the OsWRKY45 nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. The use according to claim 1, wherein: The OsWRKY45 The nucleotide sequence of the cDNA of the gene is shown as SEQ ID NO.

1.

3. The use according to claim 1, wherein: The OsWRKY45 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.

3.

4. The use according to claim 1, wherein: The material for knocking out a gene is sgRNA or a CRISPR system comprising sgRNA. OsWRKY45 The material for knocking out a gene is sgRNA or a CRISPR system comprising sgRNA. The 5'-3' targeting sequence of the sgRNA is: CTCCGCGACTCGCCGGAGGC.

5. The use according to any one of claims 1-4, wherein: The rice is Huajiangxian 74.

Citation Information

Patent Citations

  • WRKY45 gene of paddy rice, preparation method and application

    CN101003808A

  • Rice cells and rice plants

    US11220694B1