Nanomedicine for treating t-all by delivering sgc8 binding aptamer-sibcl11b and preparation method and application thereof

Abstract

The application discloses a kind of nano-drugs for treating T-ALL by combining aptamer sgc8 delivery siBCL11B and preparation method and application.The application takes acute T-cell lymphoblastic leukemia cell Molt4, CCRF-CEM as research object, and the nano-drugs are delivered by in-vitro drug addition experiment etc., and the viability and apoptosis of cell are determined.The results show that the nano-drugs can effectively and stably transfect and deliver siBCL11B into T-ALL tumor cell strain and successfully release siBCL11B, knock down the expression of BCL11B in T-ALL cell strain, thereby promoting the apoptosis of tumor cell strain and inhibiting the viability of tumor cell strain.Based on the results, the nano-drugs can be used for delivering siBCL11B and thereby used for the clinical treatment of acute T-cell lymphoblastic leukemia.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to a nanomedicine for treating T-ALL by delivering siBCL11B in combination with an aptamer sgc8, as well as a preparation method and application thereof. Background Art

[0002] In the treatment of hematological malignancies, chemotherapy-induced remission has always been the main treatment method. Anti-hematological malignant tumor chemotherapy drugs usually have the effect of inhibiting DNA synthesis or damaging DNA structure. When the damage exceeds the tumor cells' ability to repair themselves, it can activate programmed cell death, thereby inducing remission. However, chemotherapy drugs also have toxic side effects on normal cells. Patients often cannot withstand the double blow of tumors and chemotherapy and have a poor prognosis. 1,2 . Moreover, it has been found in clinical treatment that under the selective pressure of chemotherapy drugs, potential drug-resistant cells gradually replace sensitive cells to become the dominant clones. Relapse after chemotherapy remission often indicates the failure of the original chemotherapy regimen and poor prognosis. Although multi-drug combination chemotherapy can increase the proportion of induced remission and reduce drug-resistant cells caused by single pharmacological mechanisms, there are still patients who fail to respond to chemotherapy. Therefore, in recent years, scientific research on hematological malignancies has been looking for molecular targets that are specifically and highly expressed in tumor cells to combat and treat hematological malignancies, and as an alternative after the failure of first-line chemotherapy. 3 With the rapid development of genomics, research on targets for hematological malignancies has become increasingly precise at the genetic level. Research on targeted therapies for hematological malignancies has also gradually achieved clinical efficacy, such as the CD20-targeting therapy with rituximab for lymphoma. The development of drugs targeting novel targets may represent a new approach for treating patients with hematological malignancies who have failed chemotherapy-induced remission.

[0003] Acute T-cell lymphoblastic leukemia (T-ALL) is an aggressive, heterogeneous blood malignancy that arises from the developmental arrest, differentiation blockage, and uncontrolled proliferation of T-cell precursors at a specific maturation stage. It accounts for 25% of acute lymphoblastic leukemia in adults and 15% in children. 4 The clonal primitive cells in the bone marrow of T-ALL continue to proliferate and squeeze the normal hematopoietic environment, causing a decrease in normal hematopoiesis of the three lineages, including erythropenia, thrombocytopenia and granulocytopenia. T-ALL tumor cells also often accumulate in different extramedullary organs such as the liver, spleen and lymph nodes, especially those that infiltrate the central nervous system, with a very poor prognosis. T-ALL is associated with the loss of many tumor suppressor pathways, such as the inactivation of PTEN and CDKN2A / B, and the activation of tumor-promoting pathways, such as the activation of NOTCH1 and IL7R / JAK / STAT. 5Although most patients with T-ALL can achieve remission after chemotherapy induction, they are expected to be cured after receiving allogeneic stem cell transplantation, but still about 20-30% of patients relapse after remission. The prognosis of patients after relapse is very poor and there is currently no effective targeted treatment for T-ALL 6 Therefore, it is still urgent to find new specific targets, discover more potential drugs and regimens, and improve the survival rate and cure rate of such patients.

[0004] BCL11B (B-cell chronic lymphocytic leukemia / lymphoma 11B, B-cell chronic lymphocytic leukemia / lymphoma 11B) is a gene located at 14q32.2, encoding a C2H2 zinc finger protein transcription factor, belonging to the BCL family with BCL11A, and is an important factor for regulating lymphocyte proliferation and survival, expressed in the nervous system, thymus and lymphocytes, and highly expressed in some T-ALL patients 7 The BCL11B gene has 4 exons, and 4 transcripts have been identified, of which exon 3 is involved in encoding transcripts 1 and 3 but not transcripts 2 and 4 8 Previous studies have shown that BCL11B plays a very important role in the normal differentiation and development of T cells, and is a key gene for T cell directional differentiation. BCL11B is first expressed at DN2 7 BCL11B is believed to promote the expression of T cell lineage genes and turn off the expression of myeloid and NK lineage genes, promoting T cell directional differentiation. NOTCH1 signaling is also essential for the normal differentiation and development of T cells, and BCL11B has been reported to be downstream of NOTCH1 regulation and involved in the differentiation and development of T cells. In a significant portion of patients with T cell-derived leukemia such as T-ALL and TCL, BCL11B expression is higher than that in normal T cells, but the BCL11B expression in tumor cells of some T cell-derived leukemia patients is not significantly increased. Meanwhile, in AML and other non-T cell-derived leukemia, there are 15% of cases with increased BCL11B expression, which are defined as BCL11B-activated leukemia with specific gene expression characteristics 9,10 Studies have shown that BCL11B gene mutations exist in these patients, and the fusion of BCL11B coding with other strong promoters of oncogenes leads to increased expression of BCL11B, further amplifying the downstream pathway of BCL11B. Studies have reported that the downstream of BCL11B promotes the expression of anti-apoptotic genes such as BCLxL and inhibits the expression of apoptotic genes such as TRAIL. At the same time, BCL11B has also been reported to interact with NuRD, a histone modification complex, and is involved in epigenetic regulation such as histone deacetylation11 It has been reported that the effects of BCL11B long transcripts and short transcripts in T-ALL tumor cell lines are different, and their expression patterns are also different from those of normal T cells, which may play a role in the occurrence and development of tumors. These studies all indicate that BCL11B may play an important key role in the occurrence and development of T-ALL. 12 Furthermore, BCL11B may not simply manifest itself in changes in gene expression levels; it may also involve changes in transcript splicing, which can affect BCL11B's function. BCL11B relies on its transcription factors to regulate gene expression levels and interacts with NuRD to exert epigenetic regulation. Whether BCL11B is normally expressed in T-ALL also affects the progression of T-ALL.

[0005] RNA interference technology (RNA interfering, RNAi) is a method of silencing gene expression by inducing mRNA degradation after a specific sequence of single-stranded RNA binds to a homologous sequence on mRNA. Scientific research has discovered this phenomenon in mammalian cells and silenced the expression of specific genes by artificially synthesizing small interfering RNA (siRNA) and transfecting it into cells. It has the characteristics of high efficiency and good targeting. The research group of Professor Li Peng from the Institute of Hematology of Jinan University and the Guangzhou Institute of Health of the Chinese Academy of Sciences and Professor Grzegorz K Przybylski from Poland have previously confirmed that electroporation of siBCL11B in T-ALL tumor cell lines can promote tumor cell apoptosis and inhibit tumor cell proliferation, and has little effect on normal human T cells. 13-15 Therefore, targeting BCL11B for the treatment of T-ALL may be a potential alternative after clinical induction chemotherapy fails. However, due to the widespread presence of nucleases in the circulating blood and liver, simple intravenous injection of small molecule nucleic acids is ineffective, while electroporation does not have clinical therapeutic significance. Liposome transfection is far less effective for the treatment of hematological tumors than for solid tumors. Therefore, the progress and effectiveness of mature RNAi in the treatment of hematological tumors are currently limited.

[0006] Among the polymer materials for delivering small molecule nucleic acids, PAMAM (Polyamindoamine) is a polyamide-amine dendrimer. The presence of a large number of -NH2 groups in its molecules can spontaneously bind to the P atoms in the nucleic acid molecules through electrostatic adsorption, while also blocking the epitopes that nucleases degrade nucleic acids, thereby stabilizing the presence of nucleic acids in the peripheral blood environment. 16In existing reports, PAMAM has been used to deliver a variety of small molecule nucleic acids and has a certain effect. It is an ideal material for delivering nucleic acid molecules into cells. However, PAMAM does not have target selectivity for different cells, so it has limitations in application. 17,18 PAMAM-G5 refers to a PAMAM with 5 branches. Aptamer is a type of single-stranded nucleic acid molecule that can spontaneously form a secondary structure. Its secondary structure can bind to other molecules such as protein molecules, similar to the specificity of antigen-antibody binding. 19,20 . Nucleic acid molecules have a lower risk of immune response when used in vivo because their immunogenicity is lower than that of protein molecules. Sgc8 is a single-stranded DNA nucleic acid aptamer screened and identified by Professor Tan Weihong of Hunan University. Its specific secondary structure can specifically bind to the cell membrane protein PTK7 (protein tyrosine kinase 7), and PTK7 is highly expressed on T cells and T-ALL tumor cell lines. It mediates sgc8 to enter the cell after binding to PTK7 through endocytosis. Among the reported application cases of PAMAM and aptamers, more designs are designed for the detection of tumor cells. When applied to tumor treatment, PAMAM is more often chemically combined with chemotherapy drugs such as daunorubicin, rituximab, cytarabine and other drugs, assisted by protein molecules such as FLT3L and anti-CD20 antibodies or nucleic acid molecules such as TD05 and sgc8 to improve the specificity of the complex. However, reports on the use of PAMAM combined with sgc8 to enhance nanoparticle specificity and deliver siRNA for tumor treatment in hematological malignancies, particularly T-ALL, are currently limited. In vivo experiments that mimic the natural course of hematological malignancies lack sufficient valid evidence and trial efforts. Therefore, building on our previous work discovering BCL11B as a potential target for T-ALL, we sought to utilize sgc8 to enhance the specificity of nanomedicines. We designed the siBCL11B-delivering nanoparticles described in this patent, which incorporate sgc8. We also tested the anti-tumor effects of the nanomedicines designed in this patent in an in vivo experiment that more closely resembles clinical T-ALL conditions, mimicking the administration of clinical chemotherapy. This provides a higher level of evidence for the clinical application of the nanomedicines designed in this patent.

[0007] References:

[0008] 1 Cao,S.C.et al.Effect of chemotherapy(with and without radiotherapy)on the intelligence of children and adolescents treated for acutelymphoblastic leukemia;a meta-analysis.Psychooncology32,492-505,doi:10.1002 / pon.6103(2023).

[0009] 2 Sliwa-Tytko,P.,Kaczmarska,A.,Lejman,M.&Zawitkowska,J.NeurotoxicityAssociated with Treatment of Acute Lymphoblastic Leukemia Chemotherapy andImmunotherapy.Int J Mol Sci23,doi:10.3390 / ijms23105515(2022).

[0010] 3 Zeng,X.L.,Heneghan,M.B.&Badawy,S.M.Adherence to Oral Chemotherapyin Acute Lymphoblastic Leukemia during Maintenance Therapy in Children,Adolescents,and Young Adults:A Systematic Review.Curr Oncol30,720-748,doi:10.3390 / curroncol30010056(2023).

[0011] 4 Thomas,X.T-cell acute lymphoblastic leukemia:promising experimentaldrugs in clinical development.Expert Opin Investig Drugs32,37-52,doi:10.1080 / 13543784.2023.2161361(2023).

[0012] 5 Martelli,A.M.et al.Understanding the Roles of the HedgehogSignaling Pathway during T-Cell Lymphopoiesis and in T-Cell AcuteLymphoblastic Leukemia(T-ALL).Int J Mol Sci24,doi:10.3390 / ijms24032962(2023).

[0013] 6 Caracciolo,D.et al.The emerging scenario of immunotherapy for T-cell Acute Lymphoblastic Leukemia:advances,challenges and futureperspectives.Exp Hematol Oncol12,5,doi:10.1186 / s40164-022-00368-w(2023).

[0014] 7 Chen,S.et al.The role of BCL11B in regulating the proliferation ofhuman naive T cells.Hum Immunol73,456-464,doi:10.1016 / j.humimm.2012.02.018(2012).

[0015] 8 Grabarczyk,P.et al.The N-Terminal CCHC Zinc Finger Motif MediatesHomodimerization of Transcription Factor BCL11B.Mol Cell Biol38,doi:10.1128 / MCB.00368-17(2018).

[0016] 9 Kominami,R.Role of the transcription factor Bcl11b in developmentand lymphomagenesis.Proc Jpn Acad Ser B Phys Biol Sci88,72-87,doi:10.2183 / pjab.88.72(2012).

[0017] 10 Li,X.H.X.D.Y.The role of BCL11B in hematologicalmalignancy.Experimental Hematology&Oncology (2012).

[0018] 11 Sidwell,T.&Rothenberg,E.V.Epigenetic Dynamics in the Function ofT-Lineage Regulatory Factor Bcl11b.Front Immunol12,669498,doi:10.3389 / fimmu.2021.669498(2021).

[0019] 12 Montefiori,L.E.&Mullighan,C.G.Redefining the biological basis oflineage-ambiguous leukemia through genomics:BCL11B deregulation in acuteleukemias of ambiguous lineage.Best Pract Res Clin Haematol34,101329,doi:10.1016 / j.beha.2021.101329(2021).

[0020] 13 Huang,X.et al.Down regulation of BCL11B expression inhibitsproliferation and induces apoptosis in malignant T cells by BCL11B-935-siRNA.Hematology16,236-242,doi:10.1179 / 102453311X13025568941961(2011).

[0021] 14 Shen,Q.et al.BCL11B suppression does not influence CD34(+)celldifferentiation and proliferation.Hematology17,329-333,doi:10.1179 / 1024533212Z.000000000145(2012).

[0022] 15 Li,K.et al.Inhibition of BCL11B induces downregulation of PTK7 andresults in growth retardation and apoptosis in T-cell acute lymphoblasticleukemia.Biomark Res9,17,doi:10.1186 / s40364-021-00270-3(2021).

[0023] 16 Arkas,M.,Vardavoulias,M.,Kythreoti,G.&Giannakoudakis,D.A.DendriticPolymers in Tissue Engineering:Contributions of PAMAM,PPI PEG and PEI toInjury Restoration and Bioactive Scaffold Evolution.Pharmaceutics15,doi:10.3390 / pharmaceutics15020524(2023).

[0024] 17 Kheraldine,H.et al.Emerging innate biological properties of nano-drug delivery systems:A focus on PAMAM dendrimers and their clinicalpotential.Adv Drug Deliv Rev178,113908,doi:10.1016 / j.addr.2021.113908(2021).

[0025] 18 Li,J.,Liang,H.,Liu,J.&Wang,Z.Poly(amidoamine)(PAMAM)dendrimermediated delivery of drug and pDNA / siRNA for cancer therapy.Int J Pharm546,215-225,doi:10.1016 / j.ijpharm.2018.05.045(2018).

[0026] 19 Tarach, P. & Janaszewska, A. Recent Advances in Preclinical Research Using PAMAM Dendrimers for Cancer Gene Therapy. Int J Mol Sci22, doi:10.3390 / ijms22062912(2021).

[0027] 20 Wong, KH, Guo, Z., Law, MK & Chen, M. Functionalized PAMAM constructed nanosystems for biomacromolecule delivery. Biomater Sci11, 1589-1606, doi:10.1039 / d2bm01677j(2023). Summary of the Invention

[0028] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a nanoparticle composite.

[0029] Another object of the present invention is to provide a method for preparing the above-mentioned nanoparticle composite.

[0030] Another object of the present invention is to provide use of the above-mentioned nanoparticle complex in the preparation of a drug for treating acute T lymphocytic leukemia.

[0031] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0032] A nanoparticle complex is prepared by combining a polyamide-amine dendrimer with nucleic acid, wherein the nucleic acid is an aptamer sgc8 and siBCL11B; the siBCL11B refers to siRNA that targets and inhibits the BCL11B gene.

[0033] Furthermore, the polyamidoamine dendrimer is selected from PAMAM-G5.

[0034] Furthermore, the sequence of the aptamer sgc8 is 5'-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3'.

[0035] Furthermore, the sequence of the siBCL11B is 5'-GCACAACAUGCAAGCAGCCCUUCAA-3'.

[0036] Furthermore, the molar ratio of the polyamidoamine dendrimer to the nucleic acid is 2 to 4:1, preferably 3:1.

[0037] Furthermore, the molar ratio of the aptamer sgc8 to siBCL11B is 3 to 5:1, preferably 4:1.

[0038] The method for preparing the nanoparticle complex is to fully mix the polyamidoamine dendrimer solution, the aptamer sgc8 solution and the siBCL11B solution, centrifuge them instantaneously and incubate them at room temperature to form a stable nanoparticle structure.

[0039] Furthermore, the incubation time is 5±1 min.

[0040] The room temperature in the present invention refers to 15-30°C.

[0041] Application of the nanoparticle complex in the preparation of a drug for treating acute T lymphocytic leukemia.

[0042] The present invention combines the characteristics of high expression of BCL11B in T-ALL cells with the structural and functional characteristics of siRNA, PAMAM, and sgc8 to construct a novel nanoparticle structure of spontaneously formed PAMAM+siBCL11B+sgc8 for the treatment of T-ALL. Sgc8 is used to increase the targeting of the nanoparticles, PAMAM is used to protect and deliver siBCL11B, and siBCL11B is used to promote the apoptosis of T-ALL tumor cells, providing a new approach for the clinical treatment of T-AZLL.

[0043] The present invention has the following advantages and effects compared to the prior art:

[0044] (1) Both siRNA and aptamers are nucleic acid molecules with low immunogenicity, high safety for in vivo application, and low adverse reactions. The preparation of nanoparticle drugs is simple and efficient. sgc8 targeting T-ALL tumor cells can improve the anti-tumor efficiency of the drug, reduce the drug dosage, and give full play to the clear and effective effect of siBCL1B in promoting T-ALL tumor apoptosis.

[0045] (2) The present application takes acute T-cell lymphoblastic leukemia cells Molt4 and CCRF-CEM as research objects, and gives different siBCL11B delivery combinations through in vitro drug addition and other experimental operations, and determines the viability and apoptosis of cells. The results show that PAMAM can effectively and stably transfect and deliver siBCL11B into T-ALL tumor cell lines and successfully release siBCL11B, knock down the expression of BCL11B in T-ALL cell lines, thereby promoting the apoptosis of tumor cell lines and inhibiting the viability of tumor cell lines. Based on the results, the new nucleic acid delivery structure can be used for delivering siBCL11B for the clinical treatment of acute T-cell lymphoblastic leukemia. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 A schematic diagram of the nanoparticle composite construction of the present application.

[0047] Figure 2 A verification diagram of the optimal ratio of PAMAM-G5 to siBCL11B and sgc8.

[0048] Figure 3 A confocal microscope verification diagram of the cell sublocalization of the nanoparticle composite for delivering nucleic acids.

[0049] Figure 4 A RT-PCR verification diagram of the change of BCL11B mRNA level in Molt4 cells and CCRF-CEM cells transfected with the nanoparticle composite for 48h.

[0050] Figure 5 A Western blot verification diagram of the change of BCL11B protein level in Molt4 cells and CCRF-CEM cells transfected with the nanoparticle composite for 48h.

[0051] Figure 6 A flow cytometry detection diagram of the change of the apoptosis proportion of Molt4 cells transfected with the nanoparticle composite for 48h.

[0052] Figure 7 A CCK-8 detection diagram of the change of cell proliferation activity of Molt4 cells transfected with the nanoparticle composite for 48h.

[0053] Figure 8 A flow cytometry detection diagram of the change of the apoptosis proportion of CCRF-CEM cells transfected with the nanoparticle composite for 48h.

[0054] Figure 9 A CCK-8 detection diagram of the change of cell proliferation activity of CCRF-CEM cells transfected with the nanoparticle composite for 48h.

[0055] Figure 10This is a graph showing the results of a study using flow cytometry to detect the expression ratio of human CD45 in bone marrow cells of each group.

[0056] Figure 11 This figure shows the results of a study using flow cytometry to detect the effect of nanoparticle complex transfection on normal T cell apoptosis 48 hours later. DETAILED DESCRIPTION

[0057] The present invention will be described in further detail below with reference to examples and drawings, but the embodiments of the present invention are not limited thereto.

[0058] Example 1

[0059] 1. Experimental Materials and Methods

[0060] (1) Experimental materials

[0061] (1) Molt4 and CCRF-CEM cell lines were purchased from the American Type Culture Collection (ATCC).

[0062] (2) siBCL11B and cy5-modified siBCL11B (hereinafter referred to as siBCL11B-cy5, the sequence of siBCL11B is: GCACAACAUGCAAGCAGCCCUUCAA) were synthesized as dry powder by Guangzhou Ruibo Company, dissolved in DEPC water and prepared into 100 μmol / L stock solution, and then aliquoted and stored at -80°C. sgc8 and FAM-modified sgc8 (hereinafter referred to as sgc8-FAM, the sequence of sgc8 is 5'-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3') were synthesized as dry powder by Guangzhou Ruibo Xingke Company, dissolved in DEPC water and prepared into 100 μmol / L stock solution, and then aliquoted and stored at -80°C. PAMAM-G5 was purchased from Shandong Weihai Chenyuan Molecular New Materials Co., Ltd., dissolved in DMSO and prepared into 100 μM stock solution, and then stored at 4°C.

[0063] (2) Experimental methods

[0064] (1) Cell culture

[0065] ① Molt4 cells: The complete culture medium is 90% RPMI-1640 medium containing 10% Gibco fetal bovine serum, penicillin (100 U / mL) and streptomycin (100 mg / mL); culture in a 5% CO2, 37°C incubator. The cells are suspension cells and the density is maintained at 1-2 × 10 6 / mL to ensure that the cells are in the logarithmic growth phase, and the cells are passaged every 2-3 days on average.

[0066] ②CCRF-CEM cells: The complete culture medium is 90% RPMI-1640 medium containing 10% Gibco fetal bovine serum, penicillin (100 U / mL) and streptomycin (100 mg / mL); culture in a 5% CO2, 37°C incubator. The cells are suspension cells and the density is maintained at 1-2 × 10 6 / mL to ensure that the cells are in the logarithmic growth phase, and the cells are passaged every 2-3 days on average.

[0067] (2) Construction of nanoparticle complexes

[0068] Use high-pressure sterilized 1×PBS to filter through a 0.22 μm filter and thaw siBCL11B and sgc8 and place them on ice.

[0069] ① Determine the optimal nitrogen-phosphorus ratio (NP ratio) of PAMAM-G5 and nucleic acids

[0070] Take 100 μmol / L PAMAM-G5 and siBCL11B stock solutions, dilute them to 100 nmol / L respectively, extract 1 μL 100 nmol / L siBCL11B as 1 unit, extract 0.5 μL, 1 μL, 2 μL, and 3 μL of 100 nmol / L PAMAM-G5 respectively, mix them into separate 0.2 mL sterile enzyme-free EP tubes, use 1× PBS to make up the volume of each group to 20 μL, mix the reagents in each tube thoroughly to prepare a gradient concentration mixture, incubate at room temperature for 5 minutes, and then add 3 μL 6× loading The buffer was mixed again, and 10 μL was extracted and added to a 1% agarose gel loading well. Samples from control wells containing PAMAM-G5 and siBCL11B alone were also added. Electrophoresis was performed in 1×TAE electrophoresis buffer at a constant voltage of 80 V for 30 min. The agarose gel was removed and exposed to UV light for imaging to observe the packaging efficiency of PAMAM-G5 and siBCL11B at different ratios. In the present invention, the optimal ratio was a PAMAM:nucleic acid molar ratio of 3:1 (i.e., a nitrogen-phosphorus ratio of 30:1).

[0071] ② Construction of nanoparticle complexes for cell experiments after preparation according to the optimal NP ratio

[0072] Thaw 100 μmol / L PAMAM-G5, 100 μmol / L siBCL11B, and 100 μmol / L sgc8 and store at 4°C for later use.

[0073] The experiment set up a blank control group Contrl (CTR), PAMAM-G5 alone group (PAMAM), PAMAM-G5 packaged sgc8 group (PAMAM+sgc8), PAMAM-G5 packaged siBCL11B group (PAMAM+siBCL11B), and PAMAM-G5 packaged siBCL11B and sgc8 group (PAMAM+siBCL11B+sgc8). The five groups of reagents were prepared in sterile enzyme-free 1.5 mL EP tubes. 0 μL, 15 μL, 15 μL, 15 μL, 15 μL of 100 μmol / L PAMA-G5, 0 μL, 0 μL, 5 μL, 0 μL, 1 μL of 100 μmol / L sgc8, 0 μL, 0 μL, 5 μL, 1 μL of 100 μmol / L siBCL11B, 0 μL, 0 μL, 0 μL, 5 μL, 4 μL of 1 × PBS were added to the volume of 50 μL. After thorough mixing, the tubes were centrifuged instantly and incubated at room temperature for 5 min to form a stable nanoparticle structure. Finally, the tubes were added to a 50×10 4 Molt4 or CCRF-CEM cells were incubated in 1 mL of culture medium at 37°C for 48 hours, and then the cells were harvested for subsequent experimental testing. In this system, the final concentrations of PAMAM-G5 were 0 μmol / L, 1.5 μmol / L, 1.5 μmol / L, 1.5 μmol / L, and 1.5 μmol / L, the final concentrations of sgc8 were 0 μmol / L, 0 μmol / L, 0.5 μmol / L, 0 μmol / L, and 0.1 μmol / L, and the final concentrations of siBCL11B were 0 μmol / L, 0 μmol / L, 0 μmol / L, 0.5 μmol / L, and 0.4 μmol / L.

[0074] (3) Detection of the effect of nanoparticle nucleic acid delivery (in this part of the experiment, siBCL11B was modified with Cy5 and sgc8 was modified with FAM)

[0075] Twenty hours after incubation with the nanoparticle complexes, Molt4 / CCRF-CEM cells were cultured with Hoechst 33258 (1:10,000) and incubated overnight. At 24 hours, cells were harvested into a 1.5 mL centrifuge tube, centrifuged at 350 rcf for 5 minutes at room temperature, resuspended in 1 mL of 1× PBS, and centrifuged at 350 rcf for 5 minutes at room temperature. The cells were washed three times with 1× PBS and resuspended in 100 μL of 1× PBS. The cells were then placed onto a microplate spinner and centrifuged at 200 rcf for 10 minutes at room temperature to obtain a cell slide. The remaining liquid on the slide was gently blotted with filter paper, and 100 μL of immunofluorescence fixative was added to each slide. The slides were incubated at 4°C in the dark for 12 hours. After the slides were aspirated, the liquid was removed with a pipette tip, and the slides were gently rinsed with 1 mL of 1× PBS and blotted with filter paper. This was repeated three times. After absorbing the residual liquid, 100 μL of immunofluorescence preservation solution was added to each slide, and the slides were sealed with a cover slip. After being fixed with a clamp for half an hour, cell fluorescence images were detected and taken under a confocal microscope at 555 nm, 488 nm and DAPI channels.

[0076] (4) siBCL11B delivery effect detection

[0077] ①RT-PCR detection of BCL11B expression changes at the transcriptional level

[0078] Harvest cells for RNA extraction: 48 hours after incubation with the nanoparticle complex, culture medium containing Molt4 / CCRF-CEM cells was added to the culture medium. The cells were harvested into a 1.5 mL centrifuge tube and centrifuged at 350 rcf for 5 minutes at room temperature. The cells were resuspended in 1 mL of 1× PBS and centrifuged at 350 rcf for 5 minutes at room temperature. After washing twice with 1× PBS, the supernatant was removed and 1 mL of Trizol reagent was added. The cells were vortexed thoroughly to lyse the cells. 200 μL of chloroform was added to the cell lysate, and the mixture was inverted several times to mix thoroughly. The cells were then allowed to stand at room temperature for separation. Centrifuge at 13400 rcf for 30 minutes at 4°C. Transfer 500 μL of the upper aqueous phase to a new 1.5 EP tube, add 500 μL of isopropanol, mix thoroughly, and store at -20°C overnight. After overnight, centrifuge the sample at 4°C, 12,000 rcf for 10 minutes, remove the supernatant, add 1 mL of absolute ethanol to resuspend the pellet, and centrifuge at 4°C, 12,000 rcf for 10 minutes. Remove the supernatant and repeat the ethanol wash once. Place the RNA pellet on ice to dry briefly, then resuspend and dissolve in 50 μL of DEPC water to obtain an RNA solution. Store at -20°C until needed.

[0079] Reverse transcription was performed to obtain cDNA, and RT-PCR was used to detect changes in BCL11B expression: 1 μg of total RNA was reverse transcribed into 20 μL of cDNA using a TAKARA reverse transcription kit, which was diluted with 20 μL of DEPC water and used as a template for RT-PCR. A Tiangen quantitative kit was used on a bio-rad fluorescent PCR instrument with GAPDH as the internal reference gene to detect and read the expression cycle values ​​of BCL11B between groups. Three replicate wells were set up for each group to observe the changes.

[0080] ② Western blot detection of BCL11B protein expression changes

[0081] Collect cells to obtain protein samples: Add the nanoparticle complex to the Molt4 / CCRF-CEM cell culture medium after incubation for 48 hours, collect the cells into a 1.5 mL centrifuge tube, centrifuge at 350 rcf for 5 minutes at room temperature, resuspend with 1 mL of 1×PBS, and centrifuge at 350 rcf for 5 minutes at room temperature. Repeat the washing with 1×PBS for a total of 2 times, remove the supernatant and add 100 μL of Biyuntian 1×SDS loading buffer. After fully lysing the sample, centrifuge the sample and place it on a metal heating shaker at 100°C to denature the protein sample for 10 minutes. After cooling, aliquot and store at 80°C for later use.

[0082] Western blot analysis of BCL11B expression in protein samples: Sample loading was adjusted using GAPDH as an internal control protein. Protein samples were subjected to vertical electrophoresis on a 10% SDS-PAGE gel at 90V for 120 minutes. After electrophoresis, the excess area of ​​the SDS-PAGE gel was cut off and the proteins were transferred to a Millipore 0.45μm PVDF membrane using Beyotime semi-dry transfer buffer at 20V for 30 minutes. The PVDF membrane was blocked in 5% BSA blocking buffer at 4°C for 4 hours with rotation. The BCL11B and GAPDH bands were cut according to the size of the protein markers and transferred to a 1:5000 dilution of the primary antibodies against BCL11B (CST, rabbit antibody) and GAPDH (Beyotime, mouse antibody) respectively, and incubated with rotation at 4°C overnight. After recovering the primary antibody dilution, wash with 3 mL of 1×TBST at room temperature for 3 minutes, repeat the wash three times, replace it with the corresponding 1:10000 secondary antibody dilution, incubate with rotation at room temperature for 2 hours, then recover the secondary antibody dilution, wash with 3 mL of 1×TBST at room temperature for 3 minutes, repeat the wash three times, add biosharp chemiluminescence detection substrate when the PVDF membrane is not obviously dry, expose and photograph the protein bands in the developer, and observe the changes.

[0083] (5) Flow cytometry detection of cell apoptosis

[0084] After incubation with the nanoparticle complex for 48 hours, the Molt4 / CCRF-CEM cell culture medium was added and the cells were collected into a 1.5 mL centrifuge tube. The cells were centrifuged at 350 rcf for 5 minutes at room temperature, resuspended in 1 mL of 1× PBS, and centrifuged at 350 rcf for 5 minutes at room temperature. According to the instructions of the Lianke Apoptosis Kit, each group was resuspended in 100 μL of 1X binding buffer, and 1 μL of Annexin V antibody and 0.5 μL of Propidine iodide (PI) antibody solution were added. The cells were gently pipetted to mix, and the cells were incubated at room temperature in the dark for 5 minutes. The cell fluorescence in the APC and PE channels was measured on an Agilent 6-color flow cytometer. The experimental results were analyzed using FlowJo software, and the proportional data were output.

[0085] (6) CCK-8 detection of cell activity

[0086] Add the nanoparticle complex to the culture medium of Molt4 / CCRF-CEM cells after 48 hours of incubation, collect the cells into a 1.5 mL centrifuge tube, centrifuge at 350 rcf for 5 min at room temperature, resuspend in 1 mL of complete culture medium, count, and dilute to 50*10 4 / mL, extract 100μL of cell suspension and add it to 96-well plate so that each well contains 5*10 4 Cells were plated in a blank well with no cells for baseline correction. Three replicates were set up for each group. 10 μL of biosharp CCK-8 reagent was added to each well and the plate was gently mixed. The plate was returned to the incubator at 37°C for 4 hours. After incubation, the plate was read at a wavelength of 450 nm using a microplate reader. The read value was subtracted from the blank well value, with the blank control group set as 1. Cell viability was calculated using the following formula: Cell viability = (treated group - blank control group) / (blank control group).

[0087] (7) Animal experiments

[0088] We ordered 5-week-old immunodeficient BND-G mice from Zhuhai Baishitong Co., Ltd. After quarantine, we injected 300 × 106 T-ALL PDX cells (donated by the Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences) into the mouse's circulation via tail vein injection. On day 7, 100 μl of orbital blood was collected and placed in a 1.5-well polypropylene tube with 200 μl of 1X PBS containing 2 mM EDTA. The tube was mixed thoroughly to prevent clotting, centrifuged at 500 rcf for 5 minutes, and the supernatant was removed. The tube was resuspended in 1 mL of erythrocyte lysis buffer (biosharp, BL503B) and incubated at room temperature in the dark for 15 minutes, inverting every 5 minutes to mix thoroughly. After lysis, the tube was centrifuged at 500 rcf for 5 minutes, and the supernatant was removed. The tube was resuspended in 1 mL of 1X PBS and centrifuged at 500 rcf for 5 minutes. The supernatant was removed and washed once more. Prepare 200ul of 1X PBS + 5ul of CD45-FITC (Biolegend, 304038) mixture for each sample, resuspend and incubate at room temperature in the dark for 15 minutes, add 1mL of 1X PBS to the EP tube and resuspend, centrifuge at 500rcf for 5 minutes, remove the supernatant, add 200ul of 1X PBS, and use flow cytometry to detect the expression of human CD45 in peripheral blood. If the expression ratio of human CD45 in peripheral blood exceeds 5%, the modeling is successful. According to the blank control group Contrl (CTR), PAMAM-G5 single-use group (PAMAM), PAMAM-G5 packaged sgc8 group (PAMAM+sgc8), PAMAM-G5 packaged siBCL11B group (PAMAM+siBCL11B), PAMAM-G5 packaged siBCL11B and sgc8 group (PAMAM+siBCL11B+sgc8), the animal experimental drugs were based on the nanoparticle mass of 5 mg / kg, the molar ratio of PAMAM-G5 to nucleic acid was 3:1, and the mass ratio was about 6.3:1. The drugs were injected into the tail vein every 2 days. After 3 consecutive weeks, the survival information of the mice was recorded. The experimental endpoint was 2 weeks after drug withdrawal. The experiment was stopped and the mice were killed by CO2 asphyxiation. The spleen and femoral tissue of the mice were dissected and one of the femurs was extracted with a syringe to extract 1X After PBS administration, the femur was punctured into the long diameter to flush out the bone marrow cells and collect them into an EP tube. Following the same steps as previously described for red blood cell lysis and CD45 flow cytometric staining, the proportion of human CD45 expression in the bone marrow was measured to reflect tumor burden. The spleen's long and short diameters were measured, also reflecting tumor burden. The spleen and remaining femur were fixed in 3 mL of 4% paraformaldehyde (Biyuntian, P0099-500ml) for 48 hours and then sent to Guangzhou Bolfu Biotechnology Co., Ltd. for tissue sectioning and subsequent HE staining and BCL11B immunohistochemical staining (CST, 12120S). Changes in T-ALL tumor infiltration and BCL11B expression in the spleen and bone marrow after nanomedicine intervention were examined.

[0089] (8) Toxicity Assay Experiment

[0090] Collect 5 mL of human peripheral blood from healthy donors in Guangzhou Huayi Hospital, and all sample collections are done with the informed consent of the donors. The ethical committee of Huayi Hospital approves the collection. All operations and reagents after peripheral blood collection are in a sterile environment and sterile reagents. Take 4 mL of human peripheral blood lymph separation medium and place it in a 15 mL centrifuge tube. Dilute the peripheral blood with an equal volume of 1X PBS and gently tilt the diluted peripheral blood on the lymph separation medium with a Pasteur pipette. Centrifuge at 1500 rpm at room temperature for 15 min. Gently aspirate the PBMC layer with a Pasteur pipette and transfer it to a new 15 mL centrifuge tube. Add 6 mL of 1X PBS and mix well, then centrifuge at 1000 rpm at room temperature for 10 min. Remove the supernatant and repeat the washing once. The reagents used after this step for sorting are pre-cooled at 4°C. The following buffer for sorting is 1X PBS containing 4% FBS. Resuspend the cell mass with sorting buffer and transfer it to a 1.5 EP tube for cell counting. Centrifuge at 350 rcf at 4°C for 5 min to remove the supernatant. Add 80 uL of sorting buffer and 20 uL of sorting magnetic beads CD3 antibody to each 1*10e7 cells. Resuspend the cell mass thoroughly and incubate at 4°C for 15 min, mixing gently every 5 min during the incubation. After incubation, add 1 mL of sorting buffer and centrifuge at 4°C at 350 rcf for 15 min. Remove the supernatant and repeat the step twice. Resuspend the cell suspension with 500 uL of sorting buffer. Fix the sorting column to the magnetic stand, place the waste tube, and rinse the column with 1 mL of sorting buffer three times. Add the cell suspension to the sorting column, and when the cell suspension is about to pass through the column, add 3 mL of sorting buffer to the sorting column and wash it three times. Remove the sorting column from the magnetic stand, add 1 mL of sorting buffer to a new 15 mL centrifuge tube, and use a piston column to push the cells in the sorting column with the sorting buffer into the centrifuge tube. Discard the foam at the end of the push, add 5 mL of sorting buffer to the 15 mL centrifuge tube, centrifuge at 350 rcf at room temperature for 5 min, and remove the supernatant. Add 2 mL of RPMI 1640 medium containing 10% FBS to resuspend the cells and plant them in a 12-well plate to obtain human peripheral blood T cells. Add 400 U / mL IL-2 and 10 ul of CD3 / CD28 monoclonal antibody per 1 mL of culture medium to the human peripheral blood T cell culture medium to maintain and stimulate the survival and proliferation of T cells. The cells will be cultured in a sterile incubator at 5% CO2 and 37°C. After 48 h of CD3 / CD28 stimulation, the human peripheral blood T cells obtained are sufficient for subsequent experiments.

[0091] In a 24-well plate, plant 50*10 4Human peripheral blood T cells were grouped in the same manner according to the same dosage of T-ALL cell lines, namely, a blank control group (CTR), a PAMAM-G5 single-use group (PAMAM), a PAMAM-G5 packaged sgc8 group (PAMAM+sgc8), a PAMAM-G5 packaged siBCL11B group (PAMAM+siBCL11B), and a PAMAM-G5 packaged siBCL11B and sgc8 group (PAMAM+siBCL11B+sgc8). The same dose of reagents was added to each group and incubated for 48 hours, and then T cell apoptosis was detected by flow cytometry. The operation was the same as the previous operation and will not be repeated.

[0092] 9) Statistical analysis

[0093] All data are presented as the mean ± SD of three independent experiments and were statistically analyzed using GraphPad Prism 8.0 software. Statistical significance was analyzed using the rank sum test and one-way analysis of variance, and p values ​​were used (p values ​​< 0.05 were considered significant. *, P < 0.05, **, P < 0.01, ***, P < 0.001, ****P < 0.0001).

[0094] 2. Experimental Results

[0095] 1. Figure 1 The structure and effectiveness mechanism of the design of the present invention are demonstrated, namely, siBCL11B, which promotes the apoptosis of T-ALL tumor cells, and the nucleic acid aptamer sgc8 that can target T-ALL tumor cells are encapsulated by PAMAM-G5. Through the specific recognition between sgc8 and PTK7, PTK7 mediates the endocytosis of the nanoparticles and releases siBCL11B in the cells to achieve specific transfection and promote the apoptosis of T-ALL tumor cells.

[0096] The nanoparticle complexes formed by different ratios of PAMAM-G5 and siBCL11B were subjected to agarose gel electrophoresis. Figure 2 The electrophoresis results show that as the amount of PAMAM-G5 increases, the number of nanocomplexes gradually increases. Finally, when PAMAM-G5:siBCL11B = 3:1, all siBCL11B is bound to PAMAM-G5. Due to the large molecular weight of PAMAM-G5, the electrophoresis graph shows that the nucleic acid has not migrated at the sample loading well. At this time, this ratio is the most appropriate.

[0097] According to this ratio, we set up different transfection groups and used siBCL11B labeled with cy5 (red fluorescence) and sgc8 labeled with FAM (green fluorescence). After incubation in Molt4 cell line for 24 hours, we used confocal microscopy to locate the nucleic acid molecules inside and outside the cells. Figure 3 As shown, the complex formed by PAMAM-G5 and nucleic acid can be stably delivered to Molt4 cells in complete medium with 10% serum and then transfected.

[0098] 2. 48 h after applying the nanoparticle complex, we collected Molt4 / CCRF-CEM cells and extracted RNA. After reverse transcription into cDNA, we used RT-PCR to detect the expression of BCL11B in Molt4 cells. The results are as follows Figure 4 As shown. It can be found that compared with the CTR control group, PAMAM-G5 successfully delivered siBCL11B into cells and released siBCL11B, knocking down the expression of BCL11B at the transcriptional level, and the reduction was most obvious in the complex group with added sgc8. At the same time, we also extracted the total protein of Molt4 / CCRF-CEM and detected the expression of BCL11B by Western blot. The results are shown as follows Figure 5 As shown in Figure 2, compared to the CTR control group, the expression of BCL11B protein levels in both groups of nanoparticle complexes encapsulating siBCL11B was reduced. This indicates that the nanoparticle complexes successfully transfected and delivered siBCL11B and knocked down BCL11B expression.

[0099] 3. We further examined the apoptosis of Molt4 / CCRF-CEM cells 48 hours after transfection with the nanoparticle complex. Figure 6 and Figure 8 As shown. It can be found that compared with the CTR control group, the apoptosis of Molt4 / CCRF-CEM cells in the group with siBCL11B-encapsulated nanoparticle complex increased, and the apoptosis rate of the group with sgc8 was even higher. At the same time, we used CCK-8 to detect the viability of Molt4 / CCRF-CEM cells 48 hours after transfection with nanoparticle complexes. The results are shown as follows Figure 7 and Figure 9 As shown in the figure, compared to the CTR control group, the activity of Molt4 / CCRF-CEM cells in the group containing the siBCL11B-encapsulated nanoparticle complex was reduced, and the activity of cells in the group containing the added sgc8 was even lower. This suggests that the nanoparticle complex can promote T-ALL tumor cell apoptosis and inhibit cell proliferation by delivering siBCL11B, and that sgc8 can enhance the efficiency of the nanoparticle complex.

[0100] 4. We further constructed a T-ALL PDX model by transplanting the cells into BND-G mice and administered the drugs according to the protocol. At the end of the experiment, we obtained femoral bone marrow cells from mice in each group and used flow cytometry to detect the expression ratio of human CD45 in bone marrow cells in each group. The results are as follows: Figure 10 As shown, compared to the CTR control group, the siBCL11B-loaded nanoparticle complex group showed a lower proportion of human CD45 expression, indicating a reduced tumor burden. Furthermore, the group with the addition of sgc8 showed an even lower tumor burden. This demonstrates that the nanodrug designed in this patent can still function in an in vivo environment that mimics T-ALL, and that sgc8 can enhance the efficiency of the nanoparticle complex.

[0101] 5. We further performed the same intervention on primary T cells collected and sorted from healthy donors according to the dosage and grouping of the cell line experiment and used flow cytometry to detect the effect of transfection of nanoparticle complexes on normal T cell apoptosis 48 hours later. The results are as follows: Figure 11 As shown, it can be found that the nanoparticles designed in this patent have little effect on the apoptosis rate of normal T cells at a dose that exerts an anti-tumor effect.

[0102] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the described embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A nanoparticle composite, characterized in that: It is made of a polyamide-amine dendrimer and a nucleic acid compound, wherein the nucleic acid is the aptamer sgc8 and siBCL11B; the siBCL11B is an siRNA that targets and inhibits the BCL11B gene; The polyamidoamine dendrimer is selected from PAMAM-G5; The sequence of the aptamer sgc8 is 5'-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3'; The sequence of the siBCL11B is 5'-GCACAACAUGCAAGCAGCCCUUCAA-3'.

2. The nanoparticle composite according to claim 1, characterized in that: The molar ratio of the polyamide-amine dendrimer to the nucleic acid is 2 to 4:

1.

3. The nanoparticle composite according to claim 2, characterized in that: The molar ratio of the polyamidoamine dendrimer to the nucleic acid is 3:

1.

4. The nanoparticle composite according to claim 1, characterized in that: The molar ratio of the aptamer sgc8 to siBCL11B is 3-5:

1.

5. The nanoparticle composite according to claim 4, characterized in that: The molar ratio of the aptamer sgc8 and siBCL11B is 4:

1.

6. The method for preparing the nanoparticle composite according to any one of claims 1 to 5, characterized in that: The polyamidoamine dendrimer solution, the aptamer sgc8 solution, and the siBCL11B solution were thoroughly mixed, centrifuged instantaneously, and incubated at room temperature to form a stable nanoparticle structure.

7. Use of the nanoparticle complex according to any one of claims 1 to 5 in the preparation of a medicament for treating acute T-lymphocytic leukemia.

Images