Use of an expression inhibitor of bovine CXXC1 protein in the preparation of a product for inhibiting Mycobacterium tuberculosis

Abstract

The present invention belongs to the technical field of animal husbandry, and specifically relates to the use of an expression inhibitor of bovine CXXC1 protein in the preparation of a product for inhibiting tuberculosis. Experimental verification shows that the interference of CXXC1 inhibits the survival of tuberculosis, indicating that the expression inhibitor of bovine CXXC1 protein can be used as a potential substance for resisting tuberculosis infection, and bovine CXXC1 protein can provide new ideas for breeding anti-tuberculosis animals.

Description

Technical Field

[0001] The invention belongs to the technical field of animal husbandry, and in particular relates to use of an expression inhibitor of bovine CXXC1 protein in preparing a product for inhibiting mycobacterium tuberculosis. Background Art

[0002] Bovine tuberculosis is a chronic, consumptive zoonotic infectious disease mainly caused by Mycobacterium bovis, which causes significant economic losses to the cattle industry and seriously threatens public health safety. Bovine tuberculosis has become a key issue affecting the sustainable development of my country's cattle industry, and the discovery and application of bovine tuberculosis resistance genes is an important basis for breeding tuberculosis-resistant dairy cows.

[0003] Coronin-1A is a tryptophan / aspartic acid-containing coat protein encoded by the coro1a gene that is widely expressed in eukaryotic cells. The transcription and expression levels of coro1a are significantly increased after infection with Mycobacterium tuberculosis. Mycobacterium tuberculosis retains Coronin-1A on phagosomes to prevent phagosome-lysosome fusion, thereby escaping the host cell's clearance of Mycobacterium tuberculosis. The loss of coro1a significantly increases the host cell's ability to resist Mycobacterium tuberculosis infection. Therefore, targeted inhibition of coro1a expression can be used as a potential strategy for breeding tuberculosis-resistant dairy cows.

[0004] The literature currently reports that complete knockout of coro1a will cause decreased survival of naive T cells and damage to the central nervous system in mice. In addition, modification based on coro1a itself will also cause problems such as changes in the macrophage endocytosis pathway. Targeted inhibition of the coro1a expression pathway without changing coro1a itself can be used as a new strategy. Therefore, finding the key sequence that regulates coro1a expression is an urgent problem to be solved.

[0005] CXXC1 is one of the proteins that specifically binds to the coro1a promoter region, which was screened from cells infected with Mycobacterium tuberculosis by DNA-pull down technology, using the coro1a promoter region as a probe. As a transcriptional activator, this protein specifically binds to unmethylated CpG motifs through its CXXC domain; it is a component of the SETD1 complex, regulates gene expression, and is essential for vertebrate development. Therefore, exploring the role of CXXC1 protein in regulating coro1a gene expression and its key sequence can provide potential targets for subsequent targeted reduction of coro1a expression and anti-tuberculosis dairy cow breeding. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a use of an expression inhibitor of bovine CXXC1 protein in preparing a product for inhibiting Mycobacterium tuberculosis. Experimental verification shows that interference with CXXC1 inhibits the survival of Mycobacterium tuberculosis.

[0007] The specific technical solutions provided by the present invention are as follows:

[0008] The present invention provides use of an expression inhibitor of bovine CXXC1 protein in preparing a product for inhibiting Mycobacterium tuberculosis.

[0009] As a preferred embodiment of the present invention, the expression inhibitor of bovine CXXC1 protein is an interfering RNA of bovine CXXC1 protein, and the sequence of the interfering RNA is:

[0010] siCXXC1-sense: 5'-GGUACAAGCUGGACGAGCUGUUUGA-3',

[0011] siCXXC1-antisense:5'-UCAAACAGCUCGUCCAGCUUGUACC-3'.

[0012] As a preferred embodiment of the present invention, the expression inhibitor of bovine CXXC1 protein is used to prepare a product for resisting Mycobacterium tuberculosis infection.

[0013] As a preferred embodiment of the present invention, the expression inhibitor of bovine CXXC1 protein is used for breeding of anti-tuberculosis animals.

[0014] As a preferred embodiment of the present invention, the animal is a dairy cow.

[0015] As a preferred embodiment of the present invention, the product is a medicine or a feed additive.

[0016] The present invention also provides a drug for inhibiting Mycobacterium tuberculosis, wherein the drug uses the expression inhibitor of the bovine CXXC1 protein as the only effective active ingredient.

[0017] As a preferred embodiment of the present invention, the drug includes a pharmaceutically acceptable excipient. The excipient is specifically selected according to the dosage form of the drug, and the dosage form of the drug can be an oral preparation or an injection preparation. Exemplarily, the oral preparation can be selected from granules, tablets, powders or other liquid preparations such as suspensions.

[0018] The present invention also provides a feed additive for inhibiting Mycobacterium tuberculosis, wherein the feed additive comprises the expression inhibitor of the bovine CXXC1 protein, and the expression inhibitor of the bovine CXXC1 protein is used as the only active ingredient for inhibiting Mycobacterium tuberculosis.

[0019] As a preferred embodiment of the present invention, the feed additive includes veterinary acceptable auxiliary materials. The feed additive can be used together with ordinary feed, and the ordinary feed is adaptively selected according to the feeding object, and no further restrictions are made here.

[0020] Compared with the prior art, the beneficial effects of the present invention are:

[0021] The present invention provides a use of an expression inhibitor of bovine CXXC1 protein in preparing a product for inhibiting tuberculosis. Experimental verification shows that by using interfering RNA to reduce the expression of CXXC1, the transcription of the coro1a gene is significantly inhibited, and CXXC1 mainly regulates the transcription of the coro1a gene by binding to the CpG sequence in the promoter region of the coro1a gene. At the same time, the interference of CXXC1 inhibits the survival of tuberculosis mycobacterium, indicating that the expression inhibitor of bovine CXXC1 protein can be used as a potential substance for resisting tuberculosis mycobacterium infection, and can provide new ideas for anti-tuberculosis animal breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the effect of overexpression of CXXC1 in EBL cells for 48 h on the transcription level of coro1a ;

[0023] Figure 2 is the effect of interference with -CXXC1 on the transcription level of coro1a in EBL cells after 48 h by qRT-PCR;

[0024] Figure 3 is the dual luciferase reporter system to detect the binding activity of CXXC1 to the coro1a gene promoter;

[0025] Figure 4 is a schematic diagram of the domain structure of CXXC1;

[0026] Figure 5 It is the prediction result of CpG sequence in coro1a promoter sequence;

[0027] Figure 6 is a schematic diagram of the promoter lacking CpG sequences;

[0028] Figure 7 is a dual luciferase reporter system to detect the binding activity of CXXC1 to the CpG-deficient coro1a gene promoter;

[0029] Figure 8 The CFU assay is used to investigate the effect of interfering with CXXC1 on the intracellular survival of Mycobacterium tuberculosis. DETAILED DESCRIPTION

[0030] Materials and methods

[0031] 1. Vector construction

[0032] (1) PCR amplification of the bovine CXXC1 CDS sequence and the sequence containing the coro1a promoter

[0033] Primers were designed using Primer Primer 5 software based on the bovine CXXC1 mRNA sequence in the NCBI database, and the sequence containing the CXXC1 CDS region was amplified by PCR using bovine lung epithelial cell cDNA as a template.

[0034] The bovine CXXC1 mRNA sequence is shown in SEQ ID NO.19:

[0035]

[0036] The primer sequences are as follows:

[0037] CXXC1-F: 5′-GACGCTGCCGAGTGGTCTGT-3′, as shown in SEQ ID NO. 1;

[0038] CXXC1-R: 5′-TCCGAGGCCCTCTGGTAA-3′, as shown in SEQ ID NO.2.

[0039] The PCR system is shown in Table 1.

[0040] Table 1 PCR system

[0041]

[0042] PCR program: 98°C pre-denaturation for 3 min, 98°C denaturation for 10 s, 56°C annealing for 5 s, 72°C extension for 2 min 30 s, 30 cycles.

[0043] The amplified product was subjected to nucleic acid electrophoresis on 1% agarose gel, and the target band of 2215 bp was recovered for subsequent amplification.

[0044] Design seamless cloning gene fragment primers: Based on the bovine CXXC1 CDS sequence, p3×Flag-CMV was used as the backbone vector, NotⅠ was used as the linearization single restriction site, and the website for online seamless cloning primer design of Beijing Quanshijin Company (soft.transgen.com / index.php) was used. The above amplified product was used as a template to PCR amplify the CXXC1 CDS sequence, and the 1977bp target band was recovered for subsequent connection. The primer sequences are as follows: (the lowercase letters in the primer sequence are the homologous sequences of the connection fragments)

[0045] CXXC1-F-2: 5′-cgatgacaagcttgcgATGGAGGGCGACGCTTCA-3′, as shown in SEQ ID NO. 3;

[0046] CXXC1-R-2: 5'-tatcgatgaattcgcTCAGCGCTCGGCGTTTGA-3', as shown in SEQ ID NO.4.

[0047] The sequence containing the coro1a promoter is the 2000bp sequence upstream of the coro1a 5'UTR, which was synthesized by Beijing Qingke Biotechnology Co., Ltd., using pGL4.10 as the backbone vector and KpnⅠ as the linearization single restriction site. Seamless cloning primers were designed, and the above synthetic sequence was used as a template to PCR amplify the QDZ sequence and QDZ-ΔCpG, and the 2000bp target band was recovered for subsequent connection.

[0048] coro1a contains a 2000 bp sequence of the promoter, as shown in SEQ ID NO.18:

[0049]

[0050]

[0051] T GCCACCCCTGAGGAGGCGGGCGCCGCCGCTTCTCATTCATTGTCTTGACA AGAGCATC, the bold and underlined part is the predicted CpG sequence.

[0052] The primer sequences for QDZ amplification are as follows (the lowercase letters in the primer sequences are homologous sequences of the junction fragments):

[0053] pGL4.10-QDZ-F: 5'-ctaactggccggtacGGTAATTGGGTAACTGGGTTTTTTT-3', as shown in SEQ IDNO.5;

[0054] pGL4.10-QDZ-R: 5'-agcgagctcaggtacGATGCTCTTGTCAAGACAATGAATG-3', as shown in SEQ IDNO.6;

[0055] The primer sequences for QDZ-ΔCpG amplification are as follows (the lowercase letters in the primer sequences represent the homologous sequences of the junction fragments):

[0056] pGL4.10-QDZ-ΔCpG-F: Same as pGL4.10-QDZ-F

[0057] pGL4.10-QDZ-ΔCpG-R:

[0058] 5'-agcgagctcaggtacGATGCTCTTGTCAAGACAATGAATGAGAAGCGGCGG CGCCCGCCTCCTCAGGGGTGGCGCTGAGAATCTAATCTGCACTTTTT-3', as shown in SEQ ID NO.7.

[0059] (2) Enzymatic digestion of backbone vector

[0060] p3×Flag-CMV and pGL4.10 were digested with NotⅠ and KpnⅠ, respectively. The enzyme digestion reaction systems are shown in Table 2.

[0061] Table 2 Single enzyme digestion system

[0062]

[0063] Incubate overnight in a 37°C water bath. Perform nucleic acid electrophoresis on 1% agarose gel to identify and recover the digestion products, and use an ultra-micro nucleic acid analyzer to determine the concentration and purity of the recovered fragments.

[0064] (3) Connection

[0065] Table 3 Connection system

[0066]

[0067] (4) Conversion

[0068] The above ligation products were transformed into DH5α competent cells and plated. Single clones were picked after 12 hours. p3×Flag-CXXC1 was sequenced by Sanger sequencing using universal primers CMV-F (5'-CGCAAATGGGCGGTAGGCGTG-3', as shown in SEQ ID NO.8) and PFLAG-CMV-R (5'-GCACTGGAGTGGCAACTT-3', as shown in SEQ ID NO.9), and pGL4.10-QDZ was sequenced by universal primers RVP3 (5'-CTAGCAAAATAGGCTGTCCC-3', as shown in SEQ ID NO.10) and GLP4 (5'-GGGTAGAATGGCGCTGGG-3', as shown in SEQ ID NO.11). The colonies with correct sequencing results were expanded and cultured, and the endotoxin-free plasmid was extracted for subsequent cell transfection.

[0069] (5) Endotoxin-free plasmid extraction method (Omega Endotoxin-free Plasmid Extraction Kit)

[0070] Collect 10-15 mL of bacterial solution: centrifuge at 8000 × g for 10 min and discard the supernatant;

[0071] Resuspend the pellet: add 500 μL of Solution Ⅰ / RNase A mixture and gently pipette to suspend the bacteria;

[0072] Lyse bacteria: add 500 μL Solution II, gently invert 10 times, and let stand for 4 min;

[0073] Neutralization of alkali: add 250 μL N3 Buffer (pre-cooled on ice), invert 10 times until white flocculent precipitate appears, centrifuge at 13000 × g for 10 min, and take the supernatant into a new 1.5 mL centrifuge tube;

[0074] Add 0.1 times the volume of ETR Solution of the supernatant, gently invert 10 times, ice bath for 10 minutes, 42°C water bath for 5 minutes, centrifuge at 12000×g for 3 minutes, and aspirate the supernatant into a new 1.5mL centrifuge tube;

[0075] Add 0.5 times the volume of anhydrous ethanol, mix by inverting 6 to 7 times, let stand at room temperature for 1 to 2 minutes, and transfer the mixture to DNA adsorption column, centrifuged at 14000×g for 1 min (adsorption column was activated in advance: 100 μL 3 mol / L NaOH was added, allowed to stand for 1 min, centrifuged at 13000×g for 1 min, and the waste liquid was discarded);

[0076] To remove proteins: add 500 μL HBC Buffer, centrifuge at 14000 × g for 1 min, and discard the waste liquid;

[0077] Add 700 μL DNA Washing Buffer, centrifuge at 14000×g for 1 min, discard the liquid, and repeat once; centrifuge the empty column for 2 min, put the adsorption column in a 1.5 mL centrifuge tube, and put it in an oven for 5 min to evaporate the ethanol;

[0078] Elution of plasmid: vertically facing the center of the adsorption column, add 85μL of 65℃ preheated Elution Buffer, let stand for 1min, centrifuge at 14000×g for 1min, add the eluted liquid back to the adsorption column, centrifuge at 14000×g for 1min, the eluted liquid is the plasmid. Use an ultra-micro nucleic acid analyzer to measure the purity and concentration of the plasmid and store at -20℃.

[0079] 3. Cell culture

[0080] The cells used in this experiment are HEK293T cells and EBL cells, which are cultured in the same way, and the cell culture medium is DMEM (containing 10% fetal bovine serum). When thawing, take the cell cryopreservation tube out of the liquid nitrogen tank, place it in 37°C warm water, stir and thaw, transfer it to a 1.5mL centrifuge tube, and centrifuge it at 1050rpm for 5min. Discard the supernatant, add 1mL of cell culture medium to resuspend, inoculate it into a 60mm cell culture dish, and place it in a 37°C, 5% CO 2 Culture in an incubator. When the cell confluence rate is above 90%, subculture is performed. During subculture, discard the original culture medium in the culture dish, add 2 mL PBS to wash the cells, discard PBS, add 1 mL 0.25% trypsin, place in a 37°C incubator to digest for 1 min, gently blow off the adherent cells, add 1 mL of cell culture medium to stop digestion, and centrifuge at 1050 rpm for 5 min. Discard the supernatant, add 1 mL of cell culture medium to resuspend, inoculate HEK293T cells at a ratio of 1:3 and EBL cells at a ratio of 1:5 into a 60 mm cell culture dish, and place in a 37°C, 5% CO2 Culture in an incubator.

[0081] 4. Cell transfection

[0082] In this experiment, PEI transfection reagent was used to transfect HEK293T cells and EBL cells. HEK293T cells and EBL cells were inoculated into 24-well (500 μL culture medium) and 12-well (1 mL culture medium) cell culture plates one day in advance. When the cell confluence rate reached 60% to 70%, the culture medium was discarded and replaced with DMEM serum-free culture medium. The cells were placed in a cell culture incubator and cultured for 1 hour. The transfection system is shown in Table 4:

[0083] Table 4 Transfection system

[0084]

[0085] The above system was evenly added to the culture plate and placed in a cell culture incubator for culture. After 24 hours of transfection, serum-free DMEM was replaced with DMEM cell culture medium supplemented with 10% fetal bovine serum and continued to be cultured.

[0086] The siRNA used for CXXC1 interference was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequence is as follows:

[0087] siCXXC1-sense: 5′-GGUACAAGCUGGACGAGCUGUUUGA-3′, as shown in SEQ ID NO. 12;

[0088] siCXXC1-antisense: 5′-UCAAACAGCUCGUCCAGCUUGUACC-3′, as shown in SEQ ID NO.13.

[0089] The transfection dosage was 50 nM siRNA per well of 12-well plate cells, and the PEI dosage was 6 μL. The transfection method was the same as above.

[0090] 5. RNA extraction (TRIzol Reagent Kit)

[0091] 48 hours after cell transfection, discard the cell culture medium, wash the cultured cells with PBS solution, add 500μL Trizol lysis solution to 12 wells, lyse for 5min, transfer the lysate to a 1.5mL centrifuge tube; add 100μL chloroform, shake vigorously for 30s, centrifuge at 12000×g for 15min, and aspirate the supernatant to a new centrifuge tube; add an equal volume of isopropanol, mix by inversion, incubate at room temperature for 10min, and centrifuge at 12000×g for 10min; discard the supernatant, add 500μL 75% ethanol prepared with DEPC water, invert until the precipitate floats, centrifuge at 7500×g for 5min, discard the supernatant, wait for the ethanol to evaporate, and add 20μL DEPC water to dissolve the precipitate. Determine its concentration.

[0092] 6. qRT-PCR detection of gene transcription levels

[0093] Reverse transcription to synthesize cDNA: Add 4 μL of 4×g DNA wiper Mix, 1 μg of template RNA, and RNase-free ddH into an RNase-free centrifuge tube. 2 Add 16 μL of O, mark it after adding, centrifuge it instantly, and place it at 42°C for 2 min. Add 4 μL of 5×HiscriptⅢqRT SuperMix, centrifuge it instantly, and react at 50°C for 15 min and 85°C for 5 s in a PCR instrument. The sample is stored at -20°C.

[0094] 7. qRT-PCR detection of gene transcription levels

[0095] Table 5 qRT-PCR sample loading system

[0096]

[0097] Place the eight-tube concatenation with samples added into the fluorescence quantitative PCR instrument. The reaction program is shown in Table 6.

[0098] Table 6 qRT-PCR reaction procedure

[0099]

[0100] Use 2 -ΔΔCt Method analysis results, primer sequences are as follows:

[0101] coro1a-F: 5′-CCCCTCCTCATCTCCCTCAA-3′, as shown in SEQ ID NO.14;

[0102] coro1a-R: 5′-GGACTGTCTCCTCCAGCCTA-3′, as shown in SEQ ID NO.15;

[0103] gapdh-F: 5′-GAGCGAGATCCTGCCAACAT-3′, as shown in SEQ ID NO. 16;

[0104] gapdh-R: 5′-GGTTCACGCCCATCACAAAC-3′, as shown in SEQ ID NO.17.

[0105] 8. Dual luciferase reporter assay

[0106] 48 hours after cell transfection, discard the cell culture medium, wash twice with PBS solution, add 100 μL 1× Cell Lysis Buffer to each well, shake on a shaker for 30 min to fully lyse; transfer the lysate to a 1.5 mL centrifuge tube, centrifuge at 12000×g at 4°C for 10 min, and take the supernatant for detection; add 20 μL sample lysate to an opaque 96-well plate, add 100 μL Luciferase Reaction Reagent equilibrated to room temperature to each sample, shake horizontally to mix, and detect the activity of the firefly luciferase reporter gene in a chemiluminescence instrument; add 100 μL Luciferase Reaction ReagentⅡ, shake horizontally to mix, and detect the activity of the Renilla luciferase reporter gene in a chemiluminescence instrument.

[0107] 9. Mycobacterium tuberculosis infection and CFU detection

[0108] 3×10 5 The cells were infected with H37Ra at a multiplicity of infection (MOI) of 30 for 4 h and then washed three times with PBS to remove extracellular bacteria. The infected cells were cultured for the specified time and lysed with PBS containing 0.1% TritonX-100 for 5 minutes at room temperature. The lysate was centrifuged at 4500×g for 5 min and then resuspended and diluted several times with PBS. The bacterial suspension (triplicate) was spread on Middlebrook 7H10 agar plates, incubated at 37°C for 2 to 3 weeks, and then the colonies were counted.

[0109] result

[0110] To detect the effect of CXXC1 on the transcription level of coro1a gene, p3×Flag-CXXC1 was transfected into EBL cells, and cellular RNA was extracted 48 hours later and reverse transcribed into cDNA. qPCR was performed using cDNA as a template to detect the transcription level of coro1a. Figure 1 It can be seen that the Coronin-1A gene level in EBL cells transfected with p3×Flag-CXXC1 was significantly upregulated compared with the control group.

[0111] To further verify the results, interfering RNA of CXXC1 was transfected into EBL cells to reduce the expression of CXXC1, and the transcription level of coro1a was detected after 48 h. Figure 2 It can be seen that the transcription of coro1a gene was also significantly inhibited after interfering with CXXC1.

[0112] The dual luciferase reporter system was used to detect the binding activity of CXXC1 to the coro1a gene promoter. Figure 3 It can be seen that compared with the control group, the binding activity of CXXC1 to the coro1a gene promoter was significantly increased.

[0113] Further, analysis of the CXXC1 domain and reference to literature showed that the CpG bind domain of CXXC1 can specifically bind to unmethylated CpG motifs to regulate gene expression ( Figure 4 ).

[0114] Sequence analysis of the 2000 bp coro1a promoter showed that ( Figure 5 ), -213 to -58 bp is the predicted CpG sequence, so the vector pGL4.10-QDZΔCpG ( Figure 6 ).

[0115] The dual luciferase reporter system was used to detect the binding activity of CXXC1 to the coro1a gene promoter lacking CpG. Figure 7 As shown, after the CpG sequence was deleted, the binding activity of CXXC1 to the coro1a gene promoter was significantly reduced, indicating that CXXC1 mainly regulates the transcription of the coro1a gene by binding to the CpG sequence in the coro1a gene promoter region.

[0116] EBL cells interfered with CXXC1 were infected with Mycobacterium tuberculosis for different time periods, and the effect of CXXC1 on the intracellular survival of Mycobacterium tuberculosis was detected using CFU. The results showed that ( Figure 8 )Interference with CXXC1 inhibits the survival of Mycobacterium tuberculosis.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. Use of an inhibitor of bovine CXXC1 protein expression in the preparation of a product for inhibiting Mycobacterium tuberculosis, characterized in that: The expression inhibitor of the bovine CXXC1 protein is an interfering RNA of the bovine CXXC1 protein, and the sequence of the interfering RNA is: siCXXC1-sense: 5'-GGUACAAGCUGGACGAGCUGUUUGA-3', siCXXC1-antisense:5'-UCAAACAGCUCGUCCAGCUUGUACC-3'; The product is a medicine or a feed additive.

2. The use according to claim 1, characterized in that The expression inhibitor of bovine CXXC1 protein is used for preparing products for resisting infection by Mycobacterium tuberculosis.

3. A drug for inhibiting Mycobacterium tuberculosis, characterized in that: The drug has the bovine CXXC1 protein expression inhibitor according to claim 1 as the only effective active ingredient, and the bovine CXXC1 protein expression inhibitor is an interfering RNA of the bovine CXXC1 protein, and the sequence of the interfering RNA is: siCXXC1-sense: 5'-GGUACAAGCUGGACGAGCUGUUUGA-3', siCXXC1-antisense:5'-UCAAACAGCUCGUCCAGCUUGUACC-3'.

4. The drug according to claim 3, characterized in that The drug includes pharmaceutically acceptable excipients.

5. A feed additive for inhibiting Mycobacterium tuberculosis, characterized in that: The feed additive uses the bovine CXXC1 protein expression inhibitor of claim 1 as the only active ingredient for inhibiting Mycobacterium tuberculosis, and the bovine CXXC1 protein expression inhibitor is an interfering RNA of the bovine CXXC1 protein, and the sequence of the interfering RNA is: siCXXC1-sense: 5'-GGUACAAGCUGGACGAGCUGUUUGA-3', siCXXC1-antisense:5'-UCAAACAGCUCGUCCAGCUUGUACC-3'.

6. The feed additive according to claim 5, characterized in that The feed additive includes veterinary acceptable adjuvants.

Images