A cell biosensor for PCA-producing strains based on transcription factor BsdA and its application

Abstract

The present invention belongs to the field of bioengineering technology, and discloses a cell biosensor for PCA production strain based on transcription factor BsdA and its application. The protocatechuic acid biosensor of the present invention is applicable to the breeding of protocatechuic acid high-yield strains. The present invention uses the transcriptional regulatory factor BsdA derived from Bacillus licheniformis DW2, which can respond to protocatechuic acid, as the basic functional element, and constructs an efficient protocatechuic acid biosensor by coupling the protocatechuic acid concentration with the fluorescence intensity of green fluorescent protein. It can realize the real-time monitoring of the intracellular protocatechuic acid concentration of Bacillus licheniformis, and is used for the mutagenesis breeding of rapidly screening protocatechuic acid high-yield strains.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to a cell biosensor for PCA-producing strains based on the transcription factor BsdA and its application. Background Art

[0002] Protocatechuic acid (PCA) is a natural phenolic aromatic compound with various pharmacological activities, and thus can be used as a raw material for medicine, functional foods, and cosmetics (DOI: 10.1016 / j.biortech.2020.124239). In addition, PCA is an important platform compound and can be used as a precursor for the biomanufacture of high-value-added compounds with a wide range of application fields, such as vanillin, gallic acid, adipic acid, etc. (DOI: 10.1016 / j.biortech.2020.124239). Due to the wide application value of PCA, the efficient production of PCA has received increasing attention in recent years.

[0003] Microbial synthesis is one of the important means for the efficient production of PCA. At present, the synthesis of PCA in various microbial hosts has been achieved through strain genetic modification (DOI: 10.1016 / j.ymben.2024.02.003), and the rapid screening of high-yield PCA strain genetic modification is the basis and key for the industrial production of PCA. Biosensors can specifically respond to target compounds and output fluorescence signals for easy detection, and thus have been widely used in the high-throughput screening of strain genetic modification. Currently, biosensors based on transcription factors are the most common. The most commonly used transcription factors are bacterial transcription factors, including ligand-binding domains and DNA-binding domains (DOI: 10.1021 / acssynbio.1c00549). However, the research on PCA biosensors is almost blank, which reduces the efficiency of obtaining high-yield PCA strains and hinders the process of its industrial production.

[0004] To address the above problems, in Bacillus licheniformis, a novel transcription factor BsdA responsive to PCA activation was mined, and a cell biosensor for PCA-producing strains based on the transcription factor BsdA was developed. Based on this biosensor, mutagenesis breeding screening of high-yield strains was carried out.

[0005] It was applied to the rapid screening of mutagenesis breeding of high-yield PCA strains to obtain high-yield PCA strains. Summary of the Invention

[0006] The object of the present invention is to provide a cell biosensor for PCA-producing strains based on the transcription factor BsdA, and the biosensor is

[0007] Another object of the present invention is to provide an application of a protocatechuic acid biosensor based on the transcription factor BsdA.

[0008] To achieve the above object, the present invention takes the following technical measures:

[0009] A protocatechuic acid-producing strain cell biosensor based on the transcription factor BsdA, wherein the biosensor is a recombinant Bacillus licheniformis, and the recombinant Bacillus licheniformis integrates an expression vector for driving the expression of a fluorescent protein by the transcription factor BsdA and an expression vector for expressing protocatechuic acid synthase.

[0010] The protein encoded by the transcription factor BsdA is shown in SEQ ID NO.2; preferably, the coding sequence is shown in SEQ ID NO.1.

[0011] For the above-mentioned biosensor, preferably, the fluorescent protein is green fluorescent protein, yellow fluorescent protein, red fluorescent protein or blue fluorescent protein.

[0012] For the above-mentioned biosensor, preferably, the Bacillus licheniformis is a Bacillus licheniformis integrated with an expression vector for expressing protocatechuic acid synthase.

[0013] For the above-mentioned biosensor, preferably, the protein encoded by the protocatechuic acid synthase gene contained in the expression vector for expressing protocatechuic acid synthase is shown in SEQ ID NO.4, and more preferably, the protocatechuic acid synthase gene is shown in SEQ ID NO.3.

[0014] For the above-mentioned biosensor, preferably, the Bacillus licheniformis is Bacillus licheniformis P-20.

[0015] The protection scope of the present invention also includes:

[0016] The application of the above-mentioned biosensor in the preparation of a high-yield protocatechuic acid strain;

[0017] For the above-mentioned application, preferably, in the conventional strain manner in the art, the above-mentioned strain is mutated, and strains with higher fluorescence brightness are screened to obtain a high-yield protocatechuic acid mutant strain.

[0018] The above-mentioned mutation includes, but is not limited to, radiation, ultraviolet irradiation, or drug-induced mutation, etc.

[0019] Compared with the prior art, the method of the present invention has the following advantages:

[0020] (1) The present invention reports for the first time a transcription factor BsdA that can respond to protocatechuic acid signal molecules and be activated.

[0021] (2) The present invention provides a novel protocatechuic acid biosensor that can monitor the content of protocatechuic acid in real time.

[0022] (3) In traditional metabolite mutagenesis breeding work, there is a large amount of screening and detection work, which is time-consuming and laborious. In the present invention, the protocatechuic acid biosensor developed based on the transcription factor BsdA can conveniently, quickly and effectively screen mutagenesis breeding strains with high PCA yield. Brief Description of the Drawings

[0023] Figure 1 It is the design diagram of the protocatechuic acid biosensor based on the transcription factor BsdA.

[0024] Figure 2 It is the characterization diagram of the protocatechuic acid biosensor based on the transcription factor BsdA.

[0025] Figure 3 It is the fermentation result diagram of mutagenesis breeding with high PCA yield. Detailed Embodiments

[0026] The reagents or materials described in the present invention, unless otherwise specified, are all from commercial channels.

[0027] The present invention will be described below through specific implementation examples. Unless otherwise specified, the technical means used in the present invention are all methods well known to those skilled in the art. In addition, the implementation examples should be understood as illustrative rather than limiting the scope of the present invention. The essence and scope of the present invention are only defined by the claims. For those skilled in the art, without departing from the essence and scope of the present invention, various changes or modifications to the material components and dosages in these implementation examples also fall within the protection scope of the present invention.

[0028] In the present invention, the P-20 Bacillus licheniformis with high PCA yield itself is taken as an example for illustration, and the ordinary Bacillus licheniformis is used in Example 1:

[0029] A PCA-producing strain cell biosensor based on the transcription factor BsdA

[0030] The applicant found that the expression of PCA can activate the transcription factor BsdA. Therefore, a fluorescent protein can be conjugated to the transcription factor BsdA to indicate the expression level of PCA, thereby screening strains with high PCA expression.

[0031] In this embodiment, the fluorescent protein is exemplified by green fluorescent protein, and other fluorescent proteins, such as red fluorescent protein, yellow fluorescent protein, blue fluorescent protein, etc. can also achieve the present invention.

[0032] The specific construction method is as follows:

[0033] 1. According to the sequence of the bsdBCD gene cluster in the genomic DNA sequence of Bacillus licheniformis DW2 (CN117402802A) and the sequence of plasmid pHY-R0-GFP (DOI: 10.1016 / j.ymben.2023.06.004), upstream homologous arm primers (bsdBCD-F1, bsdBCD-R1), downstream homologous arm primers (bsdBCD-F3, bsdBCD-R3) and reporter protein GFP primers (GFP-F2, GFP-R2) were designed; then, using the genomic DNA of Bacillus licheniformis DW2 and plasmid pHY-R0-GFP as templates, the upstream homologous arm fragment, downstream homologous arm fragment and reporter protein GFP of bsdBCD were amplified by PCR respectively;

[0034] Among them, the sequences of bsdBCD-F1, bsdBCD-R1, GFP-F2, GFP-R2, bsdBCD-F3, and bsdBCD-R3 are: bsdBCD-F1: CTGCAGCCCGGGGGATCCTGGAAAGGCGTTGTCGTG, bsdBCD-R1: TATATATTCCTCCTTTCTAATATACATGCGCCCCCCTTTCCCTCTT, GFP-F2: GTATATTAGAAAGGAGGAATATATAATGGTGAGCAAGGGCGAGG, GFP-R2: CGGATGCCTCCCTTTAGATTACTTGTACAGCTCGTCC, bsdBCD-F3: GGACGAGCTGTACAAGTAATCTAAAGGGAGGCATCCG, bsdBCD-R3: GATCTTTTCTACGAGCTCCAATTGGCTGTACCTTGGC;

[0035] 2. Using the upstream homologous arm, downstream homologous arm and reporter protein GFP fragment of the bsdBCD sequence as templates, and the upstream homologous arm primer bsdBCD-F1 and downstream homologous arm primer bsdBCD-R3 as primers, the upstream homologous arm, reporter protein GFP fragment and downstream homologous arm of the bsdBCD sequence were connected together by overlapping extension PCR to obtain the target fragment bsdBCD-GFP;

[0036] 3. Primers T2-T5-F / R were designed, and the T2 backbone was amplified using plasmid T2(2)-ori as a template. Among them, the sequences of T2-T5-F / R are:

[0037] T2-T5-F: GGATCCCCCGGGCTGCAGGAATTC

[0038] T2-T5-R: GAGCTCGTAGAAAAGATCAAAGGA

[0039] 4. Use the Nanjing Novoprotein One Step Cloning Kit to ligate the gene fragments obtained in steps 2 and 3 with the linear T2 backbone, transfer the ligation product into Escherichia coli DH5α by the calcium chloride transformation method, culture it on a medium plate containing kan r After culturing, use the verification primers T2-F / R to perform colony PCR verification on the transformants to obtain the plasmid T2::PbsdB-gfp in which bsdBCD is replaced (this plasmid no longer contains the bsdBCD gene cluster, and the expression of GFP is driven by bsdA). Then, electrotransform the plasmid T2::PbsdB-gfp into Bacillus licheniformis P-20 (CN117511832A, paragraph

[0094] , also referred to as PCA20 in the present invention), and after culturing on a medium plate containing kan r After culturing, use the verification primers T2-F / R to perform colony PCR verification on the transformants to obtain the recombinant strain PCA20 / T2::PbsdB-gfp. The sequences of T2-F / R are as follows:

[0040] T2-L: ATGTGATAACTCGGCGTA

[0041] T2-R: GCAAGCAGCAGATTACGC

[0042] 5. Transfer and culture the recombinant strain PCA20 / T2::PbsdB-gfp obtained in step 4 3 times on a liquid medium containing kanamycin resistance at 45°C, with each culture lasting 10 - 12 h. And use T2-F and bsdBCD-YR as verification primers to perform colony PCR detection to obtain the recombinant strain PCA20-T2::PbsdB-gfp with successful single crossover. Then, transfer and culture it several times in a liquid medium without kanamycin at 37°C, and use the double crossover verification primers bsdBCD-YF / R to perform colony PCR verification on the selected transformants to obtain the strain PCA20::PbsdB-gfp with successful double crossover. Among them, the sequences of bsdBCD-YF / R are as follows:

[0043] bsdBCD-YF: GAGTGAAAGTGATGGACGACC

[0044] bsdBCD-YR: CGTGTTTTCCGTCTGCGCTG

[0045] 6. Using the plasmid pHY-R55-GFP (DOI: 10.1016 / j.ymben.2023.06.004) and the protocatechuate synthase gene qsuB of Corynebacterium glutamicum (shown in SEQ ID NO.3, encoding the protein shown in SEQ ID NO.4) as templates, the backbone pHY-R55 and the fragment QsuB were amplified by PCR with primers T5-F / R and QsuB-F / R, and DNA recovery was performed;

[0046] 7. The residual pHY-R55-GFP template in the vector backbone pHY-R55 was digested with DpnI enzyme;

[0047] 8. The vector backbone and the fragment were treated with Vazyme's homologous recombination enzyme (Exnase II) and reacted at 37 °C for 30 min to ligate the vector backbone pHY-R55 and the fragment QsuB; the recombinant plasmid pHY-R55-QsuB was obtained;

[0048] 9. The recombinant plasmid pHY-R55-QsuB obtained in step (8) was electrotransformed into Bacillus licheniformis PCA20::PbsdB-gfp, and tetracycline antibiotics were used as screening markers. Subsequently, positive transformants were screened by colony PCR with primers pHY-F / R, and thus the Bacillus licheniformis strain PCA20::PbsdB-gfp / R55-QsuB of the protocatechuate biosensor was successfully obtained.

[0049] The primers used in Example 1 above are as follows:

[0050] T5-F: ACAAATCTCCCCCTTTGTTG

[0051] T5-R: AAGAGCAGAGAGGACGGATTTCC

[0052] QsuB-F: ACAAAGGGGGAGATTTGTATGCGTACATCCATTGCCACTG

[0053] QsuB-R: TCCGTCCTCTCTGCTCTTCTAGTTGGGGATTCCCCGCTCGAG

[0054] pHY-F: GTTTATTATCCATACCCTTAC

[0055] pHY-R: CAGATTTCGTGATGCTTGTC

[0056] 10. Seed preparation: The engineered strain PCA20::PbsdB-gfp / R55-QsuB and the control strain PCA20::PbsdB-gfp / pHY300 obtained in step 9 were respectively inoculated into 5 mL of LB medium at a volume percentage of 1% from the glycerol tube, cultured at 230 r / min and a temperature of 37 °C for 12 hours. Then, the activated bacterial liquid was inoculated into a 50 mL seed fermentation medium of LB at an inoculation amount of 1% (volume percentage) and cultured at 230 r / min and 37 °C for 10 hours to obtain the bacterial liquid for seed culture.

[0057] The described control strain PCA20::PbsdB-gfp / pHY300 was obtained by transferring the empty vector pHY300 into PCA20::PbsdB-gfp.

[0058] 11. Strain fermentation: The bacterial liquid for seed culture was added to a 500 mL Erlenmeyer flask containing 50 mL of protocatechuic acid fermentation medium at an inoculation amount of 3% (volume percentage). Then, the rotation speed was 230 r / min and the temperature was 37 °C, and the fermentation culture was carried out for 72 hours. Every 12 hours, the fluorescence level of GFP and the PCA yield were detected. The detection results are shown in Figure 2 .

[0059] From Figure 2 the results, we can find that compared with the control strain PCA20::PbsdB-gfp / pHY300, as PCA gradually accumulates in PCA20::PbsdB-gfp / R55-QsuB, the expression of GFP is effectively initiated, and as PCA further accumulates, the fluorescence intensity of GFP gradually increases.

[0060] This result indicates that PCA is a signal molecule that activates the transcription factor BsdA. We successfully developed a cell biosensor for PCA based on the transcription factor BsdA, using the GFP fluorescence intensity biased towards reading to respond to the content of PCA.

[0061] 12. GFP detection: Take 0.2 mL of the fermentation broth into a 2 mL EP tube, add 1.8 mL of PBS buffer, and measure its biomass (OD600) with a visible light spectrophotometer. Then, dilute the fermentation broth with PBS buffer to a final concentration (OD 600 ) of 1 and a final volume of 2 mL. Subsequently, centrifuge at 7000 rpm for 2 min, then resuspend with 2 mL of PBS buffer and repeat once. Finally, detect its fluorescence intensity with a microplate reader.

[0062] 13. PCA Detection: Protocatechuic acid was detected by high performance liquid chromatography (HPLC). The detection conditions were as follows: an Agilent 1260 high performance liquid chromatograph was used, the chromatographic column was a C18 column (4.6 mm ID × 250 mm, 5 μm), the mobile phase was 100% methanol / 0.1% formic acid = 1 / 4, the flow rate was 0.6 mL / min, the column temperature was 30 °C, the injection volume was 10.0 μL, the detection wavelength was 224 nm, and the detection time was 20 min. The yield of protocatechuic acid in the fermentation broth was calculated according to the standard curve prepared with the protocatechuic acid standard product.

[0063] Example 2:

[0064] The protocatechuic acid biosensor was used for the rapid screening of mutagenesis breeding of protocatechuic acid high-yield strains:

[0065] 1. First, the strain PCA20::PbsdB-gfp / R55-QsuB was activated and cultured to prepare a bacterial suspension, which was uniformly added to a sterilized petri dish (without a lid). After irradiation with a 30 W ultraviolet lamp for a certain time (40 s) in a laminar flow hood, the bacterial liquid in the petri dish was aspirated and transferred into a sterilized 1.5 mL centrifuge tube, and immediately placed in an ice-water mixture. Then, under dark conditions, the bacterial liquid was spread on a petri dish with tetracycline resistance and incubated at 37 °C for 24 - 36 h with constant static culture.

[0066] 2. Single colonies were picked and streaked one by one on a new petri dish with tetracycline resistance, and were respectively inoculated into a 96-well plate containing 1 mL of protocatechuic acid fermentation medium. At the same time, the starting strain PCA20::PbsdB-gfp / R55-QsuB (CK) was used as a control. After culturing at 37 °C and 230 rpm for 24 h, the GFP expression intensity was measured using a microplate reader.

[0067] 3. Repeat steps 1 - 2 until mutants with GFP fluorescence intensity significantly higher than that of the starting strain PCA20::PbsdB-gfp / R55-QsuB are screened.

[0068] 4. The mutants D1-8 and D5-36 strains screened in step 3 above were fermented with protocatechuic acid together with the control strain PCA20::PbsdB-gfp / R55-QsuB. Samples were taken after 72 hours of fermentation, and the yield of protocatechuic acid and the fluorescence intensity of GFP were detected ( Figure 3 ). As Figure 3 can be seen, compared with the control strain PCA20::PbsdB-gfp / R55-QsuB, the mutants D1-8 and D5-36 strains increased the yield of protocatechuic acid by 21.85% and 11.64% respectively. The results showed that we successfully used the protocatechuic acid biosensor to rapidly screen mutants of protocatechuic acid mutagenesis breeding and successfully obtained the mutant D1-8 with high protocatechuic acid yield.

Claims

1. A protocatechuic acid producing strain cell biosensor based on transcription factor BsdA, wherein the biosensor is a recombinant Bacillus licheniformis, and the recombinant Bacillus licheniformis is integrated with an expression vector for a fluorescent protein driven by the transcription factor BsdA and an expression vector for expressing protocatechuic acid synthase; The expression vector integrated with the fluorescent protein driven by the transcription factor BsdA replaces the BsdBCD gene cluster of the Bacillus licheniformis DW2 strain with the fluorescent protein gene, and the expression of the fluorescent protein is driven by the transcription factor BsdA and the PbsdB promoter; The sequence of the transcription factor BsdA is shown in SEQ ID NO.1; The fluorescent protein is green fluorescent protein, yellow fluorescent protein, red fluorescent protein or blue fluorescent protein; The expression vector for expressing protocatechuate synthase, the sequence of protocatechuate synthase is shown as SEQ ID NO.

4.

2. The biosensor according to claim 1, wherein the protocatechuate synthase gene is shown as SEQ ID NO.

3.

3. The biosensor according to claim 1, wherein the Bacillus licheniformis is Bacillus licheniformis P-20.

4. Use of the biosensor according to claim 1 in preparing a high protocatechuic acid producing strain.

Images