A MIP probe and its application in capturing and building a library for free DNA in urine

By designing a MIP probe suitable for the DNBSEQ sequencing platform, the problem of high error rates of fragmented damage and PCR amplification in the construction of urine free DNA capture library was solved, and efficient and low-cost single-strand DNA target region capture and sequencing was achieved, which improved the sensitivity and specificity of low-frequency mutation detection.

CN118995902BActive Publication Date: 2025-08-29CANCER INST & HOSPITAL CHINESE ACADEMY OF MEDICAL SCI +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411333309.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-24
Publication Date
2025-08-29
Estimated Expiration
2044-09-24

AI Technical Summary

Technical Problem

The prior art has problems such as fragmentation damage, high PCR amplification error rate, long operating cycle and high cost in the construction of urine free DNA, making it difficult to achieve efficient and highly sensitive single-stranded DNA target region capture and sequencing.

Method used

Design a MIP probe suitable for the DNBSEQ sequencing platform. By controlling the length of chromosomal DNA between the arms on both sides of the probe, it is compatible with single-stranded DNA, eliminates PCR amplification, simplifies the operation process, directly hybridizes and introduces the linker sequence, realizing circularization and index introduction.

Benefits of technology

It improves the efficiency of fragment conversion, reduces the background error introduced by PCR, saves operation time and sequencing costs, and improves the sensitivity and specificity of low-frequency mutation detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995902B_ABST
    Figure CN118995902B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biological sequencing technology, and discloses a MIP probe and its application in urine free DNA capture and library construction. The MIP probe includes, from 5'-3', a 5' capture arm, an F-terminal adapter containing 10nt hypoxanthine, an R-terminal adapter, and a 3' capture arm. The present method prepares a DNA library by complementary base pairing, extension, and connection of the capture arm, is compatible with DNA fragments of different lengths and single-stranded DNA, improves template utilization, and thus facilitates the detection of low-frequency mutations in urine free DNA. The present method fixes the length of the library insert fragment by controlling the span length of the chromosomal DNA to be tested between the capture arms on both sides of the probe, making the DNBSEQ platform sequencing fluorescence signal more uniform, and the data output and quality higher. The present method combines the three steps of capture, library construction, and machine library preparation, eliminating the operations such as intermediate library quality control and pre-capture drying and concentration in conventional methods, and the operation time is shorter; there is no PCR amplification during the capture and library construction process of the present method, which reduces the error accumulation due to PCR amplification, reduces background noise, and improves the sensitivity and specificity of low-frequency mutation detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application belongs to the technical field of nucleic acid targeted enrichment sequencing, and specifically relates to a MIP probe and its application in capturing and building a library of free DNA in urine. Background Art

[0002] Molecular antisense probe technology (MIP) is a capture technology based on ligation-PCR reaction. Its advantage lies in its high specificity, and the fragments after capture are directly used to complete the library construction. The principle is to design a pocket-shaped probe, the probe sequence includes a universal sequence of the adapter and capture arms at the 5' and 3' ends of the probe that can specifically complement each other with the target region. In actual applications, the capture arm first specifically anneals with the target region sequence, and then uses DNA polymerase to fill the probe gap. At the same time, DNA ligase is added to connect the gap to form a complete circular probe. The remaining uncaptured probes and DNA sequences are removed by exonuclease digestion. The complete circular probe contains the target sequence and the universal sequence of the adapter. Finally, an index primer that can anneal to the universal sequence of the adapter is used to complete the index introduction and library amplification for sequencing.

[0003] Single molecule molecular inversion probes (smMIP) is a traceable antisense probe technology developed based on MIP technology. Its characteristic is the introduction of a single molecule tag (Unique Molecular Identifier, UMI) into the previous antisense capture probe sequence. By tracing the original library template through the UMI, the background error introduced by conventional antisense probe technology due to PCR amplification is greatly reduced, and the error rate of single base estimation in clinical samples is reduced to 2.6×10 -5 This technology was first reported by Hiatt et al. in 2013 for the detection of low-frequency or subclonal variants. In 2015, Carlson et al. applied smMIP technology to multiplex genotyping of germline and somatic STR variants, addressing the challenges of aligning reads of low-complexity short fragments and the high-frequency nonspecific sequence interference in STR amplification.

[0004] Cell-free DNA (cfDNA) refers to highly fragmented DNA that exists in the human body's fluid circulation and is free from cells. It mainly originates from cell apoptosis, tissue necrosis, and autoimmune cell killing. The fragmented genomic DNA released after the rupture of dead tumor cells is called ctDNA (circulating tumor DNA). It contains information on mutations and epigenetic changes in the tumor genome and can be used as a test sample for early screening, diagnosis, medication guidance, and recurrence monitoring of tumors. As an ultra-noninvasive sample source, urine has significant advantages over tissue and blood in terms of compliance, convenience, and sample size. Urine cfDNA (urine cell-free DNA, ucfDNA) carries the genetic information of tumor cells that have directly apoptotically transformed into the urine, as well as the genetic information of tumors in other organs that are transported from the body fluid circulation into the urine. It is considered an effective ultra-noninvasive sample type for cancer detection.

[0005] Previous experience and literature reports have shown that ucfDNA has a more complex fragment distribution than blood-derived cfDNA. It contains not only common cfDNA fragments (fragment length of approximately 150-200bp) but also large DNA fragments, and there is strong heterogeneity between samples. Conventional capture library construction methods require DNA fragmentation before library construction. The resulting DNA damage and excessive fragmentation (small fragments) will lead to low fragment conversion efficiency. Clinical DNA samples, especially those of poor quality, contain single-stranded DNA. Conventional library construction methods do not support single-stranded template conversion and will also cause template loss. Secondly, conventional library construction uses PCR amplification, and each cycle uses the product of the previous cycle as a template. Amplification errors accumulate logarithmically, the error background is high, and it is impossible to determine which low-frequency mutations are true mutations. The detection sensitivity is low. At the same time, the capture sequencing of the target region in the past required two steps of PCR (library construction PCR and post-capture PCR). PCR generates repeated DNA fragments, resulting in redundant sequencing data and wasteful sequencing costs. Again, the conventional target region capture sequencing process based on the DNBSEQ sequencing platform requires 12 steps to complete the library preparation on the machine, including DNA fragmentation, library construction, intermediate library quality control, pooling, capture, elution, capture library quality control, pooling before circularization, circularization, circularization quality control, DNB preparation, and DNB quality control. It takes about 3 days to complete, with a long cycle and high labor costs.

[0006] Therefore, there is an urgent need to seek an efficient and highly sensitive single-stranded DNA target region capture sequencing method based on DNBSEQ sequencing technology. Summary of the Invention

[0007] To overcome these technical challenges, this application discloses a molecular antisense probe (MIP probe) for capturing cell-free DNA in urine, suitable for the DNBSEQ sequencing platform. It also develops a method for capturing target regions and building libraries based on this probe. This experimental method offers advantages such as high template DNA conversion efficiency, no PCR-induced errors, short operation time, and low sequencing costs.

[0008] To achieve this goal, this application specifically adopts the following technical solutions:

[0009] In a first aspect, the present application provides a MIP probe, which comprises, from 5' to 3', a 5' capture arm, an F-terminal linker containing 10 nt hypoxanthine, an R-terminal linker, and a 3' capture arm.

[0010] In this application, the 5' and 3' capture arms in the MIP probe are designed based on the target sequence. By controlling the span length of the chromosomal DNA to be tested between the capture arms on both sides of the MIP probe, the length of the library insert is fixed, making the DNBSEQ platform sequencing fluorescence signal more uniform and the data output and quality higher. The MIP probe of this application is designed with F-terminal adapters and R-terminal adapters. The adapter sequence can be introduced by complementary pairing, extension, and connection between the capture arm and the target region of the chromosome to be tested, so that the probe supports the addition of adapters to both single-stranded DNA and denatured double-stranded DNA, overcoming the defect of TA connection that cannot utilize free single-stranded DNA in the template.

[0011] Furthermore, the F-terminal adapter includes, from 5' to 3', a DNBSEQ sequencing platform F-terminal adapter sequencing primer binding region, 10 nt hypoxanthine, and a DNBSEQ sequencing platform F-terminal adapter terminal sequence.

[0012] Furthermore, the R-end adapter includes, from 5' to 3', a DNBSEQ sequencing platform R-end adapter terminal sequence and a DNBSEQ sequencing platform R-end adapter sequencing primer binding region.

[0013] In this application, the F-terminal linker of the MIP probe also contains 10nt hypoxanthine, namely IIIIIIIIII. By introducing the index in this way, circularization can be completed while building the library, eliminating the need for post-capture library quality control and pooling operations.

[0014] Furthermore, the sequence length of the 5' capture arm or 3' capture arm is 20-30nt, for example, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt. The capture arm length can also be selected to meet the annealing temperature of 60-70°C with the target region of the chromosomal DNA to be tested.

[0015] Furthermore, the MIP probe sequence (from 5' to 3'):

[0016] / PHO / XXXXXXXXXXXXXXXXXXXXAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAAII IIIIIIIICAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTTXXXXXXXXXXXX XXXXXXX*X.

[0017] From 5' to 3', preferably, " / PHO / " indicates phosphorylation modification, "XXXXXXXXXXXXXXXXXXXX" indicates the 5' capture arm (specifically corresponding to the target region)

[0018] heterosexual hybridization probe sequence);

[0019] Preferably, AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (SEQ ID NO. 1) is the F-terminal adapter sequencing primer binding region;

[0020] Preferably, "I" represents hypoxanthine base;

[0021] Preferably, CAACTCCTTGGCTCACA (SEQ ID NO. 2) represents F-terminal

[0022] head-end sequence;

[0023] Preferably, GAACGACATGGCTACGATCCGACTT (SEQ ID NO. 3)

[0024] Indicates the R linker end sequence;

[0025] "XXXXXXXXXXXXXXXXXXXXX*X" indicates the 3' capture arm (with the target region

[0026] domain-specific hybridization probe sequence), and “*” indicates thiolation modification.

[0027] In a second aspect, the present application also provides a method for capturing and building a library of free DNA in urine based on the DNBSEQ sequencing platform, the method comprising the following steps:

[0028] (1) mixing the MIP probe described in the first aspect of the present application with the sample DNA to be sequenced, and performing denaturing hybridization;

[0029] (2) the 3' capture arm of the MIP probe is extended, connected, and digested with an exonuclease to obtain a capture product;

[0030] (3) denaturing the captured product, extending and ligating it with Index oligo to obtain a circularized Index library;

[0031] (4) DNB preparation and library construction are completed.

[0032] Using the above technical solution, since the capture arm designed in the MIP probe has achieved the regulation of the length of the library insert fragment, the genomic DNA to be tested does not need to be interrupted and the library can be directly hybridized to build the library, overcoming the disadvantage of DNA fragmentation before library construction in conventional methods causing loss of degraded DNA (small fragment DNA), and greatly improving the fragment conversion efficiency. At the same time, it is also compatible with single-stranded DNA library construction, overcoming the technical limitations of conventional DNA library construction processes (end repair, A-tailing, adapter ligation, PCR) that cannot be used to build libraries for single-stranded DNA templates. Secondly, there is no PCR amplification in the entire process of this method, which reduces the accumulation of background errors introduced by PCR logarithmic amplification, reduces background noise, and makes data redundancy ≈ 0%. High-depth sequencing can be achieved at extremely low data volumes, improving the sensitivity and specificity of low-frequency mutation detection. It saves the sequencing cost waste caused by redundant data, especially in low-starting amount library construction and high-depth sequencing, which can save 80%-90% of sequencing costs. In addition, this method also eliminates the operations such as intermediate library quality control and pre-capture drying and concentration in conventional methods, and the operation time is shorter.

[0033] Furthermore, the hybridization treatment temperature in step (1) is 60-65°C, and the hybridization treatment time is 15-17h. Preferably, the treatment temperature is 61°C, 62°C, 63°C, 64°C, 65°C, and specific values ​​between the above values. Due to space limitations and for the sake of brevity, this application no longer exhaustively lists the specific values ​​included in the range. Similarly, the hybridization treatment time can be 15h, 15.5h, 16h, 16.5h, 17h, and specific values ​​between the above values. Due to space limitations and for the sake of brevity, this application no longer exhaustively lists the specific values ​​included in the range.

[0034] Furthermore, both step (2) and step (3) include a magnetic bead purification step.

[0035] Furthermore, the DNB in ​​step (4) is prepared by rolling circle amplification.

[0036] In a third aspect, the present application also provides a sequencing library, which is prepared using the method described in the second aspect of the present application.

[0037] In a fourth aspect, the present application also provides a method for sequencing urine cell-free DNA nucleic acid, comprising the step of sequencing the sequencing library, wherein the sequencing is performed using a DNBSEQ sequencing platform.

[0038] Compared with the existing technology, this application has the following technical effects:

[0039] (1) The MIP probe designed in this application fixes the length of the library insert fragment by controlling the length of the chromosomal DNA span between the capture arms on both sides of the probe. In actual operation, there is no need to fragment the DNA template for library construction, thus avoiding the template loss caused by secondary fragmentation of degraded samples and improving the fragment conversion efficiency. Secondly, the adapter sequence is introduced by complementary pairing, extension, and connection between the probe capture arm and the target region of the template DNA, so that it can simultaneously support single-stranded DNA and denatured double-stranded DNA with adapters, overcoming the defect that TA connection cannot utilize free single-stranded DNA in the template.

[0040] (2) The capture library construction method provided in this application has fixed the length of the inserted fragment during the probe design process, eliminating the need for interruption operations, is compatible with single-stranded DNA, and improves the shortcoming of conventional DNA library construction processes (end repair, A-tailing, linker ligation, PCR) that cannot be used to construct libraries for single-stranded DNA templates; the introduction of the index simultaneously completes the circularization, eliminating the need for post-capture library quality control and pooling operations. There is no PCR amplification during the capture and library construction process, which reduces the accumulation of errors caused by PCR amplification, reduces background noise, and improves the sensitivity and specificity of low-frequency mutation detection.

[0041] (3) The capture library construction method provided in this application adopts a highly integrated experimental process of each step, and the capture and library construction are completed at the same time, eliminating the operations such as intermediate library quality control and pre-capture drying and concentration in conventional methods. The overall operation time is saved by about 1 day compared with the conventional method. In actual application, it is more operational and avoids the waste of manpower costs caused by overtime work. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] In order to more clearly illustrate the specific implementation of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the specific implementation.

[0043] Figure 1 Schematic diagram of the MIP probe structure of Example 1 of the present application.

[0044] Figure 2 Schematic diagram of the molecular reaction for library construction in Example 2 of the present application.

[0045] Figure 3 The base distribution diagram (Figure A) and data quality distribution diagram (Figure B) of the library obtained in Example 2 of this application.

[0046] Figure 4 The effective depth of the library (Figure A), capture efficiency (Figure B) and coverage uniformity (Figure C) obtained in Example 2 of the present application. DETAILED DESCRIPTION

[0047] The present invention is further described below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, where specific conditions are not specified, are generally based on conventional conditions, conditions described in laboratory manuals, or conditions recommended by the manufacturer.

[0048] Example 1 Preparation of MIP probe

[0049] The capture probe sequence was designed based on the target region of the DNA sample from urine supernatant. The MIP probe structure is as follows: Figure 1 As shown, from 5' to 3', it includes: 5' capture arm, DNBSEQ sequencing platform F-terminal adapter sequencing primer binding region, 10nt hypoxanthine, DNBSEQ sequencing platform F-terminal adapter sequence, DNBSEQ sequencing platform R-terminal adapter sequence and DNBSEQ sequencing platform R-terminal adapter sequencing primer binding region. The specific sequence structure is shown below.

[0050] Probe sequence (from 5' to 3'):

[0051] / PHO / XXXXXXXXXXXXXXXXXXXXAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAAII IIIIIIIICAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTTXXXXXXXXXXXX XXXXXXX*X.

[0052] Wherein, “ / PHO / ” indicates phosphorylation modification, “X” indicates the probe sequence that specifically hybridizes with the target region, “I” indicates hypoxanthine base, and “*” indicates thiolation modification.

[0053] From 5' to 3', preferably, " / PHO / " indicates phosphorylation modification, "XXXXXXXXXXXXXXXXXXXX" indicates the 5' capture arm (specifically corresponding to the target region)

[0054] heterotropic hybridization probe sequences).

[0055] Preferably, AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (SEQ ID NO. 1) is the F-terminal adapter sequencing primer binding region.

[0056] Preferably, "I" represents hypoxanthine base.

[0057] Preferably, CAACTCCTTGGCTCACA (SEQ ID NO. 2) represents the F linker terminal sequence.

[0058] Preferably, GAACGACATGGCTACGATCCGACTT (SEQ ID NO. 3)

[0059] Indicates the R linker end sequence.

[0060] "XXXXXXXXXXXXXXXXXXXXX*X" indicates the 3' capture arm (with the target region

[0061] domain-specific hybridization probe sequence), and “*” indicates thiolation modification.

[0062] The MIP probe panel covers an area of ​​0.2M and is custom-synthesized by our company. It covers 20 gene regions related to urothelial carcinoma, namely POU4F2, TWIST1, SOX1, ONECUT2, OTX1, HAND2, HOXA9, ULBP1, BCL2, FEZF2, ZNF154, EOMES, EDNRB, NID2, SOX17, GALR1, DMRTA2, IRAK3, KCNJ2, and NPR3.

[0063] Example 2

[0064] The MIP probe prepared in Example 1 was used to complete the capture and sequencing of the target region of the urine supernatant DNA sample. The experimental process is as follows: Figure 2 As shown, it includes: DNA + probe denaturation → probe hybridization → 3' capture arm extension and ligation → exonuclease digestion → magnetic bead purification → capture product denaturation → index oligo extension → index oligo ligation → magnetic bead purification → circularized library denaturation → DNB preparation → sequencing, specifically including the following steps.

[0065] 1. DNA+probe denaturation and probe hybridization

[0066] Take 10 ng of urine supernatant-derived ucfDNA sample and prepare the reaction system according to Table 1 in a PCR reaction tube.

[0067] Table 1 DNA, probe denaturation hybridization mix

[0068]

[0069] PCR reaction program: 95°C for 5 min, 65°C for 16 h; 65°C, hold, 65°C for 30 min; 80°C for 20 min; 4°C, hold; overnight hybridization.

[0070] 2. 3' capture arm extension

[0071] The next morning at approximately 9:00 AM, prepare the "3' Capture Arm Extension Mix" according to Table 2 and vortex to mix thoroughly. While the reaction tube is still in the PCR instrument, add 15 μL of the "3' Capture Arm Extension Mix" to the reaction tube. Pipette to mix thoroughly and incubate at 65°C for 1 minute.

[0072] Table 2 3' capture arm extension mix

[0073]

[0074]

[0075] 3. Capture product connection

[0076] During the extension incubation period, prepare the "Capture Product Ligation Mix" according to Table 3 and vortex to mix thoroughly. After the "3' Capture Arm Extension" reaction is complete, keep the reaction tube in the PCR instrument and add 5 μL of the "Capture Product Ligation Mix" to the reaction tube. Pipette to mix thoroughly and incubate at 65°C for 15 minutes.

[0077] Table 3 Capture product ligation mix

[0078]

[0079] 4. Exonuclease digestion

[0080] During the incubation period, remove the exonuclease from the -20°C freezer and place it in an ice box until ready to use. At the end of the incubation period, while the reaction tube is still in the PCR instrument, add 5 μL of Exonuclease I (20 units / μL) to the reaction tube and mix thoroughly by pipetting. Set the PCR program to: 65°C for 30 minutes; 80°C for 20 minutes; and 4°C for a hold.

[0081] 5. Magnetic bead purification

[0082] During the incubation period, remove the Ampure XP purification magnetic beads from the 4°C refrigerator and allow them to equilibrate at room temperature before performing magnetic bead purification according to the following steps.

[0083] a) After the exonuclease digestion reaction is completed, add 65 μL of nuclease-free water to the reaction system, shake to mix, and centrifuge. Transfer the mixture to a 1.5 mL low-binding centrifuge tube;

[0084] b) Add 250 μL of AMPure XP purified magnetic beads to each reaction tube, vortex to mix, centrifuge briefly, and incubate at room temperature for 10 minutes. c) After the incubation period, place the tubes on a magnetic rack. Allow the solution to clear and discard the supernatant.

[0085] d) Add 400 μL of freshly prepared 80% ethanol solution to the centrifuge tube, invert the tube once, and discard the supernatant;

[0086] e) Repeat the rinse with 400 μL of 80% ethanol for a total of 2 rinses;

[0087] f) Place the tube containing the magnetic beads in a palm-top centrifuge for a short spin, then place it on a magnetic stand and use a 20 μL pipette to remove any remaining ethanol.

[0088] g) Open the lid and let the beads dry at room temperature until they are matte (approximately 5 minutes).

[0089] h) Add 40 μL of IDTE to the magnetic beads to resuspend them and incubate at room temperature for 10 minutes;

[0090] i) After incubation, place the centrifuge tube on a magnetic rack. Once the supernatant becomes colorless and transparent, transfer it to a new 0.2 mL PCR tube for subsequent experiments.

[0091] 6. Capture product denaturation

[0092] Place 40 μL of the purified capture product in a PCR instrument and incubate at 95°C for 5 minutes, followed by a 95°C hold. Prepare crushed ice during the incubation. After the 5-minute incubation, remove the sample from the PCR instrument and immediately place it on crushed ice for another 5 minutes.

[0093] 7. Index oligo extension

[0094] While in the ice bath, prepare the "Index Oligo Extension Mix" according to Table 4, vortex to mix, and centrifuge. After the ice bath, add 10 μL / rxn of the "Index Oligo Extension Mix" to the denatured capture product tube on ice and mix thoroughly by pipetting. In a thermal cycler, run the following program: 65°C, 30 min; 4°C, hold.

[0095] Table 4 Index oligo extension mix

[0096]

[0097] The sequence of Index oligo is:

[0098] / PHO / TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCG ACT*T (SEQ ID NO. 4), wherein “ / PHO / ” indicates phosphorylation modification, “N” indicates index sequence, and “*” indicates thiolation modification.

[0099] 8. Index oligo connection

[0100] During the reaction, prepare the "Index Oligo Ligation Mix" according to Table 5, vortex to mix, and centrifuge. After the ice bath, add 10 μL / rxn of the "Index Oligo Ligation Mix" to the denatured capture product tube on ice and mix thoroughly by pipetting. In a PCR instrument, run the following program: 60°C, 30 min; 4°C, hold.

[0101] Table 5 Index oligo connection mix

[0102]

[0103] 9. Magnetic bead purification

[0104] a) After the index oligo ligation reaction is complete, add 150 μL of Ampure XP purified magnetic beads to each reaction tube, vortex to mix, centrifuge briefly, and incubate at room temperature for 10 minutes.

[0105] b) After incubation, place the centrifuge tube on a magnetic rack; wait for the solution to clarify and discard the supernatant;

[0106] c) Add 400 μL of freshly prepared 80% ethanol solution to the centrifuge tube, invert the tube once, and discard the supernatant;

[0107] d) Repeat the rinse with 400 μL of 80% ethanol for a total of 2 rinses;

[0108] e) Place the tube containing the magnetic beads in a palm-top centrifuge for a short spin, then place it on a magnetic rack. Use a 20 μL pipette to remove any remaining ethanol.

[0109] f) Open the lid and let the beads dry at room temperature until they are matte (approximately 5 minutes).

[0110] g) Add 22 μL of IDTE to the magnetic beads to resuspend them and incubate at room temperature for 10 minutes;

[0111] h) After incubation, place the centrifuge tube on a magnetic rack. Once the supernatant becomes colorless and transparent, transfer it to a new 0.2 mL PCR tube. i) For single sample testing, directly use the purified product for DNB preparation.

[0112] 10. Denaturation of the circularized library

[0113] Prepare the "Circularization Library Denaturation Reaction System" according to Table 6, shake and mix thoroughly, centrifuge briefly, and then place in a PCR instrument and run the PCR program: 95°C for 1 min, 65°C for 1 min, 60°C for 1 min, 4°C hold; heat the lid at 105°C.

[0114] Table 6 Denaturation reaction system of circularized library

[0115]

[0116] The DNB preparation buffer contains the RCAOligo sequence from 5' to 3': CCTTGGCTCACAGAACGACATGGCTAC*G (SEQ ID NO. 5), where "*" indicates thio modification.

[0117] 11. DNB preparation

[0118] During the reaction, prepare the "DNB preparation reaction system" according to Table 7, vortex to mix, and centrifuge briefly. After the circularized library denaturation is complete, remove the samples from the PCR reaction and add 44 μL of the "DNB preparation mix" to each sample on ice. Mix thoroughly by pipetting. Then, place the sample in a thermal cycler and run the following program: 0°C for 25 min, 4°C hold, and 35°C heated lid.

[0119] Table 7 DNB preparation reaction system

[0120]

[0121] The database is built.

[0122] Example 2 Sequencing on a Machine

[0123] After the DNB preparation reaction in Example 1 is complete, remove the reaction system from the PCR instrument and add 20 μL of DNB stop buffer to each reaction tube. Gently pipette and mix five times using a wide-bore pipette tip. Quantify 2 μL of the DNB solution using the Qubit ssDNA Assay Kit. Combine the solution with the other libraries based on the quantification results and data weight. All the mixed DNBs are then loaded onto the sequencing chip.

[0124] Effect Examples

[0125] The DNA library obtained in Example 2 was tested for base distribution and data quality distribution, and the quality of the DNA library was evaluated from the perspectives of effective depth, capture efficiency, and coverage uniformity.

[0126] Test results such as Figure 3 and Figure 4 As shown, from Figure 3 It can be seen that the bases in the insert region of the library are balanced and the overall Q30 distribution of the offline data is normal. Figure 4 As can be seen in Figure A, effective sequencing depths are >2500×, with a theoretical template conversion rate of 85%-94% (calculated based on a 3.3pg human genome and a 10ng starting library), significantly superior to traditional capture sequencing (30%-50%). Figures B and C show that both capture efficiency and 0.5× average depth coverage are >98%, significantly higher than traditional capture sequencing (capture efficiency 40%-70%, 0.5× average depth coverage 85%-95%), demonstrating the expected improvement.

[0127] Comparative Example

[0128] Comparative Example 1

[0129] Synchronously use the method of the embodiment of the present application and the conventional method (library construction: Plasma Cell-Free DNA Double-End Molecular Tagging Library Construction Kit (for MGI), Capture: xGen TM Hybridization capture of DNA libraries was used to sequence the target region of 10 FFPE samples with a primary fragment size of approximately 130-170 bp (the target region for both methods was the same, 0.2 MB). The average effective depth was calculated using the same data volume. The results are shown in Table 8. It can be seen that with 10% of the data volume of the conventional method, the effective depth of this method reached 250%-300% of that of the conventional method.

[0130] Table 8 Average effective depth of samples

[0131]

[0132] Comparative Example 2

[0133] Using the conventional method (same as comparative example 1) and the method of the present application, 100ng of blood cell genomic DNA was denatured at 95°C for 5 minutes for 5 cases to build libraries. The results showed that after 8 cycles of amplification using the conventional method, the total library volume was less than 50ng, which was insufficient to support the subsequent capture process, and the library construction failed. However, using this method, the library construction and capture (target area 0.2M) were successfully completed and sequenced on the machine. The data quality control results are shown in Table 9. The pre-arranged amount was 1.5G, and the actual output was about 1.8G of data, the dup rate was ≈0%, and the effective depth was 5000×~6000×. The data quality can meet the detection requirements of the second-generation sequencing platform for 0.1% variation.

[0134] Table 9 Data quality control results

[0135]

[0136]

[0137] Comparative Example 3

[0138] The method of this application and the conventional method (same as comparative example 1) were used to capture and sequence 3 DNA samples derived from urine supernatant, respectively. The starting amount for library construction was 5 ng. The conventional method performed 10 cycles of PCR amplification for library construction and 5 cycles of PCR amplification after capture. The library after capture was sequenced using a DNBSEQ-2000 sequencer. The target depth was >15000×. The base error rate of the offline data was calculated using our company's data quality control process. The results showed that the base error rate of the 3 samples using the conventional method was approximately 0.0033%-0.004%, and the base error rate of the 3 samples using this method was approximately 0.0022%-0.0036%. The error rate of this method was lower.

[0139] Comparative Example 4

[0140] The time consumption of Example 1 and the conventional method (same as Comparative Example 1) was calculated in actual operation, as shown in Tables 10-11.

[0141] Table 10 Operation time of each step of the method in Example 1

[0142]

[0143] Table 11 Operation time of each step of conventional method

[0144]

[0145]

[0146] The total time required for this method was 23.24 hours, compared to 29.33 hours for the conventional method, saving 6.09 hours. Furthermore, the second day of operation required 6.74 hours for this method, compared to 8 hours for the conventional method, which may have resulted in overtime and increased labor costs.

[0147] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. A method for capturing and building a library of urine cell-free DNA based on the DNBSEQ sequencing platform, characterized in that: The capture library construction method comprises the following steps: (1) Mixing the MIP probe with the urine sample DNA to be sequenced and denaturing and hybridizing; wherein the MIP probe includes, from 5' to 3', a 5' capture arm, an F-terminal adapter, an R-terminal adapter, and a 3' capture arm in sequence; the F-terminal adapter includes, from 5' to 3', a DNBSEQ sequencing platform F-terminal adapter sequencing primer binding region, 10nt hypoxanthine, and a DNBSEQ sequencing platform F-terminal adapter terminal sequence; the R-terminal adapter includes, from 5' to 3', a DNBSEQ sequencing platform R-terminal adapter terminal sequence; and the sequence length of the 5' capture arm or the 3' capture arm is 20-30nt; The sequence of the F-terminal adapter sequencing primer binding region of the DNBSEQ sequencing platform is shown in SEQ ID NO.1, the F-terminal sequence of the DNBSEQ sequencing platform is shown in SEQ ID NO.2, and the R-terminal sequence of the DNBSEQ sequencing platform is shown in SEQ ID NO.3; (2) The 3' capture arm of the MIP probe is extended, connected, and digested with an exonuclease to obtain a capture product; (3) Denaturing the captured product, extending and ligating it with Index oligo to obtain a circularized Index library; wherein the sequence of the Index oligo is shown in SEQ ID NO. 4; (4) DNB preparation and library construction are completed.

2. The capture library construction method according to claim 1, characterized in that: The hybridization treatment temperature in step (1) is 60-65° C., and the hybridization treatment time is 15-17 h.

3. The capture library construction method according to claim 1, characterized in that: The step (2) and the step (3) both include a magnetic bead purification step.

4. The capture library construction method according to claim 1, characterized in that: In step (4), DNB is prepared by rolling circle amplification.

5. A urine cell-free DNA sequencing library based on the DNBSEQ sequencing platform, characterized in that: Prepared by the method described in any one of claims 1 to 4.

6. A method for sequencing urine free DNA for purposes other than disease diagnosis and treatment, characterized in that: The method comprises the step of sequencing the sequencing library according to claim 5, wherein the sequencing is performed using a DNBSEQ sequencing platform.

Citation Information

Patent Citations

  • Sequencing library building method and reagent based on molecular inverse probe

    CN105714383A