A residue-free sequence circular RNA based on ribozyme self-splicing and its preparation method

Abstract

The present invention discloses a residue-free sequence circular RNA based on ribozyme self-splicing and a preparation method thereof, belonging to the field of molecular biology. The circular RNA is prepared from a DNA molecule, and the DNA molecule comprises elements operably linked and arranged in the following order from 5' to 3': a promoter; a poly X fragment containing more than 5 identical consecutive bases; a type I intron fragment; and a target fragment; wherein the type I intron ribozyme can initiate cleavage in a single-step transesterification reaction, so that the linear RNA transcribed from the DNA molecule is configured to be self-cyclized to produce a circular RNA, and the circular RNA only contains the RNA corresponding to the target fragment, thereby avoiding the additional use of wild-type exon residues at both ends of the intron known to promote cleavage, and there is no residual exon sequence. The technical problem of residual exons in circular RNA in the prior art is solved. The circular RNA can be used for the diagnosis and treatment of diseases.

Description

Technical Field

[0001] This specification relates to the field of molecular biology, and particularly to a residue-free sequence circular RNA based on ribozyme self-splicing and a preparation method thereof. Background Art

[0002] Circular RNAs are a class of closed circular RNAs widely present in animals and plants. In recent years, with the development and improvement of new transcriptome sequencing technologies and the continuous update of corresponding computational biology analysis programs, hundreds of thousands of exon back-spliced (or sheared) circular RNAs have been discovered in eukaryotes. These circular RNAs can participate in biological processes such as immunity, metabolism, nervous system development, and reproduction through mechanisms such as acting as molecular sponges for miRNAs and proteins, affecting transcription, interfering with the normal splicing of pre-mRNAs, regulating mRNA molecule translation, forming circular RNA-protein complexes, and competitively binding proteins with mRNAs.

[0003] Due to the relatively stable structure of circular RNAs and the use of non-cap-dependent transcriptional initiation elements such as internal ribosome entry sites (IRESs), circular RNAs can be used as a protein expression vector tool and directly introduced into cells to achieve long-term expression of target proteins.

[0004] Currently, the mainstream method for in vitro synthesis of circular RNAs is based on the self-splicing and circularization scheme of type I or type II intron ribozymes PIE (permuted intron-exon). Due to its special structure, it is usually necessary to retain the exon junctions at both ends of the intron or simulate wild exon junctions to design the target circularization sequence, so as to achieve an efficient in vitro cleavage-circularization process. And these designs depend on the specific situation of the target sequence (also known as the target fragment). Especially for short non-coding circular RNA sequences, it is difficult to simulate wild exon junctions, and often it is necessary to retain a certain exon junction additionally, which will form a scar sequence (SCAR sequence) after circularization. The residual scar sequence is usually considered to increase immunogenicity or relatively change the secondary structure of circular RNA, thereby affecting its physiological function.

[0005] In addition, the self-splicing and circularization scheme based on type I or type II intron ribozymes PIE usually requires two-step affinity attack reactions to cleave off the intron fragment to obtain circular RNA. After the reaction, the reaction mixture contains in vitro transcription precursors, first cleavage intermediates, circular RNAs, different intron fragments, and linear molecules with circular RNAs broken and opened. Purifying circular RNA from the reaction mixture is a major problem faced from the laboratory level to the clinical therapeutic molecular application.

[0006] Therefore, it is desirable to provide an in vitro method for efficiently synthesizing circular RNAs without exon and scar sequence residues in one step and a preparation method thereof. Summary of the Invention

[0007] One or more embodiments of the present specification provide a DNA molecule for preparing circular RNAs, including elements operably linked and arranged in the following order from 5' to 3': a promoter; a poly X fragment, the poly X fragment containing more than 5 identical consecutive bases, and X represents any one of the bases A, T, C, and G; a type I intron fragment; and a target fragment; wherein the type I intron ribozyme can initiate cleavage in a one-step transesterification reaction, so that the linear RNA transcribed from the DNA molecule is configured to be able to circularize itself to produce circular RNAs, and the circular RNAs only contain the RNAs corresponding to the target fragment.

[0008] One or more embodiments of the present specification provide a recombinant expression vector, including the DNA molecule as described above.

[0009] One or more embodiments of the present specification provide a circular RNA prepared according to the DNA molecule as described above.

[0010] One or more embodiments of the present specification provide a method for preparing circular RNAs based on the DNA molecule as described above, the method including:

[0011] An in vitro transcription reaction is carried out to obtain linear RNA based on the DNA molecule. After transcription, a modified base X-NTP is added to the 3'-end of the linear RNA by a ligation means, where X in the X-UTP represents a modification group, N is any one of A, U, C, and G, and the X-NTP includes one or more of fluorescein isothiocyanate-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-desthiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxy-NTP, 5-formyl-NTP, desthiobiotin-16-NTP, 5-carboxymethyl ester-NTP, 5-hydroxymethyl-NTP, N1-methylpseudo-NTP, 3'-O-methyl-NTP, 5-bromo-NTP, 2'-O-methylpseudo-NTP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thieno-NTP, 5-iodo-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas Red-NTP, TET-NTP, NED-NTP; and the linear RNA is cyclized to generate the circular RNA containing only the RNA corresponding to the target fragment.

[0012] The circular RNA containing only the RNA corresponding to the target fragment is prepared by the DNA molecule provided in the embodiments of the present specification, which can avoid the additional use of wild-type exon residues at both ends of the intron known to promote splicing, so that there is no residue of exon and scar sequence, and can effectively avoid the structural change or increase in immunogenicity of the circular RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] This specification will be further described by way of exemplary embodiments, and these exemplary embodiments will be described in detail through the drawings. These embodiments are not restrictive. In these embodiments, the same numbers represent the same structures, where:

[0014] Figure 1 is a schematic sequence of the T7 promoter, SP6 promoter, and T3 promoter shown in some embodiments of the present specification;

[0015] Figure 2 is a schematic diagram of the full-length secondary structure of wild-type Tetrahymena thermophila group I intron RNA shown in some embodiments of the present specification;

[0016] Figure 3Schematic diagram of the secondary structure of the reverse sequence of mmu_circ_0001254 as shown in some embodiments of this specification;

[0017] Figure 4 Schematic diagram of the secondary structure of the mmu_circ_0001254 sequence after artificial design of the linker as shown in some embodiments of this specification;

[0018] Figure 5 Schematic diagram of the linker design of mmu_circ_0001254 as shown in some embodiments of this specification;

[0019] Figure 6 Schematic diagram of a DNA molecule containing an artificially designed Thermus thermophilus group I intron for forming circular RNA as shown in some embodiments of this specification;

[0020] Figure 7 Schematic diagram of the secondary structure of linear RNA transcribed from a DNA molecule as shown in some embodiments of this specification;

[0021] Figure 8 Gel electrophoresis result diagram of the RNase R tolerance verification of the circularized product as shown in some embodiments of this specification;

[0022] Figure 9 Gel electrophoresis result diagram of the RT-PCR verification of the circularized product as shown in some embodiments of this specification;

[0023] Figure 10 Schematic diagram of the linker sequencing as shown in some embodiments of this specification;

[0024] Figure 11 Gel electrophoresis result diagram of the RNase R tolerance verification of the Cy5-UTP labeled circularized product as shown in some embodiments of this specification;

[0025] Figure 12 Schematic diagram of the secondary structure of the mmu_circ_0007509 sequence and the mmu_circ_0007509 sequence designed by linker schemes 1 and 2 as shown in some embodiments of this specification;

[0026] Figure 13 Schematic diagram of the circularization framework formed by the combination of Anabaena group I introns as shown in some embodiments of this specification;

[0027] Figure 14 Gel electrophoresis result diagram of the circularized product of the mmu_circ_0007509 linker scheme as shown in some embodiments of this specification;

[0028] Figure 15 Gel electrophoresis results of the circularized products incorporated with 0.1% and 5% Cy5-UTP as shown in some embodiments of this specification;

[0029] Figure 16 Gel electrophoresis results of the verification of RNase R tolerance of the Cy5-UTP-labeled circularized products as shown in some embodiments of this specification;

[0030] Figure 17 Schematic diagram of the circularization framework of two adapter sequence selection methods of CVB3-GFP based on Anabaena type I intron as shown in some embodiments of this specification;

[0031] Figure 18 Schematic diagram of the circularization framework of two adapter methods designed on the IRES of CVB3 as shown in some embodiments of this specification; and

[0032] Figure 19 Gel electrophoresis results of the verification of the circularized products generated from the circCVB3-GFP-pure-01 and circCVB3-GFP-pure-02 plasmids as shown in some embodiments of this specification. Detailed implementation manners

[0033] To more clearly illustrate the technical solutions of the embodiments of this specification, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some examples or embodiments of this specification. For those of ordinary skill in the art, without creative efforts, this specification can also be applied to other similar scenarios based on these drawings. Unless obvious from the language context or otherwise stated, the same reference numerals in the drawings represent the same structure or operation.

[0034] As shown in this specification and the claims, unless the context clearly indicates an exception, words such as "a", "an", "one" and / or "the" are not specifically singular and may also include the plural. Generally speaking, the terms "comprising" and "including" only indicate the inclusion of the clearly identified steps and elements, and these steps and elements do not constitute an exclusive list. For example, the method may also include other steps.

[0035] Circular RNA is a type of single-stranded closed RNA molecule, which is produced by alternative splicing (AS, Alternative Splicing, exon cyclization or intron cyclization) of mRNA precursor. Endogenous circular RNA includes coding or non-coding RNA, does not contain a 5' cap structure (Cap) and a 3' poly A tail, lacks free ends, and is therefore not easily degraded by nuclease exonucleases, and is more stable than linear RNA. In-depth research on circular RNA is inseparable from the in vitro preparation of circular RNA to further verify its biological function, among which the in vitro cyclization method is an important process.

[0036] With linear RNA as a precursor, the common method for synthesizing circular RNA in vitro is to connect the ends of two exons based on chemical connection, enzymatic connection or ribozyme splicing to form a covalently closed circular structure. However, this method will additionally retain a certain exon joint, and a scar sequence will be formed after cyclization. The residual scar sequence is generally believed to increase immunogenicity or relatively change the secondary structure of the target circular RNA, thereby affecting its physiological function. The present specification embodiment provides a circular RNA with no exon and scar sequence residues (also referred to as no sequence residues or no residual sequences), which only contains RNA corresponding to the target fragment (e.g., a DNA fragment encoding a target protein), which can effectively avoid structural changes or increases in immunogenicity of the target circular RNA. Specifically, based on the recognition characteristics of type I intron ribozymes, on the basis of not changing the sequence of the target fragment, the necessary conditions for ribozyme recognition and shearing (or splicing) are achieved by screening a suitable joint sequence in the target sequence to avoid the additional use of wild-type exon residues at both ends of the intron known to promote shearing, thereby using biological methods to accurately synthesize circular RNA.

[0037] One of the embodiments of the present specification provides a DNA molecule for preparing circular RNA, comprising elements operably linked and arranged in the following order from 5' to 3': a promoter; a poly X fragment; a group I intron fragment; and a target fragment.

[0038] As used in this article, "promoter" is a DNA sequence that RNA polymerase recognizes, binds to and initiates transcription. It contains conserved sequences required for RNA polymerase specific binding and transcription initiation. Most of them are located upstream of the transcription start point of the structural gene. The promoter itself is not transcribed.

[0039] In some embodiments, the promoter element is one of a T7 promoter, a T3 promoter, and an SP6 promoter.

[0040] In some embodiments, to achieve circular RNAs without exon remnants, the promoter selected needs to meet the condition that the third base from the 5'-end to the 3'-end in the sequence transcribed from the transcription start site into the linear RNA in the promoter is G, that is, the +3 base is G. This sequence can be represented by nnG, where n can be any one of A, T, C, and G. Merely by way of example and not to be construed as a limitation thereto, nnG in the T7 promoter can be GGG; nnG in the T3 promoter can be GGG; nnG in the SP6 promoter can be GAG.

[0041] Figure 1 Schematic sequences of the T7 promoter, the SP6 promoter, and the T3 promoter are shown. As Figure 1 shown, the +1 base (i.e., the first n) is the transcription start site, and the sequence transcribed from the transcription start site into the linear RNA is the sequence formed by the +1 base to the +3 base (i.e., the last G) (i.e., the transcription start sequence). These sequences will be transcribed to the 5'-end of the linear RNA during transcription, while the promoter sequences before these sequences will not be transcribed. It should be noted that Figure 1 the promoter sequences shown in

[0042] As used herein, a "poly X fragment" refers to a nucleic acid sequence composed of a preset number of identical consecutive bases X. Wherein, X represents any one of A, T, C, and G. The poly X fragment is located between the promoter and the intron fragment. In some embodiments, the poly X fragment contains 5 - 80 identical consecutive bases. In some embodiments, the poly X fragment contains 5 - 70 identical consecutive bases. In some embodiments, the poly X fragment contains 5 - 60 identical consecutive bases. In some embodiments, the poly X fragment contains 15 - 50 identical consecutive bases. In some embodiments, the poly X fragment contains 15 - 35 identical consecutive bases. In some embodiments, the poly X fragment is a poly A fragment.

[0043] The structure (nnG) where the last base near the 3'-end in the sequence transcribed from the transcription start site in the promoter into the RNA is G, in combination with the poly X fragment structure, can form a highly universal internal guiding sequence (IGS), thereby promoting splicing.

[0044] As used herein, Group I Intron is a type of intron (ribozyme) that can undergo self-splicing reactions. Such introns can form 9 core specific secondary structures formed by base pairing after transcription, which are named P1 to P9 domains respectively. Group I Introns have the ability to catalyze splicing reactions in the presence of GTP and Mg 2+A self-splicing system that undergoes self-cleavage (or self-splicing, self-cleavage) to form a loop in the presence of a certain condition. In the self-splicing reaction, a guanosine nucleoside (containing a free 3'-OH), G-OH, is required. G first binds to the 5' end of the intron. When the linear intron becomes circular, its 3' end can be more than 15 nucleotides away from the 5' end, thereby excising the original 5' end and a segment of 15 bases (or more) (including G). This self-splicing is catalyzed by the activity of an endonuclease with a specific RNA sequence.

[0045] In some embodiments, group I introns include multiple types, such as IC1, IC2, IC3, IA2, etc. Exemplarily, group I introns of the IC1 type include, but are not limited to, introns from Tetrahymena sp., Pneumocystis sp., Neurospora sp. (e.g., Neurospora crassa). In some embodiments, group I introns include, but are not limited to, introns from Tetrahymena thermophile, T. cosmopolitanis, T. hyperangularis, T. malaccensis, T. pigmentosa. In some embodiments, the group I intron can be the Tetrahymena thermophila group I intron. Group I introns of the IC3 type include, but are not limited to, one or more group I introns from Anabaena sp., Azoarcus sp., Glaucophyte sp., Synechococcus sp., Prochlorothrix sp. In some embodiments, group I introns of the IC3 type can include introns from Anabaena sp. PCC7120, Anabaena variabilis ATCC 29413, Azoarcus sp. BH72, Cyanophora paradoxa, Synechococcus sp. PCC 6301, Prochlorothrix hollandica. In some embodiments, the group I intron can be the Anabaena group I intron. In some embodiments, group I introns of the IC3 type can also be from group I introns of Zea mays or Nicotiana tabacum.

[0046] The group I intron used in the present invention consists of the P2 to P9 domains of the wild-type intron. For the introns of IC1 type and IC3 type, the nnG sequence and a part of the poly X sequence (e.g., the first 2-7 bases) (such as poly A) form a new universal and strong IGS, namely NNNNNNG (where N represents any one of A, T, C, G), which can then form an artificial P1 domain with the 3'-end nnnnnu of the transcription product (where n represents any one of A, U, C, G). It should be noted that NNNNNNG and nnnnnu are only used to illustrate and describe the principle of the present invention, and do not limit the length of the sequence, and it can be any length that can implement the technical solution of the present invention in the art.

[0047] As used herein, "target fragment" refers to a DNA sequence or non-coding sequence containing an encoding function. In some embodiments, the target fragment is a target DNA sequence encoding a target peptide. In some embodiments, the target peptide is a target protein. The target protein refers to a specific protein molecule that is of interest, studied, analyzed, or processed. In some embodiments, the target fragment is an open reading frame encoding a protein (such as green fluorescent protein). In some embodiments, the target fragment is an open reading frame with a length less than 5 kb. In some embodiments, the target fragment is an open reading frame with a length less than 3 kb. In some embodiments, the target fragment is an open reading frame with a length less than 2 kb. In some embodiments, the non-coding sequence is a natural circular RNA sequence in cells.

[0048] To promote the circularization of linear RNA cleavage and form circular RNA without residue, the adapter sequence of the target fragment is selected based on the characteristic that the group I intron recognizes the recognition site of the adjacent exon sequence. The adapter sequence is located on the target fragment and is used to ligate and circularize after the self-cleavage of the group I intron during the formation of circular RNA. Specifically, the DNA molecule includes a first adapter sequence and a second adapter sequence. The first adapter sequence is located at the 3'-end of the target fragment, and the second adapter sequence is located at the 5'-end of the target fragment. In this way, after cutting off the group I intron, the circular RNA only contains the RNA corresponding to the target fragment.

[0049] To achieve circular RNAs without exon residues and ensure the self-splicing function of group I introns, the selection of adapter sequences needs to meet certain criteria. Specifically, for all group I introns, the first adapter sequence needs to meet the following criteria: the last nucleotide of the RNA corresponding to the first adapter sequence is U, to form a G·U wobble pairing with the third base G near the 3' end in the sequence transcribed from the transcription start site into RNA. The formation process of circular RNAs involves specific splicing events, and these splicing events include self-splicing mediated by group I intron ribozymes. During the self-splicing process based on group I introns, G·U wobble pairing plays a key role, helping to accurately identify the 5' splice site. Its stable formation of the P1 domain also provides the necessary structural features for the occurrence of 3' splicing, and then can help the spliceosome to recognize and accurately connect to the splice site (or cleavage site), promoting the occurrence of self-splicing.

[0050] For different classes of group I introns, there can be other selection criteria for the first and second adapter sequences. For group I introns of the IC1 type, optionally, the selection criteria for the first adapter sequence further include: the percentage of the number of A and U in the RNA sequence corresponding to the first adapter sequence in the total number of bases of the first adapter sequence is greater than a first preset value. The first preset value can be 30%, 40%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, etc. The more enriched the nucleotides A and U in the RNA corresponding to the first adapter sequence are selected, the higher the cleavage efficiency is. It should be noted that this condition is not a mandatory option, and there may also be no base A in the first adapter sequence. For group I introns of the IC3 type, the selection criteria for the first and second adapter sequences further include: the RNAs corresponding to the first adapter sequence and the second adapter sequence form a complementary structure, and at least 2 base pairs in the complementary structure are completely complementary. In some embodiments, 2-4, 3-5, 4-9, 6-12, 8-12, 2-12 base pairs in the complementary structure formed by the RNAs corresponding to the first adapter sequence and the second adapter sequence are completely complementary. In some embodiments, 8-10 base pairs in the complementary structure formed by the RNAs corresponding to the first adapter sequence and the second adapter sequence are completely complementary. The more complementary bases in the complementary structure, the higher the cleavage efficiency. In some embodiments, 10 base pairs in the complementary structure formed by the RNAs corresponding to the first adapter sequence and the second adapter sequence are completely complementary.

[0051] In some embodiments, the target fragment includes a translation initiation element, and the translation initiation element includes: an IRES sequence, a 5' UTR sequence, a Kozak sequence, a sequence containing m 6 A modification, a complementary sequence of ribosomal 18S rRNA, or one or more of them.

[0052] A translation initiation element refers to any sequence element that can recruit ribosomes and initiate the translation process of an RNA molecule. In some embodiments, the translation initiation element can also be any other type of element with cap-independent translation.

[0053] In some embodiments, the translation initiation element can be an IRES sequence. An IRES sequence refers to an internal ribosome entry site (IRES) sequence, where the IRES sequence is transcribed into an RNA molecule that can recruit ribosomes for a translation reaction to obtain a target peptide.

[0054] In some embodiments, the IRES sequence is selected from: Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Forman poliovirus 1, Pseudoplusia includens virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, Homalodisca coagulata virus-1, Himetobi P virus (HiPV), Hepatitis C virus, Hepatitis A virus, Hepatitis G virus, Foot-and-mouth disease virus, Human enterovirus 71, Equine rhinovirus, Ectropis obliqua-like virus, Encephalomyocarditis virus (EMCV), Drosophila C virus, Tobacco mosaic virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black queen cell virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AMLl / RUNXl, Drosophila Antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1α, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Saliva virus, Coxsackievirus, Echovirus, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, Human c-src, Human FGF-1, Picornavirus, Turnip crinkle virus, Aptamer of eIF4G, Coxsackievirus B1 (CVB1), Coxsackievirus B2 (CVB2) or Coxsackievirus B3 (CVB3).

[0055] In some embodiments, the IRES sequence is selected from Coxsackievirus B3 (CVB3).

[0056] In some embodiments, the translation initiation element may be a 5'UTR sequence. The 5'UTR sequence refers to the 5' untranslated region sequence.

[0057] In some embodiments, the translation initiation element may be a Kozak sequence. The Kozak sequence is a nucleic acid sequence located behind the 5' cap structure of eukaryotic mRNA, which can bind to translation initiation factors and mediate the translation initiation of mRNA containing the 5' cap structure.

[0058] In some embodiments, the translation initiation element may be a sequence containing m 6 A modification. The sequence containing m 6 A modification refers to a sequence containing m 6 A (N6-methyladenine) modification.

[0059] In some embodiments, the translation initiation element may be a complementary sequence of ribosomal 18S rRNA. The complementary sequence of ribosomal 18S rRNA refers to the corresponding sequence formed by the base sequence on 18S rRNA according to the base complementary pairing principle (A is complementary to T, C is complementary to G).

[0060] In some embodiments, the target fragment contains at least one open reading frame, and each open reading frame independently encodes a target peptide of any type. The circular RNA can tandemly encode one or more (e.g., 1-10) target polypeptides. Exemplarily, the circular RNA expresses 1, 2, 3, 4, 5, 10, etc. target polypeptides.

[0061] In linear DNA, the first and second linker sequences can be selected from the open reading frames in the target fragment or the sequences of the translation initiation elements. In some embodiments, when the first and second linker sequences are located on the open reading frame, the translation initiation element separates the target fragment into a first open reading frame and a second open reading frame in the 5' to 3' direction. The first linker sequence is located at the 3' end of the second open reading frame, and the second linker sequence is located at the 5' end of the first open reading frame. That is to say, in this case, the arrangement order of each element from the 5' end to the 3' end is promoter, poly X, type I intron, first open reading frame, translation initiation element, second open reading frame.

[0062] In some embodiments, when the first and second linker sequences are located on the translation initiation element, the open reading frame divides the translation initiation element into a first translation initiation element and a second translation initiation element in the 5' to 3' direction, the first linker sequence is located at the 3' end of the second translation initiation element, and the second linker sequence is located at the 5' end of the first translation initiation element. That is, in this case, in the order from the 5' end to the 3' end, the arrangement order of each element is promoter, poly X, type I intron, first translation initiation element, open reading frame, second translation initiation element.

[0063] In an in vitro transcription reaction, the linear RNA transcribed from a DNA molecule can undergo a one-step transesterification reaction under the action of a type I intron ribozyme, initiate cleavage at the splicing site, so that the linear RNA transcribed from the linear DNA molecule is configured to self-cyclize to produce a circular RNA, and the circular RNA only contains the RNA corresponding to the target fragment, and has the characteristics of high efficiency, low cost, no extra sequence residue and stability.

[0064] As used herein, "linear RNA" refers to a circular RNA precursor that can form a circular RNA through a cyclization reaction, and it is generally transcribed from a linear DNA molecule. More content about the one-step transesterification reaction and the formation of circular RNA can be referred to the following description.

[0065] In the embodiments of the present specification, in order to effectively promote RNA circularization, a promoter, a poly X structure, a type I intron, and a target fragment designed with linkers (a first linker sequence and a second linker sequence) are combined to form a circularization framework (that is, a DNA molecule), and a DNA molecule capable of preparing circular RNA is provided. The last nucleotide of the first linker sequence of the DNA molecule is T, so that the last nucleotide U at the 3' end of the linear RNA transcribed from the DNA molecule forms a G·U wobble pair with the last base G near the 3' end in the sequence transcribed from the transcription start site in the promoter. At the same time, the generally applicable and strong IGS, that is, NNNNNG, is utilized, and then an artificial P1 domain can be formed with the 3' end nnnnnu of most transcription products, so that the linear RNA is configured to self-cyclize to produce a stable circular RNA without extra sequence residue. Among them, the cleavage site is located between the 3' end of the RNA fragment transcribed from the type I intron fragment and the RNA fragment corresponding to the second linker sequence. In addition, the more stable the artificial P1 domain is, the higher the cleavage efficiency is; the more enriched the nucleotides A and U in the RNA corresponding to the first linker sequence are selected, the higher the cleavage efficiency is. By designing linker sequences at the ends of the target fragment to replace exons, so that the ribozyme can be recognized, thus there is no need to introduce extra exon sequences in the DNA molecule, and then these extra exon sequences are excluded in the circular RNA, improving the sequence accuracy of the circular RNA molecule.

[0066] In this specification, the recognition characteristics and cyclization principles of different type I intron ribozymes are analyzed. For different type I intron ribozymes, different methods are used to artificially set up recognition sequences to achieve cleavage cyclization, realizing the advantage of no residual exon sequences.

[0067] One embodiment of this specification provides a recombinant expression vector, including the DNA molecule as described above.

[0068] As used herein, a "vector" refers to a tool for carrying, replicating, and expressing exogenous DNA molecules or RNA molecules. In the context of transcription herein, a vector refers to a molecule used to carry an exogenous DNA fragment and perform a transcription reaction in a cell to produce RNA.

[0069] Vectors are usually circular DNA molecules, such as plasmids or viruses (e.g., adenoviruses, adeno-associated viruses, etc.), cosmids, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), etc. These vectors have the ability to self-replicate, can independently replicate in cells, and can also carry exogenous genes, such as protein-coding genes, RNA genes, etc.

[0070] In some embodiments, the vector backbone of the recombinant expression vector includes, but is not limited to, plasmid vectors, eukaryotic cell expression vectors, lentiviral vectors, adenoviral vectors, or adeno-associated viral vectors.

[0071] In some embodiments, the vector can be designed to contain specific promoters, regulatory elements, and terminators, so that the carried exogenous DNA is transcribed in cells to produce RNA. These RNA molecules can be mRNA encoding proteins or other non-coding RNAs.

[0072] In some embodiments, an in vitro transcription template can be obtained based on a vector including the DNA molecule as described above, and circular RNA is formed in an in vitro transcription reaction based on the in vitro transcription template.

[0073] The in vitro transcription template can be obtained in various ways. For example, the in vitro transcription template can be directly obtained by artificial in vitro synthesis. In some embodiments, the in vitro transcription template can be obtained by PCR amplification by constructing a plasmid, or by cutting the plasmid with a restriction enzyme.

[0074] One embodiment of this specification provides a circular RNA prepared according to the DNA molecule as described above.

[0075] In some embodiments, one or more bases in the circular RNA are modified bases, and the modified bases are represented as X-NTP, where N is any one of the bases A, U, C, and G, and X represents a modification group. The X-NTP includes one or more of fluorescein isothiocyanate (FITC)-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-desthiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxy-NTP, 5-formyl-NTP, desthiobiotin-16-NTP, 5-carboxymethylester-NTP, 5-hydroxymethyl (hme)-NTP, N1-methylpseudo-NTP, 3'-O-methyl-NTP, 5-bromo (Br)-NTP, 2'-O-methylpseudo-NTP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thieno-NTP, 5-iodo (Iodo)-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas Red-NTP, TET-NTP, NED-NTP. In some embodiments, one base in the circular RNA can be a modified base, and it can be located at the 3' end of the linear RNA (for example, among 1-20 nt at the 3' end). In some embodiments, the modified base can be X-UTP.

[0076] The modification methods of the modifying group can be divided into random modification and site-directed modification. Random modification is usually transcriptional incorporation modification and post-transcriptional or post-cyclization modification. Transcriptional incorporation modification has been described in the examples, and chemical methods are used to link the modifying group after transcription or cyclization (such as the Mirus Label IT nucleic acid modification kit). Site-directed modification is divided into transcriptional site-directed modification and post-transcriptional site-directed modification. Transcriptional site-directed modification can adopt the Position-specific Labelling of RNA (PLOR) technology. In the present invention, post-transcriptional site-directed modification is to ligate an oligonucleotide with a modified base at the 1st position to the 3'-end (for example, 1-20 nt) before cyclization. Note: nt represents nucleotide, which is the abbreviation of nucleotide; bp represents base pair, which is the abbreviation of base pair.

[0077] In the circular RNA prepared in this specification, by ligating the modified base, the circular RNA can be coupled to other molecules (such as small molecule drugs) through the X group to achieve the treatment of diseases.

[0078] The circular RNA of the present invention does not contain extra-introduced exon sequences and contains modified bases, has high sequence accuracy, small changes in secondary structure, high biological safety and structural stability, and low immunogenicity, and is suitable for the fields of clinical disease diagnosis and treatment.

[0079] The self-splicing of the PIE system - type I intron divides the RNA intron and the auxiliary exon fragment into two parts. Among them, the 5'-end sequence of the intron is transferred to the tail of the target sequence, and the 3'-segment sequence is inserted into the front end of the target sequence. In the presence of GTP, the 3'-hydroxyl group of GTP attacks the splicing site at the 5'-end of the intron sequence. The splicing site exposes the newly generated 3'-free hydroxyl group, and the free hydroxyl group further attacks the splicing site at the 3'-end of the intron sequence to generate circular RNA, and this circular RNA will retain the exon ends.

[0080] That is to say, the splicing reaction involved in the type I intron PIE system occurs through two-step transesterification reactions and does not require energy. In the first transesterification reaction, the 3'-hydroxyl group of the cofactor guanosine or the 2'-hydroxyl group inside the intron sequence acts on the 5'-end of the intron. In the second transesterification reaction, the 3'-hydroxyl group generated at the end of the first exon acts on the splicing site between the intron and the second exon. In addition, this PIE structure will cause the self-cyclization of the sequence except for the intron, reduce the sequence accuracy of the circular RNA, increase the natural immunogenicity of the circular RNA, and is prone to degradation in cells.

[0081] The 3'-end of the RNA sequence corresponding to the target fragment transcribed by the DNA molecule of the present invention can form a hydroxyl group in an in vitro transcription reaction. The hydroxyl group can initiate splicing at the splicing site in a one-step transesterification reaction, such that the linear RNA is configured to self-cyclize to produce circular RNA. The splicing site is located between the RNA fragment transcribed from the intron fragment and the RNA corresponding to the target fragment (the second adapter) produced by the DNA molecule in the in vitro transcription reaction. It does not require generation by additional attack. Only one-step transesterification is needed to form a ring, obtaining circular RNA, reducing the cyclization step.

[0082] In some embodiments, the 3'-end of the target fragment is configured to produce a hydroxyl group in an in vitro transcription reaction. The hydroxyl group can initiate splicing at the splicing site in a one-step transesterification reaction, such that the linear RNA is configured to self-cyclize to produce circular RNA.

[0083] The examples in the specification form a cyclization framework by combining a promoter, a poly X structure, a type I intron fragment, and a target fragment (including a first adapter sequence and a second adapter sequence), providing a DNA molecule that can prepare circular RNA. Based on the linear RNA obtained from the DNA molecule, under optimized cyclization conditions, a one-step transesterification reaction can occur, generating stable circular RNA without residual additional sequences while ensuring the cyclization efficiency.

[0084] Specifically, one embodiment of the present specification provides a method for preparing circular RNA based on the DNA molecule as described above. The method includes: performing an in vitro transcription reaction to obtain linear RNA based on the DNA molecule. After transcription, a modified base X-NTP is added to the 3' end of the linear RNA by a ligation means (for example, enzymatic method, chemical synthesis method), where X in the X-NTP represents a modification group, N is any one of A, U, C, and G, and the X-NTP includes one or more of fluorescein isothiocyanate-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-desthiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxy-NTP, 5-formyl-NTP, desthiobiotin-16-NTP, 5-carboxymethyl ester-NTP, 5-hydroxymethyl-NTP, N1-methylpseudo-NTP, 3'-O-methyl-NTP, 5-bromo-NTP, 2'-O-methylpseudo-NTP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thienyl-NTP, 5-iodo-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas Red-NTP, TET-NTP, NED-NTP; and cyclizing the linear RNA to generate the circular RNA that only contains the RNA corresponding to the target fragment.

[0085] In some embodiments, the DNA molecule can be generated by in vitro synthesis.

[0086] In some embodiments, the DNA molecule can be generated in the following manner: constructing a recombinant plasmid containing the DNA molecule sequence, and using the recombinant plasmid as a template to perform PCR amplification to prepare an in vitro transcription template.

[0087] In some embodiments, the DNA molecule can be generated by digesting the recombinant plasmid with a Type II restriction endonuclease; in some embodiments, the DNA molecule can be generated by digesting the recombinant plasmid with a Type IIs restriction endonuclease.

[0088] The recombinant plasmid can be constructed by various methods. In some embodiments, the recombinant plasmid can be constructed by seamless cloning.

[0089] In some embodiments, the reaction temperature of the in vitro transcription reaction is 30°C - 50°C, and the reaction time of the in vitro transcription reaction is 0.5 - 3 h.

[0090] In some embodiments, the reaction temperature of the in vitro transcription reaction is 30°C - 40°C. In some embodiments, the reaction temperature of the in vitro transcription reaction is 40°C - 50°C. In some embodiments, the reaction temperature of the in vitro transcription reaction is 37°C, 40°C or 50°C. In some embodiments, the reaction temperature of the in vitro transcription reaction is 37°C. In some embodiments, the reaction time of the in vitro transcription reaction is 0.5 h - 3 h. In some embodiments, the reaction time of the in vitro transcription reaction is 0.75 h - 3 h. In some embodiments, the reaction time of the in vitro transcription reaction is 0.5 h, 0.75 h, 1 h, 1.5 h, 1.75 h, 2 h or 3 h. In some embodiments, the reaction time of the in vitro transcription reaction is 2 h. In some embodiments, the reaction time of the in vitro transcription reaction is 3 h.

[0091] In some embodiments, the in vitro transcription reaction includes: preparing a mixture in an in vitro transcription system to obtain the mixed mixture; performing an in vitro transcription reaction on the mixed mixture at 37°C for 2 - 3 h to obtain a reaction product.

[0092] In some embodiments, the mixture includes: a nucleotide mixture composed of ATP, CTP, GTP, and UTP, a DNA molecule, 10× transcription buffer, RNA polymerase, and nuclease-free water.

[0093] In some embodiments, ATP, CTP, GTP, and UTP can be partially or completely replaced by 1 - 4 modified NTPs (i.e., X-NTP). Specifically, X-NTP can be included in the mixture. In some embodiments, X-NTP and ATP, CTP, GTP, or UTP can exist in a certain concentration ratio (e.g., 1:4). In some embodiments, X-NTP can exist in a certain concentration ratio with ATP, CTP, GTP, and UTP. Only by way of example, X-NTP is Cy3-NTP, and the ratio of ATP, CTP, GTP, or UTP to Cy3-NTP is 4:1; or the ratio of ATP:CTP:GTP:UTP:Cy5-UTP is 2:2:2:1.9:0.1.

[0094] In the present invention, an oligonucleotide with a modified base at the 1st position is ligated to the bases of 1-20 nt at the 3'-end of the linear RNA before cyclization. In some embodiments, linear RNA of N-1 length (the (N-1)th position cannot be U) can be transcribed in vitro, and X-NTP is ligated to the 3'-end of the in vitro transcribed linear RNA of N-1 length, namely, an RNA strand with an X modification group at the 3'-end of the target length N is formed, and then a cyclization reaction is carried out to form the final target circular RNA. In some embodiments, linear RNA of N-5 length (the (N-5)th position cannot be U) can be transcribed, and then an oligonucleotide with the same sequence of the last 5 positions is chemically synthesized. Among the last 5 nucleotide sequences, for example, the 3rd position can be an X-NTP modified base and the last position is U. After ligating it to the transcribed linear RNA of N-5 length, a cyclization reaction is carried out. It should be noted that the above methods are only examples and should not be used as a limitation to the modification method.

[0095] In some embodiments, the method for preparing circular RNA further includes: treating the reaction product with DNase I enzyme at 37 °C for 20 min to remove DNA molecules.

[0096] In some embodiments, the method for preparing circular RNA further includes: purifying the circular RNA. In some embodiments, the circular RNA can be separated from the reaction product based on the principle of affinity adsorption. For example, oligo dX magnetic beads are used to obtain purified circular RNA, where: when the poly X fragment is poly A, oligo dT magnetic beads or oligo dU magnetic beads are used; when the poly X fragment is poly T, oligo dA magnetic beads are used; when the poly X fragment is poly C, oligodG magnetic beads are used; when the poly X fragment is poly G, oligo dC magnetic beads are used.

[0097] In some embodiments, the method for purifying RNA further includes using an oligo dX-coupled packing centrifugal column or chromatography column to purify the target circular RNA by the negative selection method of affinity reaction.

[0098] In this process, due to the high affinity between the polynucleotide sequence and its complementary sequence, the oligo dX magnetic beads bind to the corresponding polynucleotide sequence of the linear RNA or other RNA fragments containing poly X, and then the magnetic beads containing the linear RNA or other RNA fragments containing poly X can be separated using a magnetic field, thereby obtaining purified circularized RNA.

[0099] In some embodiments, the method for preparing RNA further includes: adding DNase I enzyme to the reaction product to remove DNA molecules; adding a chelating agent to the reaction product to remove Mg2+ ; and adding RNase R to the reaction product to digest linear RNA and further purify the circular RNA in the reaction product.

[0100] In some embodiments, the chelating agent may include EDTA or other chelating agents having a chelating Mg 2+ function.

[0101] The embodiments of the present specification have at least the following beneficial effects:

[0102] By combining a promoter, a poly X structure, a type I intron fragment, and a target fragment (including a first adapter sequence and a second adapter sequence) to form a circularization framework, a DNA molecule capable of preparing circular RNA is provided. Based on the linear RNA obtained from the DNA molecule, a linear RNA containing modified bases is obtained through a ligation means. The RNA can undergo a one-step transesterification reaction under optimized circularization conditions, generating a stable circular RNA without additional sequence residues while ensuring the circularization efficiency, reducing the change in the secondary structure of the circular RNA, thereby reducing the immunogenicity of the circular RNA and improving the stability of the circular RNA in cells. Combined with a general oligo dX affinity purification protocol, the circularization precursor with a poly X structure (i.e., the linear RNA produced by in vitro transcription) and the excised intron ribozyme can be quickly removed only by collecting the flow-through fraction, and then high-purity circular RNA can be quickly prepared. The whole process is simple and fast, and can be completed using mainstream reagents, materials, and common instruments and equipment on the market. It is especially suitable for the rapid synthesis of circular RNA with less than 2000 nucleotides, and can effectively meet the needs of the research and production of therapeutic circular RNA.

[0103] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Some of the content in these embodiments can also be replaced or combined with the corresponding content in other embodiments to form new embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The test materials used in the following embodiments are all purchased from regular biochemical reagent companies unless otherwise specified. The quantitative tests in the following embodiments are all set with three repeated experiments, and the results are averaged. It should be understood that the following embodiments are for better explaining the present invention and are not intended to limit the present invention.

[0104] Example 1: In vitro synthesis of circBase ID:mmu_circ_0001254 based on the ribozyme self-cyclization method for circular RNA synthesis

[0105] 1. Ribozyme selection

[0106] The ribozyme selects a partial sequence (P2 - P9 domain) of group I intron from Tetrahymena thermophila, NCBI ID: V01416. The DNA sequence of the group I intron of Tetrahymena thermophila is:

[0107] AAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAA AAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGAAAGTATATTGATTAGTTTTGGAGTACTCG (SEQ ID NO:1).

[0108] The corresponding RNA sequence is:

[0109] AAAAGUUAUCAGGCAUGCACCUGGUAGCUAGUCUUUAAACCAAUAGAUUGCAUCGGUU UAAAAGGCAAGACCGUCAAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUCACAGACUAAAUGUCGGUCGGGGAAGAUGUAUUCUUCUCAUAAGAUAUAGUCGGACCUCUCCUUAAUGGGAGCUAGCGGAUGAAGUGAUGCAACACUGGAGCCGCUGGGAACUAAUUUGUAUGCGAAAGUAUAUUGAUUAGUUUUGGAGUACUCG(SEQ ID NO:2).

[0110] The full-length RNA secondary structure of the wild-type Tetrahymena thermophila Group I intron is as Figure 2 shown.

[0111] 2. Adaptor design

[0112] The sequence of mmu_circ_0001254 (corresponding transcript NCBI ID: NM_001159630) is (*indicating the junction): TCCUACACACCUCCAAGUAAUGAGUUCAAGAUCAGCAUGAAAUUGGAAGCACAGGAUCCCAGGAACACCACAUCCACCUGUAUUGCCACGGUCGUUGGAUUGACAGGUGCCCGACUUCGUCUGCGCCUUGAUGGCAGUGACAACAAGAAUGACUUCUGGAGACUGGUUGACUCCUCUGAAAUCCAGCCAAUUGGAAACUGUGAGAAGAAUGGCGGGAUGCUGCAGCCCCCUCUAGGAUUUCGGCUGAAUGCCUCCUCUUGGCCCAUGUUCCUUUUGAAGACACUAAAUGGAGCAGAGAUGGCUCCCAUCAAGAUUUUCCAUAAGGAGCCACCAUCACCUUCCCACAACUUCUUCAAAAUGGGAAUGAAGUUAGAAGCUGUAGACAGAAAGAACCCUCAUUUCAUUUGCCCAGCCACUAUUGGAGAAGUUCGAGGCGCAGAAGUGCUAGUCACCUUUGAUGGGUGGCGAGGCGCAUUUGACUACUGGUGCCGCUUUGACUCCCGGGACAUCUUUCCUGUGGGCUGGUGUUCUUUGACUGGAGAUAACCUGCAGCCACCUGGCACCAAAG*(SEQ ID NO:3).

[0113] The reverse sequence of the circular RNA is the same as the forward sequence. To facilitate further analysis of its sequence and secondary structure characteristics, the above sequence needs to be modified to the reverse sequence and artificial junction sites are designed.

[0114] The reverse sequence of mmu_circ_0001254 is:

[0115] GAAACCACGGUCCACCGACGUCCAAUAGAGGUCAGUUUCUUGUGGUCGGGUGUCCUUUCUACAG

[0116] GGCCCUCAGUUUCGCCGUGGUCAUCAGUUUACGCGGAGCGGUGGGUAGUUUCCACUGAUCGUGA

[0117] AGACGCGGAGCUUGAAGAGGUUAUCACCGACCCGUUUACUUUACUCCCAAGAAAGACAGAUGUC

[0118] GAAGAUUGAAGUAAGGGUAAAACUUCUUCAACACCCUUCCACUACCACCGAGGAAUACCUUUUA

[0119] GAACUACCCUCGGUAGAGACGAGGUAAAUCACAGAAGUUUUCCUUGUACCCGGUUCUCCUCCGU

[0120] AAGUCGGCUUUAGGAUCUCCCCCGACGUCGUAGGGCGGUAAGAAGAGUGUCAAAGGUUAACCGA

[0121] CCUAAAGUCUCCUCAGUUGGUCAGAGGUCUUCAGUAAGAACAACAGUGACGGUAGUUCCGCGUC

[0122] UGCUUCAGCCCGUGGACAGUUAGGUUGCUGGCACCGUUAUGUCCACCUACACCACAAGGACCCUAGGACACGAAGGUUAAAGUACGACUAGAACUUGAGUAAUGAACCUCCACACAUCCU(SEQ ID NO:4).

[0123] The secondary structure of the above sequence was analyzed using RNAfold (RNAfold - p - d2--noLP–circ), and the structural schematic diagram shown as Figure 3 is obtained. The positions of the natural junction sites are shown in the figure.

[0124] The mmu_circ_0001254 sequence after artificial design of the junction site (* indicates the junction, and the underlined part indicates the RNA sequence corresponding to the junction sequence):

[0125] GGCACCG UUAUGUCCACCUACACCACAAGGACCCUAGGACACGAAGGUUAAAGUACGACUAGAA

[0126] CUUGAGUAAUGAACCUCCACACAUCCUGAAACCACGGUCCACCGACGUCCAAUAGAGGUCAGUUU

[0127] CUUGUGGUCGGGUGUCCUUUCUACAGGGCCCUCAGUUUCGCCGUGGUCAUCAGUUUACGCGGAG

[0128] CGGUGGGUAGUUUCCACUGAUCGUGAAGACGCGGAGCUUGAAGAGGUUAUCACCGACCCGUUUA

[0129] CUUUACUCCCAAGAAAGACAGAUGUCGAAGAUUGAAGUAAGGGUAAAACUUCUUCAACACCCUU

[0130] CCACUACCACCGAGGAAUACCUUUUAGAACUACCCUCGGUAGAGACGAGGUAAAUCACAGAAGU

[0131] UUUCCUUGUACCCGGUUCUCCUCCGUAAGUCGGCUUUAGGAUCUCCCCCGACGUCGUAGGGCGGU

[0132] AAGAAGAGUGUCAAAGGUUAACCGACCUAAAGUCUCCUCAGUUGGUCAGAGGUCUUCAGUAAGAACAACAGUGACGGUAGUUCCGCGUCUGCUUCAGCCCGUGGACAGUUA GGUUGCU *(SEQ ID NO:5). Among them, the RNA sequence corresponding to the first adapter sequence is: GGUUGCU; the RNA sequence corresponding to the second adapter sequence is: GGCACCG.

[0133] The secondary structure of the above sequence was analyzed using RNAfold (RNAfold -p -d2--noLP–circ), and the structural schematic diagram shown as Figure 4 was obtained. Figure 4 The positions of the artificial adapter sites are shown. The adapter design of mmu_circ_0001254 is as Figure 5 shown.

[0134] To form a circular RNA without residue, each component was combined to form a circular framework, as Figure 6 shown. The DNA molecule from the 5' end to the 3' end is in turn: T7 promoter, poly A structure, Tetrahymena thermophila group I intron (P2 - P9 domains), target fragment designed with adapters.

[0135] Figure 7Shows the secondary structure of linear RNA transcribed from DNA molecules. Among them, the RNA corresponding to the target fragment is marked in blue, nnnnnnn schematically represents the RNA sequence corresponding to the second adapter sequence, unnnnn schematically represents the RNA sequence corresponding to the first adapter sequence, where n represents any one of the bases A, U, C, and G. The GGG at the 5' end of the linear RNA molecule represents the sequence after promoter transcription, the subsequent string of base A sequences represents the Poly A structure, and the remaining structure is the RNA transcribed from the thermophilic Tetrahymena type I intron (P2 - P9 domains).

[0136] Among them, the last base U of the RNA corresponding to the first adapter sequence forms a G·U wobble pairing with the third base G after promoter transcription, promoting the cleavage reaction of the G at the 3' end of the thermophilic Tetrahymena type I intron (i.e., Figure 7 the position indicated by the arrow in), so that the linear RNA is configured to self - circularize to produce a stable circular RNA without extra sequence residues.

[0137] 3. Prepare an in vitro transcription template

[0138] To form a residual-free circular RNA, various components are combined to form a circular framework, which from the 5'-end to the 3'-end is in sequence: T7 promoter, poly A structure, Tetrahymena thermophila group I intron fragment, circRNA mmu_circ_0001254 designed with adaptors. The whole sequence is: TAATACGACTCACTATAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTTAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGGGCACCGTTATGTCCACCTACACCACAAGGACCCTAGGACACGAAGGTTAAAGTACGACTAGAACTTGAGTAATGAACCTCCACACATCCTGAAACCACGGTCCACCGACGTCCAATAGAGGTCAGTTTCTTGTGGTCGGGTGTCCTTTCTACAGGGCCCTCAGTTTCGCCGTGGTCATCAGTTTACGCGGAGCGGTGGGTAGTTTCCACTGATCGTGAAGACGCGGAGCTTGAAGAGGTTATCACCGACCCGTTTACTTTACTCCCAAGAAAGACAGATGTCGAAGATTGAAGTAAGGGTAAAACTTCTTCAACACCCTTCCACTACCACCGAGGAATACCTTTTAGAACTACCCTCGGTAGAGACGAGGTAAATCACAGAAGTTTTCCTTGTACCCGGTTCTCCTCCGTAAGTCGGCTTTAGGATCTCCCCCGACGTCGTAGGGCGGTAAGAAGAGTGTCAAAGGTTAACCGACCTAAAGTCTCCTCAGTTGGTCAGAGGTCTTCAGTAAGAACAACAGTGACGGTAGTTCCGCGTCTGCTTCAGCCCGTGGACAGTTAGGTTGCT(SEQ ID NO:6).

[0139] Synthesize the above sequences and construct a recombinant plasmid. Use the recombinant plasmid as a template for PCR amplification to prepare an in vitro transcription template (IVT template) containing the T7 promoter sequence. Aliquot 150 μL of the PCR reaction mixture into 3 PCR tubes, and the PCR sample components in each tube are shown in Table 1.

[0140] Among them, the primer sequences are as follows:

[0141] Forward primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0142] Reverse primer: AGCAACCTAACTGTCCACGG (SEQ ID NO:8).

[0143] Table 1

[0144] Component 50 μL system Plasmid DNA 1 μL (10 ng / μL) F primer 2.5 μL R primer 2.5 μL 2×Magic Green Taq SuperMix 25 μL <![CDATA[ddH2O]]> 19 μL

[0145] The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min; (95°C, 15 sec; 55 - 65°C, 15 sec; 72°C, 60 sec / kb) for 35 cycles; final extension at 72°C for 5 min; end.

[0146] Use a PCR product purification and recovery kit (Aidlab#DR0202) to recover the PCR product. The specific steps are as follows:

[0147] (1) Column equilibration: Add 100 μl of equilibration buffer to the adsorption column EC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and set aside;

[0148] (2) Pipette 750 μL of binding buffer BB into a 1.5 mL EP tube, pipette 150 μL of the PCR product into the binding buffer, and vortex to mix evenly;

[0149] (3) Transfer all the mixture in step (2) to the adsorption column EC, incubate at room temperature for 1 min, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the filtrate;

[0150] (4) Add 600 μL of wash buffer to the adsorption column EC, centrifuge at 12,000 rpm for 30 s, discard the filtrate, and repeat the washing once;

[0151] (5) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min to remove ethanol residues;

[0152] (6) Transfer the adsorption column EC to a new EP tube, add 55 μL of elution buffer to the EC column, and incubate at room temperature for 2 min;

[0153] Centrifuge at 12,000 rpm for 1 min and discard the filtrate collected by the adsorption column.

[0154] Take 1 μL and measure the DNA concentration using BioDrop.

[0155] Verify the band using 1% agarose gel electrophoresis.

[0156] The PCR product sequence is as follows:

[0157]

[0158] 4. In Vitro Transcription Reaction

[0159] Using the in vitro transcription template obtained in the above steps as a substrate, perform an in vitro transcription reaction using the Yeasen in vitro transcription kit (T7 HighYield RNA Synthesis Kit, 10623ES50).

[0160] (1) Add the components required for the in vitro transcription reaction to an EP tube as shown in Table 2.

[0161] Table 2

[0162] Component 20 μL system <![CDATA[Enzyme-free H2O]]> 6 μL 10×transcription buffer 2 μL ATP 100 mM 2 μL UTP 100 mM 2 μL CTP 100 mM 2 μL GTP 100 mM 2 μL Template DNA 2 μL T7 enzyme mix 2 μL

[0163] (2) After mixing the above components evenly, incubate in a 37 °C incubator for 3 h.

[0164] (3) Subsequently, add 2 μL of DNase I to the tube. After mixing evenly with a pipette tip, incubate in a 37 °C incubator for 20 min.

[0165] (4) Add LiCl with a final concentration of 2.5 M, mix well, and incubate at -20 °C for 30 min to precipitate RNA.

[0166] (5) Centrifuge at 12000 rpm at 4 °C for 15 min. After removing the supernatant, add 600 μL of 75% ethanol to wash the precipitate. Thoroughly remove the ethanol at 12000 rpm at 4 °C, air dry at room temperature for 5 min, add 200 μL of enzyme-free water to dissolve the RNA, and then measure the concentration using a micro-spectrophotometer.

[0167] The linear RNA sequence transcribed in vitro by T7 RNA polymerase is as follows:

[0168] GGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUAAUUGAGCCUUAAAGAAGAAAUUCUUUAAGUGGAUGCUCUCAAACUCAGGGAAACCUAAAUCUAGUUAUAGACAAGGCAAUCCUGAGCCAAGCCGAAGUAGUAAUUAGUAAGUUAACAAUAGAUGACUUACAACUAAUCGGAAGGUGCAGAGACUCGACGGGAGCUACCCUAACGUCAAGACGAGGGUAAAGAGAGAGUCCAAUUCUCAAAGCCAAUAGGCAGUAGCGAAAGCUGCAAGAGAAUGGGCACCGUUAUGUCCACCUACACCACAAGGACCCUAGGACACGAAGGUUAAAGUACGACUAGAACUUGAGUAAUGAACCUCCACACAUCCUGAAACCACGGUCCACCGACGUCCAAUAGAGGUCAGUUUCUUGUGGUCGGGUGUCCUUUCUACAGGGCCCUCAGUUUCGCCGUGGUCAUCAGUUUACGCGGAGCGGUGGGUAGUUUCCACUGAUCGUGAAGACGCGGAGCUUGAAGAGGUUAUCACCGACCCGUUUACUUUACUCCCAAGAAAGACAGAUGUCGAAGAUUGAAGUAAGGGUAAAACUUCUUCAACACCCUUCCACUACCACCGAGGAAUACCUUUUAGAACUACCCUCGGUAGAGACGAGGUAAAUCACAGAAGUUUUCCUUGUACCCGGUUCUCCUCCGUAAGUCGGCUUUAGGAUCUCCCCCGACGUCGUAGGGCGGUAAGAAGAGUGUCAAAGGUUAACCGACCUAAAGUCUCCUCAGUUGGUCAGAGGUCUUCAGUAAGAACAACAGUGACGGUAGUUCCGCGUCUGCUUCAGCCCGUGGACAGUUAGGUUGCU(SEQ ID NO:10).

[0169] 5. Cyclization reaction

[0170] (1) Transfer the in vitro transcription product digested with DNase I enzyme to a 1.5 mL EP tube containing 8 volumes of enzyme-free water and 1 volume of 10× circularization buffer. Vortex and mix well, then centrifuge for a few seconds. Incubate the reaction tube in a 55°C metal bath for 15 min.

[0171] (2) Take out the reaction tube, add 12 μL of 0.5 M EDTA to it and mix well to terminate the reaction.

[0172] (3) Add LiCl with a final concentration of 2.5 M, mix well, and incubate at -20°C for 30 min to precipitate RNA.

[0173] (4) Centrifuge at 12,000 rpm at 4°C for 15 min. After removing the supernatant, add 600 μL of 75% ethanol to wash the precipitate, and thoroughly remove the ethanol at 12,000 rpm at 4°C, then air-dry at room temperature for 5 min.

[0174] The thermophilic Tetrahymena group I intron sequence generated by self-cleavage is:

[0175] GGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUAAUUGAGCCUUAAAGAAGAAAUUCUUUAAGUGGAUGCUCUCAAACUCAGGGAAACCUAAAUCUAGUUAUAGACAAGGCAAUCCUGAGCCAAGCCGAAGUAGUAAUUAGUAAGUUAACAAUAGAUGACUUACAACUAAUCGGAAGGUGCAGAGACUCGACGGGAGCUACCCUAACGUCAAGACGAGGGUAAAGAGAGAGUCCAAUUCUCAAAGCCAAUAGGCAGUAGCGAAAGCUGCAAGAGAAUG(SEQ IDNO:11).

[0176] 6. Verification of RNase R tolerance

[0177] Take 30 μg of the circularized product after ethanol precipitation, add 1 μL of RNase R, 10 μL of 10x buffer, and make up to 100 μL with enzyme-free water. Place it in a 37°C metal bath and react for 20 min. Then use an RNA purification and concentration kit (TR115, Jianshi Biotech) to purify RNA. The specific steps are as follows:

[0178] (1) Add 200 μL of binding solution to the sample, mix well, and then add 300 μL of absolute ethanol and mix thoroughly.

[0179] (2) Add the above-mentioned mixed solution into a purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate.

[0180] (3) Add 400 μL of RNA pre-washing solution to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate.

[0181] (4) Add 700 μL of RNA washing solution to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate.

[0182] (5) Add 400 μL of RNA washing solution to the purification column, centrifuge at 12,000 rpm for 2 min.

[0183] (6) Take out the purification column, place it in a new 1.5 mL EP tube, add 20 μL of preheated enzyme-free water to the column membrane, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and collect the filtrate.

[0184] (7) After detecting the concentration using Biodrop, detect the bands using 2% agarose gel electrophoresis.

[0185] (8) Prepare a 2% agarose 0.5×TBE gel, take 1 μg of the sample, add 5 μL of 2×RNA loading buffer, make up to 10 μL with enzyme-free water, mix well, incubate in a metal bath at 70 °C for 5 min, place on ice for 1 - 3 min, and then add it to the sample well.

[0186] (9) After electrophoresis at 100 V for 75 min, take out the gel block and take a photo with a gel imager. The electrophoresis results are as Figure 8 shown.

[0187] 7. RT-PCR Verification of the Adapter Sequence

[0188] The primer pair is a specific primer designed for the adapter (also known as the trans-cyclization site primer). If there are RNA molecules circularized at the designed adapter site, after reverse transcription, cDNA containing the adapter sequence that can be detected by this primer pair can be obtained.

[0189] (1) Take 700 ng of the product digested by RNase R, and prepare cDNA using a reverse transcription kit (Aidlab PC5401 TRUEscript RT Kit (+gDNA Eraser)).

[0190] (2) Thaw the template RNA and 5×TRUE RT MasterMix on ice; thaw the 4×gDNA Eraser Mix and RNase free H2O at room temperature (15 - 25°C), and immediately place them on ice after thawing. Before use, flick or gently vortex each solution to mix well, and briefly centrifuge to collect the liquid remaining on the tube wall to the bottom of the tube.

[0191] (3) Add the following components to the RNase free H2O tube (it is recommended to prepare on ice using a PCR tube):

[0192] Table 3

[0193] Component 16 μL system Total RNA / mRNA ≤12 μl* 4×gDNA Eraser Mix 4 μl <![CDATA[RNase free H2O]]> Make up to 16 μl

[0194] (4) Gently pipette to mix well, and incubate at 42°C for 2 min (or at 37°C for 5 min). It is recommended to perform the temperature control steps on a PCR instrument.

[0195] (5) Continue to directly add 4 μl of 5×TRUE RT MasterMix to the same tube, gently pipette to mix well (total volume 20 μl), and then place it in the PCR instrument.

[0196] (6) The PCR program is: incubate at 25°C for 10 min; incubate at 42°C for 20 min; 85°C for 5 s; end.

[0197] (7) Verify using primer PCR. Dilute the cDNA 10 - fold and take 2 μL as the PCR template, and use Pfu enzyme for 50 μL PCR electrophoresis to detect the results.

[0198] Among them, the upstream primer sequence used is GTCTCCTCAGTTGGTCAGAGG (SEQ ID NO:12), and the downstream primer sequence is CTATTGGACGTCGGTGGACC (SEQ ID NO:13).

[0199] The electrophoresis detection results are as Figure 9 shown.

[0200] 8. Verify the adapter by sequencing

[0201] Use a PCR product purification and recovery kit (Aidlab#DR0202) to recover the PCR product, and adopt TOPO vector cloning (Aidlab CV17 - Zero Background pTOPO - Blunt Simple Cloning Kit). The specific steps for verifying the adapter by sequencing are as follows:

[0202] (1) At room temperature, prepare the reaction mixture according to the system in Table 4:

[0203] Table 4

[0204] Component 16 μL system PCR product (20 ng / μL) 1 μL pTOPO-Blunt Simple Vector 0.5 μl 10×Enhancer 0.5 μl Sterilized water 3 μL

[0205] Mix the above components with a pipette and react for 5 min at room temperature.

[0206] (2) Take 100 μL of DH5α competent cells and thaw them on ice. Add 5 μL of the reaction mixture, mix gently, and leave at room temperature for 5 min.

[0207] (3) After heat shock in a metal bath at 42 °C for 70 s, add 500 μL of LB medium and incubate with shaking at 37 °C and 200 rpm for 10 min.

[0208] (4) Take 200 μL of the bacterial solution and spread it on an LB plate with ampicillin resistance. Incubate it upside down overnight at 37 °C, pick a single clone for culture, and use primer M13R for sequencing.

[0209] The sequencing results are analyzed as Figure 10 shown, with * indicating the junction.

[0210] 9. Affinity purification

[0211] (1) Add an equal volume of 2× Solution I to the sample at 2000 ng / μl to dilute it to 1000 ng / μl. Among them, 2× Solution I includes 20 mM Tirs-HCl, 1 M NaCl, 2 mM EDTA, and the pH value is 7.5.

[0212] (2) Add 500 μl of the packing material (affinity chromatography medium NanoGel dT20) to a centrifuge empty column tube (2 ml, 20 μm pore size sieve plate). After mixing, centrifuge and discard the filtrate.

[0213] (3) Add ultrapure water to the packing material column tube, mix well and centrifuge briefly to discard the filtrate, and repeat the washing three times. Add Solution I to the packing material, mix well and centrifuge briefly to discard the filtrate, and repeat the washing three times. Among them, Solution I includes 10 mM Tirs-HCl, 0.5 M NaCl, and 1 mM EDTA.

[0214] (4) Add the sample in step 1 to the packing material column tube (500 μL of the packing material plus 500 μg of the sample). Mix the sample and the packing material and transfer them to a new 1.5 ml centrifuge tube. (Add in multiple times until all the packing material in the adsorption column is transferred clean.)

[0215] (5) Incubate at 37 °C for 30 min. Invert and mix up and down every 10 min.

[0216] (6) Install the centrifugal packing column tube on a new 1.5 ml centrifuge tube. Add the mixed solution from step 5 to the packing column tube, and centrifuge briefly to collect the filtrate into another new 1.5 ml centrifuge tube. (Add in multiple portions to avoid the filtrate exceeding the bottom end of the packing column tube.)

[0217] (7) According to the collected filtrate, add 7.5 M LiCl to make its final concentration reach 2.8 M, and then precipitate at -20 °C for 30 min.

[0218] (8) Centrifuge at 4 °C and 12000 rpm for 15 min. Remove the supernatant and add pre-cooled 75% ethanol, and mix by inverting up and down.

[0219] (9) Centrifuge at 4 °C and 12000 rpm for 3 min. Remove the supernatant and air dry for 5 min.

[0220] (10) After dissolving with ultrapure water, detect the concentration.

[0221] (11) Use 2% agarose gel electrophoresis to detect the bands.

[0222] 10. Verification of the cleavage and cyclization of the in vitro transcription product labeled with Cy5-UTP

[0223] 10.1 In vitro transcription and cyclization with Cy5-UTP incorporation

[0224] (1) Conduct in vitro transcription according to the dosage of 5% Cy5-UTP. Add the required components for in vitro transcription to the EP tube in sequence as shown in Table 5.

[0225] Table 5

[0226]

[0227]

[0228] (2) After mixing the above components, incubate in a 37 °C incubator for 3 h.

[0229] (3) Subsequently, add 2 μL of DNase I enzyme to the reaction tube, mix with a pipette tip, and incubate in a 37 °C incubator for 20 min.

[0230] (4) Transfer the in vitro transcription product digested with DNase I enzyme to a 1.5 mL EP tube containing 8 volumes of enzyme-free water and 1 volume of 10× cyclization buffer. After vortex mixing and centrifuging for a few seconds, incubate in a 55 °C metal bath for 15 min.

[0231] (5) Take out the reaction tube, add EDTA with a final concentration of 0.15 mM and mix well to terminate the reaction.

[0232] (6) After adding LiCl with a final concentration of 2.5 M and mixing well, incubate at -20 °C for 30 min to precipitate RNA.

[0233] (7) Centrifuge at 12,000 rpm at 4 °C for 15 min. After removing the supernatant, add 600 μL of 75% ethanol to wash the precipitate. Thoroughly remove the ethanol by centrifuging at 12,000 rpm at 4 °C and then air-dry at room temperature for 5 min. Subsequently, dissolve the RNA in a certain amount of enzyme-free water and measure the concentration using a micro-spectrophotometer.

[0234] 10.2 Verification of the RNase R tolerance of the Cy5-UTP-labeled circularized product

[0235] Take 30 μg of the circularized product after ethanol precipitation, add 1 μL of RNase R and 10 μL of 10x buffer, and make up to 100 μL with enzyme-free water. React in a metal bath at 37 °C for 30 min. Subsequently, purify the RNA using an RNA purification and concentration kit (TR115, Jianshi Biotechnology). The specific steps are as follows:

[0236] (1) Add 200 μL of binding solution to the sample, mix well, and then add 300 μL of absolute ethanol and mix thoroughly.

[0237] (2) Add the above mixture to the purification column and centrifuge at 12,000 rpm at room temperature for 1 min to discard the filtrate.

[0238] (3) Add 400 μL of RNA pre-wash solution to the purification column and centrifuge at 12,000 rpm at room temperature for 1 min to discard the filtrate.

[0239] (4) Add 700 μL of RNA wash solution to the purification column and centrifuge at 12,000 rpm at room temperature for 1 min to discard the filtrate.

[0240] (5) Add 400 μL of RNA wash solution to the purification column and centrifuge at 12,000 rpm at room temperature for 2 min.

[0241] (6) Take out the purification column and place it in a new 1.5 mL EP tube. Add 20 μL of pre-warmed enzyme-free water to the column membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min to collect the filtrate.

[0242] (7) After detecting the concentration using Biodrop, detect the bands by 2% agarose gel electrophoresis. The electrophoresis results are as Figure 11 shown.

[0243] The electrophoresis results show that Cy5-circular RNA can undergo shearing and circularization, linear RNA containing Cy5-UTP can be digested by RNase R, and at the same time, Cy5-circular RNA can tolerate RNase R digestion.

[0244] Example 2: In vitro synthesis of circBase ID:mmu_circ_0007509 based on the ribozyme self-cyclization method for circular RNA synthesis

[0245] 1. Adapter design

[0246] The sequence of mmu_circ_0007509 is as follows:

[0247] TTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAAC CAGGGAGCTCAGGCTCTCAGCCGAGTGTCAGAACCACATCTTCATCTGGCAGACACACAATGCTCTGTTTATTATTTGCTGCTTGCTGAAAGTGTTCATCCGTGAGCTGTCTGAGGAAGAGCTGCAGCTTCATTTTACATATGAAGAAAAGTCCCCCGGCAGCTACAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCTTGGTACAGTTAATCACTGATACTCCACTCTT (SEQ ID NO:14).

[0248] Based on the forward sequence of the above sequence, 2 artificial adapter schemes were designed, and the sequences are shown below.

[0249] Adapter scheme 1 (* indicates the adapter position, and the underlined part indicates the adapter sequence):

[0250] ACATATGAAG AAAAGTCCCCCGGCAGCTACAGTTCTGACTCTGAAGACCTTCTGGAAGAGT TGCTCTGCAGCTTGGTACAGTTAATCACTGATACTCCACTCTTTTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCTCAGCCGAGTGTCAGAACCACATCTTCATCTGGCAGACACACAATGCTCTGTTTATTATTTGCTGCTTGCTGAAAGTGTTCATCCGTGAGCTGTCTGAGGAAGAGCTGC AGCTT CATTTT *(SEQ ID NO:15).

[0251] Among them, the first adapter sequence is: AGCTTCATTTT (SEQ ID NO:16); the second adapter sequence is: ACATATGAAG (SEQ ID NO:17).

[0252] Adapter Scheme 2 (* indicates the adapter position, and the underlined part indicates the adapter sequence):

[0253] AATCACTGATA CTCCACTCTTTTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAAC TAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCTCAGCCGAGTGTCAGAACCACATCTTCATCTGGCAGACACACAATGCTCTGTTTATTATTTGCTGCTTGCTGAAAGTGTTCATCCGTGAGCTGTCTGAGGAAGAGCTGCAGCTTCATTTTACATATGAAGAAAAGTCCCCCGGCAGCTACAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCT TGGT ACAGTT *(SEQ ID NO:18).

[0254] Among them, the first adapter sequence is: TGGTACAGTT (SEQ ID NO:19); the second adapter sequence is: AATCACTGATA (SEQ ID NO:20).

[0255] Use RNAfold to analyze the secondary structures of the mmu_circ_0007509 sequence and the mmu_circ_0007509 sequence designed with Adapter Schemes 1 and 2 (RNAfold - p - d2--noLP–circ), and obtain the structural schematic diagram as Figure 12 shown.

[0256] 2. Prepare in vitro transcription templates

[0257] To form residue - free circular RNA, combine each component to form a circular framework, which from the 5' end to the 3' end is: T7 promoter, poly A structure, Houttuynia cordata type I intron, the target sequence designed with adapters, and synthesize and place it in the pUC57 vector. The schematic diagram of the circular framework is as Figure 13 shown.

[0258] The synthetic sequence 1 for Adapter Scheme 1 is:

[0259] TAATACGACTCACTATAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTTAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGACATATGAAGAAAAGTCCCCCGGCAGCTACAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCTTGGTACAGTTAATCACTGATACTCCACTCTTTTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCTCAGCCGAGTGTCAGAACCACATCTTCATCTGGCAGACACACAATGCTCTGTTTATTATTTGCTGCTTGCTGAAAGTGTTCATCCGTGAGCTGTCTGAGGAAGAGCTGCAGCTTCATTTT(SEQ ID NO:21).

[0260] The synthetic sequence 2 for adapter scheme 2 is:

[0261] TAATACGACTCACTATAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTTAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAATCACTGATACTCCACTCTTTTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCTCAGCCGAGTGTCAGAACCACATCTTCATCTGGCAGACACACAATGCTCTGTTTATTATTTGCTGCTTGCTGAAAGTGTTCATCCGTGAGCTGTCTGAGGAAGAGCTGCAGCTTCATTTTACATATGAAGAAAAGTCCCCCGGCAGCTACAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCTTGGTACAGTT(SEQ ID NO:22).

[0262] The linear RNA sequence generated by in vitro transcription with T7 RNA polymerase is:

[0263] Adapter Scheme 1:

[0264] GGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUAAUUGAGCCUUAAAGAAGAAAU UCUUUAAGUGGAUGCUCUCAAACUCAGGGAAACCUAAAUCUAGUUAUAGACAAGGCAAUCCUGAGCCAAGCCGAAGUAGUAAUUAGUAAGUUAACAAUAGAUGACUUACAACUAAUCGGAAGGUGCAGAGACUCGACGGGAGCUACCCUAACGUCAAGACGAGGGUAAAGAGAGAGUCCAAUUCUCAAAGCCAAUAGGCAGUAGCGAAAGCUGCAAGAGAAUGACAUAUGAAGAAAAGUCCCCCGGCAGCUACAGUUCUGACUCUGAAGACCUUCUGGAAGAGUUGCUCUGCAGCUUGGUACAGUUAAUCACUGAUACUCCACUCUUUUGAAAACAACCCUCGAACAGGAAAUCUUGCUGCGCUAACUAAGGUCUUCCUAUCUAGAACCAGGGAGCUCAGGCUCUCAGCCGAGUGUCAGAACCACAUCUUCAUCUGGCAGACACACAAUGCUCUGUUUAUUAUUUGCUGCUUGCUGAAAGUGUUCAUCCGUGAGCUGUCUGAGGAAGAGCUGCAGCUUCAUUUU(SEQ ID NO:23).

[0265] Adapter Scheme 2:

[0266] GGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUAAUUGAGCCUUAAAGAAGAAAUUCUUUAAGUGGAUGCUCUCAAACUCAGGGAAACCUAAAUCUAGUUAUAGACAAGGCAAUCCUGAGCCAAGCCGAAGUAGUAAUUAGUAAGUUAACAAUAGAUGACUUACAACUAAUCGGAAGGUGCAGAGACUCGACGGGAGCUACCCUAACGUCAAGACGAGGGUAAAGAGAGAGUCCAAUUCUCAAAGCCAAUAGGCAGUAGCGAAAGCUGCAAGAGAAUGAAUCACUGAUACUCCACUCUUUUGAAAACAACCCUCGAACAGGAAAUCUUGCUGCGCUAACUAAGGUCUUCCUAUCUAGAACCAGGGAGCUCAGGCUCUCAGCCGAGUGUCAGAACCACAUCUUCAUCUGGCAGACACACAAUGCUCUGUUUAUUAUUUGCUGCUUGCUGAAAGUGUUCAUCCGUGAGCUGUCUGAGGAAGAGCUGCAGCUUCAUUUUACAUAUGAAGAAAAGUCCCCCGGCAGCUACAGUUCUGACUCUGAAGACCUUCUGGAAGAGUUGCUCUGCAGCUUGGUACAGUU(SEQ ID NO:24).

[0267] Synthesize the above sequence and construct a recombinant plasmid. Use the recombinant plasmid as a template for PCR amplification to prepare an in vitro transcription template containing the T7 promoter sequence. Aliquot 150 μL of the PCR reaction mixture into 3 PCR tubes, and the PCR sample components in each tube are shown in Table 6. Among them, the primer sequences for each protocol are as follows.

[0268] The primer sequences for Adapter Protocol 1 are as follows:

[0269] Forward primer: ATTCAGGCTGCGCAACTGTT(SEQ ID NO:7).

[0270] Reverse primer: AAAATGAAGCTGCAGCTCTTCC(SEQ ID NO:25).

[0271] The primer sequences for Adapter Protocol 2 are as follows:

[0272] F primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0273] R primer: AACTGTACCAAGCTGCAGAGC (SEQ ID NO:26).

[0274] Table 6

[0275] Component 50 μL system Plasmid DNA 1 μL (10 ng / μL) F primer 2.5 μL R primer 2.5 μL 2×Magic Green Taq SuperMix 25 μL <![CDATA[ddH2O]]> 19 μL

[0276] The PCR amplification program is as follows: pre-denaturation at 95°C for 3 min; 35 cycles of (95°C, 15 sec; 55 - 65°C, 15 sec; 72°C, 60 sec / kb); final extension at 72°C for 5 min; end.

[0277] Use a PCR product purification and recovery kit (Aidlab#DR0202) to recover the PCR product. The specific steps are as follows:

[0278] (1) Column equilibration: Add 100 μl of equilibration buffer to the adsorption column EC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and set aside.

[0279] (2) Pipette 750 μL of binding buffer BB into a 1.5 mL EP tube, pipette 150 μL of the PCR product into the binding buffer, and vortex to mix well.

[0280] (3) Transfer all of the mixture in step 2 to the adsorption column EC, incubate at room temperature for 1 min, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the filtrate.

[0281] (4) Add 600 μL of wash buffer to the adsorption column EC, centrifuge at 12,000 rpm for 30 s, discard the filtrate, and repeat the washing once.

[0282] (5) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min to remove ethanol residue.

[0283] (6) Transfer the adsorption column EC to a new EP tube, add 55 μL of elution buffer to the EC column, and incubate at room temperature for 2 min.

[0284] (7) Centrifuge at 12,000 rpm for 1 min, discard the adsorption column, and collect the filtrate.

[0285] (8) Take 1 μL and measure the DNA concentration using BioDrop.

[0286] The sequences of the PCR products are as follows:

[0287] Adapter Scheme 1:

[0288] ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCTCGCGAATGCATCTAGATGACCCAATTAATACGACTCACTATAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTTAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGACATATGAAGAAAAGTCCCCCGGCAGCTACAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCTTGGTACAGTTAATCACTGATACTCCACTCTTTTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCTCAGCCGAGTGTCAGAACCACATCTTCATCTGGCAGACACACAATGCTCTGTTTATTATTTGCTGCTTGCTGAAAGTGTTCATCCGTGAGCTGTCTGAGGAAGAGCTGCAGCTTCATTTT(SEQ IDNO:27).

[0289] Adapter Scheme 2:

[0290] ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCTCGCGAATGCATCTAGATGACCCAATTAATACGACTCACTATAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTTAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAATCACTGATACTCCACTCTTTTGAAAACAACCCTCGAACAGGAAATCTTGCTGCGCTAACTAAGGTCTTCCTATCTAGAACCAGGGAGCTCAGGCTCTCAGCCGAGTGTCAGAACCACATCTTCATCTGGCAGACACACAATGCTCTGTTTATTATTTGCTGCTTGCTGAAAGTGTTCATCCGTGAGCTGTCTGAGGAAGAGCTGCAGCTTCATTTTACATATGAAGAAAAGTCCCCCGGCAGCTACAGTTCTGACTCTGAAGACCTTCTGGAAGAGTTGCTCTGCAGCTTGGTACAGTT(SEQ ID NO:28).

[0291] 3. In vitro transcription and cyclization reaction

[0292] Using the in vitro transcription template obtained in step 2 as a substrate, perform an in vitro transcription reaction using the Yeasen in vitro transcription kit (T7 HighYield RNA Synthesis Kit, 10623ES50).

[0293] Add the components required for the in vitro transcription reaction to an EP tube, as shown in Table 7.

[0294] Table 7

[0295] Component 20 μL system <![CDATA[Enzyme-free H2O]]> 6 μL 10×transcription buffer 2 μL ATP 100 mM 2 μL UTP 100 mM 2 μL CTP 100 mM 2 μL GTP 100 mM 2 μL Template DNA 2 μL T7 enzyme mix 2 μL

[0296] After mixing the above components evenly, incubate them in an incubator at 37°C for 3 h.

[0297] Subsequently, add 2 μL of DNase I enzyme to the tube, mix evenly using a pipette tip, incubate in an incubator at 37°C for 20 min, then take a sample, and incubate the remaining reaction solution in a 50°C metal bath for 20 min for circularization.

[0298] Add LiCl with a final concentration of 2.5 M, mix well, and incubate at -20°C for 30 min to precipitate RNA.

[0299] Centrifuge at 12,000 rpm at 4°C for 15 min. After removing the supernatant, add 600 μL of 75% ethanol to wash the precipitate, thoroughly remove the ethanol by centrifuging at 12,000 rpm at 4°C, air-dry at room temperature for 5 min, add 200 μL of enzyme-free water to dissolve the RNA, and then measure the concentration using a micro-spectrophotometer.

[0300] Use 2% agarose gel electrophoresis to detect the bands. The electrophoresis results are as Figure 14 shown.

[0301] The results show that the adapter scheme 2 of mmu_circ_0007509 can efficiently generate circular RNA.

[0302] 4. Verification of RNase R tolerance

[0303] Take 30 μg of the circularized product after ethanol precipitation, add 1 μL of RNase R, 10 μL of 10x buffer, and make up to 100 μL with enzyme-free water. Place it in a 37°C metal bath for reaction for 20 min, and then purify the RNA using an RNA purification and concentration kit (TR115, Jianshi Biotechnology). The specific steps are as follows:

[0304] (1) Add 200 μL of binding solution to the sample, mix well, and then add 300 μL of absolute ethanol and mix thoroughly;

[0305] (2) Add the above mixture to the purification column, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the filtrate;

[0306] (3) Add 400 μL of RNA pre-washing solution to the purification column, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the filtrate.

[0307] (4) Add 700 μL of RNA washing solution to the purification column, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the filtrate.

[0308] (5) Add 400 μL of RNA washing solution to the purification column and centrifuge at 12,000 rpm for 2 min at room temperature;

[0309] (6) Take out the purification column and place it in a new 1.5 mL EP tube. Add 20 μL of preheated enzyme-free water to the column membrane, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and collect the filtrate.

[0310] 5. Verification of the splicing and cyclization of in vitro transcription products labeled with Cy5-UTP

[0311] 5.1 Verification of whether modified NTP affects cyclization

[0312] Respectively incorporate 1% and 5% Cy5-UTP into the in vitro transcription reaction and use the reaction of direct cyclization after transcription. The results are as Figure 14 shown.

[0313] The results show that the incorporation of Cy5-UTP does not affect the recognition, splicing and cyclization of Anabaena type I intron.

[0314] 5.2 Verification of the RNase R tolerance of the cyclized products labeled with Cy5-UTP

[0315] Take 30 μg of the cyclized product after ethanol precipitation, add 1 μL of RNase R, 10 μL of 10x buffer, and make up to 100 μL with enzyme-free water. React in a metal bath at 37 °C for 30 min. Then use an RNA purification and concentration kit (TR115, Jianshi Biotech) to purify the RNA. The specific steps are as follows:

[0316] (1) Add 200 μL of binding solution to the sample, mix well and then add 300 μL of absolute ethanol, and mix thoroughly.

[0317] (2) Add the above mixture to the purification column and centrifuge at 12,000 rpm for 1 min at room temperature to discard the filtrate.

[0318] (3) Add 400 μL of RNA pre-washing solution to the purification column and centrifuge at 12,000 rpm for 1 min at room temperature to discard the filtrate.

[0319] (4) Add 700 μL of RNA washing solution to the purification column and centrifuge at 12,000 rpm for 1 min at room temperature to discard the filtrate.

[0320] (5) Add 400 μL of RNA washing solution to the purification column and centrifuge at 12,000 rpm for 2 min.

[0321] (6) Take out the purification column and place it in a new 1.5 mL EP tube. Add 20 μL of preheated enzyme-free water to the column membrane, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and collect the filtrate.

[0322] (7) After detecting the concentration using Biodrop, the bands were then detected by 2% agarose gel electrophoresis, and the electrophoresis results are as Figure 16 shown.

[0323] The results showed that Cy5-UTP did not affect RNase R digestion, and at the same time, the RNA containing Cy5-UTP label generated by the splicing of Houttuynia cordata type I intron, which was the target circular RNA, could tolerate RNase R.

[0324] Example 3 Synthesis of circular RNA circCVB3-GFP-pure without residual extra sequences

[0325] The existing design framework of circular RNA contains the wild-type exon 1 (E1) and exon 2 (E2) terminal sequences flanking the intron. After the intron ribozyme recognizes a specific linker sequence structure, it catalyzes the transesterification reaction for splicing and cyclization, connecting the E1 and E2 terminals together. In this example, a method of mimicking the E1 and E2 terminals with a specific sequence region (i.e., the linker sequence) in the target sequence was adopted to verify whether circular RNA expressing green fluorescent protein (GFP) without residual extra sequences could be synthesized.

[0326] To form circular RNA without residues, various components were combined to form a circularization framework, which was in turn from the 5' end to the 3' end: T7 promoter, poly A30, Houttuynia cordata type I intron, CVB3-GFP. For the target fragment part, since the linker sequence could be either on the IRES sequence (the first IRES sequence and the second IRES sequence) or on the open reading frame (the first open reading frame and the second open reading frame), there were a total of 2 arrangements of DNA elements, specifically as Figure 17 shown.

[0327] 1. Linker design

[0328] Specifically, taking CVB3-GFP as the target fragment of circular RNA, the in vitro synthesis of circular RNA circCVB3-GFP-pure without residual extra sequences was verified.

[0329] Two schemes of linker sequences were screened out from the IRES sequence of CVB3.

[0330] Adapter Scheme 1: circCVB3-GFP-pure-01. The target fragment comprises elements operably linked and arranged in the following order from 5' to 3': 3' CVB3 IRES part 3-739 (IRES sequence 1), kozak sequence GCCACC, GFPCDS, TT terminus (IRES sequence 2). The first adapter sequence of CircCVB3-GFP-pure-01 is: AGTGATT, and the second adapter sequence is: AAAACAG, which are underlined.

[0331] Among them, the 3' CVB3 IRES part 3-739 sequence is:

[0332] AAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA(SEQ ID NO:29).

[0333] The sequences of the GFP CDS and the TT termini are as follows:

[0334] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACA AGTGATT (SEQ ID NO:37)

[0335] Adapter Scheme 2: circCVB3-GFP-pure-02. The target fragment comprises elements operably linked and arranged in the following order from 5' to 3': 5' CVB3 IRES part 1-38nt (IRES sequence 1), kozak sequence GCCACC, GFPCDS, 3' CVB3 IRES part 39-741nt (IRES sequence 2). The first adapter sequence of CircCVB3-GFP-pure-02 is: AGAGGTT, and the second adapter sequence is: AAAACAT, which are underlined.

[0336] Among them, the 3’CVB3 IRES part 39-741nt sequence is as follows:

[0337] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAA AGAGGTT (SEQ ID NO:30).

[0338] The 5’CVB3 IRES part 1-38nt sequence is as follows:

[0339] AAAACAT TACAATTCATTGTTAAGTTGAATACAGCAAA(SEQ ID NO:31).

[0340] Schematic diagrams of two linker schemes designed based on the CVB3 IRES are as Figure 18 shown.

[0341] 2. Prepare in vitro transcription template

[0342] According to the method disclosed in WO2024051842, plasmids circCVB3-GFP-pure-01 and circCVB3-GFP-pure-02 were constructed using seamless cloning technology and verified by sequencing.

[0343] Use the Aidlab PL03 - High Purity Plasmid Mini Rapid Extraction Kit to prepare the plasmid. The specific steps are as follows:

[0344] (1) Column equilibration: Add 100 μl of equilibration buffer to adsorption column AC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and reserve for later use.

[0345] (2) Take 5 ml of overnight culture broth and add it to a 1.5 ml centrifuge tube in portions, centrifuge at 12,000 rpm for 30 sec, pour out the supernatant as completely as possible, and collect the bacterial cells.

[0346] (3) Resuspend the bacterial cell pellet with 250 μl of solution P1 and vortex until completely suspended.

[0347] (4) Add 250 μl of solution P2, gently invert 6 - 8 times to fully lyse the bacterial cells, and let it stand at room temperature for 4 min.

[0348] (5) Add 350 μl of solution P3, immediately gently invert 6 - 8 times to mix well. At this time, a white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 min, carefully aspirate the supernatant and add it to adsorption column AC (the adsorption column is placed in the collection tube), avoiding aspirating the floating white precipitate.

[0349] (6) Centrifuge at 12,000 rpm for 1 min and discard the filtrate.

[0350] (7) Add 600 μl of wash buffer WB, centrifuge at 12,000 rpm for 30 sec, and discard the filtrate.

[0351] (8) Add another 600 μl of wash buffer WB and repeat the washing once, then discard the filtrate.

[0352] (9) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min to remove as much wash buffer as possible to avoid residual ethanol in the wash buffer inhibiting downstream reactions.

[0353] (10) Take out the adsorption column and place it in a clean centrifuge tube. Add 100 μl of elution buffer EB to the middle part of the adsorption membrane, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and discard the adsorption column.

[0354] (11) Measure the plasmid concentration using Biodrop.

[0355] Using the recombinant plasmid as a template, PCR amplification was performed to prepare an in vitro transcription template containing the T7 promoter sequence. 150 μL of the PCR reaction mixture was aliquoted into 3 PCR tubes, and the PCR sample preparation components in each tube are shown in Table 8. Among them, the primer sequences of CVB3-GFP-pure-01 are as follows:

[0356] Forward primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0357] Reverse primer: AATCACTTGTACAGCTCGTCCAT (SEQ ID NO:32).

[0358] The primer sequences of CVB3-GFP-pure-02 are as follows:

[0359] Forward primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0360] Reverse primer: AACCTCTTTCAAGCTAAGTGGT (SEQ ID NO:33).

[0361] Table 8

[0362] Component 50 μL system Plasmid DNA 1 μL (10 ng / μL) F primer 2.5 μL R primer 2.5 μL 2×Magic Green Taq SuperMix 25 μL <![CDATA[ddH2O]]> 19 μL

[0363] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; (95°C, 15 sec; 55 - 65°C, 15 sec; 72°C, 60 sec / kb) for 35 cycles; final extension at 72°C for 5 min; end.

[0364] The PCR products were recovered using a PCR product purification and recovery kit (Aidlab#DR0202). The specific steps are as follows:

[0365] (1) Column equilibration: Add 100 μl of equilibration buffer to adsorption column EC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and set aside;

[0366] (2) Pipette 750 μL of binding buffer BB into a 1.5 mL EP tube, pipette 150 μL of the PCR product into the binding buffer, and vortex to mix well;

[0367] (3) Transfer all of the mixture in step 2 to adsorption column EC, incubate at room temperature for 1 min, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the filtrate;

[0368] (4) Add 600 μL of wash buffer to adsorption column EC, centrifuge at 12,000 rpm for 30 s, discard the filtrate, and repeat the washing once;

[0369] (5) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove residual ethanol.

[0370] (6) Transfer the adsorption column EC to a new EP tube and add 55 μL of elution buffer to the EC column. Incubate at room temperature for 2 min.

[0371] (7) Centrifuge at 12,000 rpm for 1 min, discard the adsorption column and collect the filtrate.

[0372] (8) Take 1 μL and measure the DNA concentration using BioDrop.

[0373] 3. In vitro transcription reaction

[0374] Using the in vitro transcription template obtained in step 2 as the substrate, perform an in vitro transcription reaction using the Yeasen in vitro transcription kit (T7 HighYield RNA Synthesis Kit, 10623ES50).

[0375] (1) Add the components required for the in vitro transcription reaction to an EP tube as shown in Table 9.

[0376] Table 9

[0377]

[0378]

[0379] (2) After mixing the above components evenly, incubate in a 37 °C incubator for 3 h.

[0380] (3) Subsequently, add 2 μL of DNase I to the reaction tube, mix well with a pipette tip, and incubate in a 37 °C incubator for 20 min.

[0381] (4) Add LiCl with a final concentration of 2.5 M, mix well, and incubate at -20 °C for 30 min to precipitate RNA.

[0382] (5) Centrifuge at 12,000 rpm at 4 °C for 15 min. After removing the supernatant, add 600 μL of 75% ethanol to wash the precipitate, thoroughly remove ethanol at 12,000 rpm at 4 °C, air-dry at room temperature for 5 min, add 200 μL of enzyme-free water to dissolve the RNA, and then measure the concentration using a micro-spectrophotometer.

[0383] 4. Circularization reaction

[0384] (1) Take 10 μg, add 10 μL of 1× circularization buffer, make up to 100 μL with enzyme-free water, and incubate at 55 °C for 20 min.

[0385] (2) Detect the bands using 1.5% agarose gel. Take 15 μL of the circularized sample, add 15 μL of 2×RNA loading buffer, mix well, incubate in a metal bath at 70 °C for 5 min, place on ice for 1 - 3 min, and then load the sample.

[0386] (3) Electrophoresis conditions: 1×TAE, 120 V, 60 min. After completion, take out the gel and detect the bands using a gel imager, as Figure 19 shown.

[0387] The results show that according to the design of circCVB3 - GFP - pure - 02, circular RNAs without residual extra sequences can be effectively generated.

[0388] The basic concepts have been described above. Obviously, for those skilled in the art, the above detailed disclosure is only an example and does not constitute a limitation to this specification. Although not explicitly stated here, those skilled in the art may make various modifications, improvements, and corrections to this specification. Such modifications, improvements, and corrections are proposed in this specification, so such modifications, improvements, and corrections still fall within the spirit and scope of the exemplary embodiments of this specification.

[0389] Meanwhile, this specification uses specific terms to describe the embodiments of this specification. Such as "one embodiment", "an embodiment", and / or "some embodiments" mean a certain feature, structure, or characteristic related to at least one embodiment of this specification. Therefore, it should be emphasized and noted that the "one embodiment" or "an embodiment" or "an alternative embodiment" mentioned twice or more at different positions in this specification does not necessarily refer to the same embodiment. In addition, certain features, structures, or characteristics in one or more embodiments of this specification can be appropriately combined.

[0390] Similarly, it should be noted that, in order to simplify the expression of the disclosure of this specification and thus help the understanding of one or more embodiments of the invention, in the description of the embodiments of this specification above, sometimes multiple features are grouped into one embodiment, drawing, or description thereof. However, this disclosure method does not mean that the features required by the object of this specification are more than those mentioned in the claims. In fact, the features of the embodiment are less than all the features of the single embodiment disclosed above.

[0391] In some embodiments, numbers are used to describe components and the quantity of attributes. It should be understood that such numbers used in the description of embodiments are, in some examples, modified by the modifiers "about", "approximately" or "substantially". Unless otherwise specified, "about", "approximately" or "substantially" indicate that the said numbers allow a variation of ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may vary according to the characteristics required by individual embodiments. In some embodiments, the numerical parameters should consider the specified significant digits and adopt the method of retaining the general number of digits. Although the numerical ranges and parameters used in some embodiments of this specification to confirm the breadth of their scope are approximate values, in specific embodiments, such numerical settings are as precise as possible within the feasible range.

[0392] For each patent, patent application, patent application publication and other materials cited in this specification, such as articles, books, specifications, publications, documents, etc., their entire contents are hereby incorporated into this specification by reference. This excludes the application history files that are inconsistent with or conflict with the content of this specification, and also excludes the files that limit the broadest scope of the claims of this specification (currently or subsequently attached to this specification). It should be noted that if there are inconsistencies or conflicts between the descriptions, definitions, and / or uses of terms in the attached materials of this specification and the content described in this specification, the descriptions, definitions, and / or uses of terms in this specification shall prevail.

[0393] Finally, it should be understood that the embodiments described in this specification are only used to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, by way of example and not limitation, alternative configurations of the embodiments of this specification may be considered to be consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly introduced and described in this specification.

Claims

1. A DNA molecule for preparing circular RNA, comprising elements operably linked and arranged in the following order from 5' to 3': A promoter, wherein the third base from the 5' end to the 3' end of the sequence transcribed from the transcription start site into the linear RNA in the promoter is G, and the promoter is one of a T7 promoter, an SP6 promoter and a T3 promoter; A poly X segment, wherein the poly X segment comprises more than 5 identical consecutive bases, and X represents any base of A, T, C, or G; A group I intron fragment, wherein the group I intron consists of P2 to P9 domains; target fragment; a first adapter sequence and a second adapter sequence, wherein the first adapter sequence is located at the 3' end of the target fragment, and the second adapter sequence is located at the 5' end of the target fragment; The last base of the RNA corresponding to the first linker sequence is U, so as to form a G·U wobble pair with the third base G in the sequence transcribed from the transcription start site into the linear RNA, and the percentage of the number of A and U in the RNA corresponding to the first linker sequence to the total number of bases in the first linker sequence is greater than a first preset value, or The RNA corresponding to the first linker sequence and the second linker sequence form a complementary structure, and at least two base pairs in the complementary structure are completely complementary; wherein The type I intron ribozyme can initiate cleavage in a one-step transesterification reaction, so that the linear RNA transcribed from the DNA molecule is configured to self-circularize to produce a circular RNA, which contains only the RNA corresponding to the target fragment.

2. The DNA molecule according to claim 1, characterized in that The type I intron is of type IC1, and the type I intron of type IC1 includes type I introns from one or more of the genera Tetrahymena, Pneumocystis, and Neurospora.

3. The DNA molecule according to claim 1, characterized in that The type I intron is of IC3 type, and the type I intron of the IC3 type includes type I introns from one or more of the genera Anabaena, Azovibrio, Glaucocystis, Synechococcus, and Prochlorococcus; or type I introns from corn or tobacco.

4. The DNA molecule according to any one of claims 1 to 3, characterized in that The target fragment includes an open reading frame encoding a protein.

5. The DNA molecule according to claim 4, characterized in that The target fragment also includes a translation initiation element, which includes one or more of an IRES sequence, a 5'UTR sequence, a Kozak sequence, a sequence containing an m6A modification, and a complementary sequence of a ribosomal 18SrRNA.

6. The DNA molecule according to claim 5, characterized in that When the first and the second linker sequences are located on the open reading frame, the translation initiation element separates the open reading frame into a first open reading frame and a second open reading frame in the 5' to 3' direction, the first linker sequence is located at the 3' end of the second open reading frame, and the second linker sequence is located at the 5' end of the first open reading frame.

7. The DNA molecule according to claim 5, characterized in that When the first and second linker sequences are located on the translation initiation element, the open reading frame separates the translation initiation element into a first translation initiation element and a second translation initiation element in the 5' to 3' direction, the first linker sequence is located at the 3' end of the second translation initiation element, and the second linker sequence is located at the 5' end of the first translation initiation element.

8. A recombinant expression vector, characterized in that: Comprising the DNA molecule according to any one of claims 1 to 7.

9. A method for preparing circular RNA based on the DNA molecule according to any one of claims 1 to 7, characterized in that: The method comprises: An in vitro transcription reaction is performed to obtain a linear RNA based on the DNA molecule, wherein after transcription, a modified base X-NTP is added to the 3' end of the linear RNA by a connection method, wherein X in the X-NTP represents a modification group, N is any base among A, U, C, and G, and the X-NTP includes fluorescein isothiocyanate-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-desthiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxyl-NTP, 5-formyl-NTP, dethiobiotin-16-NTP, 5-carboxymethyl ester-NTP, 5-hydroxymethyl-NTP, N1-methyl pseudo-NTP, One or more of 3'-O-methyl-NTP, 5-bromo-NTP, 2'-O-methyl-pseudo-NTP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thieno-NTP, 5-iodo-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas Red-NTP, TET-NTP, and NED-NTP; and causing the linear RNA to self-circularize to produce the circular RNA containing only the RNA corresponding to the target fragment.

Images