Molecular markers in the second intron of ACOX1 gene in beef cattle and their application

Abstract

The present invention belongs to the technical field of molecular marker-assisted selection of beef cattle, and in particular, relates to a molecular marker in the second intron of ACOX1 gene of beef cattle and its application. The molecular marker is located in the second intron of ACOX1 gene in the reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna), and the molecular marker is one or more of g.55672049A>G, g.55672909C>T and g.55673438A>G. ​​The molecular marker site g.55672049 has an A>G base mutation at the 91st bp in the SEQ ID NO.1 sequence, g.55672909 has a C>T base mutation at the 87th bp in the SEQ ID NO.2 sequence, or g.55673438 has an A>G base mutation at the 76th bp in the SEQ ID NO.3 sequence. The three SNP site mutations of the present invention can significantly affect the growth traits of beef cattle, and provide a new molecular marker for the detection of growth traits of beef cattle or molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding of beef cattle, and in particular relates to a molecular marker in the second intron of ACOX1 gene of beef cattle and an application thereof. Background Art

[0002] As people's demand for high-quality protein continues to increase, beef is rich in high protein and rich in nutrients and is deeply loved by the public. Although my country's beef production has steadily increased in recent years, due to the large population base, beef production still cannot meet consumer demand. Growth traits are important economic traits in beef cattle production, and mining and screening molecular markers related to growth traits can help increase beef production.

[0003] Beef cattle have a long growth cycle. Screening genes related to growth traits and genetic markers such as SNP, combined with marker-assisted breeding methods, early selection of beef cattle can accelerate the breeding process of beef cattle. Molecular marker-assisted breeding uses the characteristics of molecular markers being closely linked to target trait genes. By detecting molecular markers, the presence of target genes can be detected to achieve the purpose of selecting target traits. It has the advantages of being fast, accurate, and not affected by environmental conditions. Single nucleotide polymorphism (SNP) is a type of molecular marker, which refers to the change in DNA sequence caused by the variation of a single nucleotide at the same position in the genome between individuals, which can subsequently affect gene expression, transcriptional activity, and splicing modification. Therefore, molecular markers can be used to assist in the early selection of beef cattle populations with excellent growth traits, providing a new idea for increasing beef cattle production. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker related to traits in the second intron of the ACOX1 gene of beef cattle and its application. The method of the present invention can not only realize the early selection of growth traits of beef cattle and shorten the meat breeding process, but also the detection method is fast and accurate and is not affected by breeding environment conditions.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a molecular marker in the second intron of the ACOX1 gene of beef cattle, wherein the molecular marker is one or more of an A>G base mutation at the g.55672049 site, a C>T base mutation at the g.55672909 site, and an A>G base mutation at the g.55673438 site in the beef cattle genome version ARS1.2.

[0007] The present invention also provides an application of a molecular marker in the second intron of the ACOX1 gene of beef cattle in detecting growth traits of beef cattle, wherein the molecular marker is the above-mentioned molecular marker, and the growth traits of beef cattle are weight, body height, cross height, body oblique length and chest circumference of beef cattle; the detection stages of weight, body height, cross height, body oblique length and chest circumference of beef cattle are birth, weaning, 6 months and 12 months of age of beef cattle;

[0008] The height at birth, weight and body length at 6 months of age, and weight and body length at 12 months of age of AA genotype beef cattle with g.55672049A>G are better than those of AG genotype and GG genotype;

[0009] The CC genotype and CT genotype of g.55672909C>T had higher weaning weight, height, cross height, body oblique length and chest circumference, as well as body oblique length at 6 months of age than the TT genotype.

[0010] The weaning weight, body height, cross height, body oblique length and chest circumference of beef cattle with the AA genotype and AG genotype of g.55673438A>G, as well as the weight at 6 months of age were better than those of the GG genotype.

[0011] The present invention also provides an application of a molecular marker in the second intron of the ACOX1 gene of beef cattle in detecting growth traits of beef cattle, wherein the molecular marker is an A>G base mutation at the 91bp in the sequence shown in SEQ ID NO.1, a C>T base mutation at the 87bp in the sequence shown in SEQ ID NO.2, or an A>G base mutation at the 76bp in the sequence shown in SEQ ID NO.3.

[0012] The present invention also provides a method for detecting growth traits of beef cattle, which detects the weight, body height, cross height, body oblique length and chest circumference of beef cattle; the detection stages of the weight, body height, cross height, body oblique length and chest circumference of beef cattle are birth, weaning, 6 months and 12 months of age;

[0013] Detect one or more of the g.55672049, g.556761122909, and g.55673438 loci in the beef cattle genome version ARS-UCD1.2;

[0014] Or one or more of the base type at the 91st bp in the sequence shown in SEQ ID NO.1, the base type at the 87th bp in the sequence shown in SEQ ID NO:2, and the base type at the 76th bp in the sequence shown in SEQ ID NO:3.

[0015] Preferably, the base type at the g.55672049 site or the 91st bp in the sequence shown in SEQ ID NO.1, the height at birth, weight and body length at 6 months of age, and weight and body length at 12 months of age of beef cattle with AA genotype are better than those with AG genotype and GG genotype;

[0016] g.55672909 site or the base type at 87bp in the sequence shown in SEQ ID NO:2, the weaning weight, body height, cross height, body oblique length and chest circumference of beef cattle with CC genotype and CT genotype, and the oblique length of body at 6 months of age were higher than those of TT genotype;

[0017] The base type at the g.55673438 site or the 76th bp in the sequence shown in SEQ ID NO: 3, the weaning weight, body height, cross height, body oblique length and chest circumference of beef cattle with AA genotype and AG genotype, and the weight at 6 months of age are better than those of GG genotype.

[0018] The present invention also provides a substance for detecting single nucleotide polymorphism of SNP site in beef cattle, comprising PCR primers for amplifying genomic DNA fragments including the SNP site or a kit containing the primers; the SNP site is an A>G base mutation at the 91bp in the sequence shown in SEQ ID NO.1, a C>T base mutation at the 87bp in the sequence shown in SEQ ID NO.2, or an A>G base mutation at the 76bp in the sequence shown in SEQ ID NO.3.

[0019] The present invention also provides the use of the molecular marker in the second intron of the ACOX1 gene of beef cattle or the material for detecting single nucleotide polymorphism of SNP site of beef cattle in genetic breeding of beef cattle, wherein the genetic breeding is to improve the growth traits of offspring beef cattle, including weight, body height, cross height, body oblique length and chest circumference of beef cattle; the detection stages of weight, body height, cross height, body oblique length and chest circumference of beef cattle are birth, weaning, 6 months and 12 months of age of beef cattle.

[0020] The present invention also provides a genetic breeding method for improving the growth traits of beef cattle, and corresponding selection is made according to the single nucleotide polymorphism of the beef cattle SNP site: the successive breeding of the breeding cattle selects the individuals whose base at the 91 bp in the sequence shown in SEQ ID NO.1 is AA type, and eliminates the individuals of AG and GG type;

[0021] The breeding of cattle is to select individuals with CC and CT bases at the 87 bp of the sequence shown in SEQ ID NO.2, and eliminate TT individuals;

[0022] In the successive breeding of breeding cattle, individuals with AA and AG bases at the 76th bp of the sequence shown in SEQ ID NO.3 are selected, and GG type individuals are eliminated.

[0023] Preferably, the growth traits of the beef cattle are weight, body height, cross height, body oblique length and chest circumference of the beef cattle; the detection stages of the weight, body height, cross height, body oblique length and chest circumference of the beef cattle are birth, weaning, 6 months and 12 months of age.

[0024] The beef cattle breed described in the present invention is Charolais cattle.

[0025] Beneficial effects of the present invention:

[0026] (1) The present invention discovered molecular markers associated with beef cattle growth traits in the second intron of the ACOX1 gene, wherein the molecular markers include one or more of g.55672049A>G, g.55672909C>T, and g.55673438A>G; the haplotype composed of the above SNP sites can be used as a molecular marker for beef cattle growth traits.

[0027] (2) The present invention verifies the effects of SNP molecular markers on the weight, body height, cross-body height, body oblique length and chest circumference of beef cattle, which can be used to improve the growth performance of offspring, thereby increasing the market competitiveness of breeding enterprises.

[0028] (3) The present invention provides a new molecular marker for molecular marker-assisted breeding of beef cattle growth traits, thereby achieving early selection of beef cattle growth traits and shortening the breeding process; the detection method is fast and accurate, and is not affected by breeding environment conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0030] Figure 1 The distribution of SNPs on beef cattle chromosomes. DETAILED DESCRIPTION

[0031] The present invention provides a molecular marker related to growth traits of beef cattle and its application. The molecular marker includes one or more of g.55672049A>G, g.55672909C>T and g.55673438A>G. ​​The above three molecular markers are located in the beef cattle reference genome ARS-UCD1.2 version genomic.fna accession number GCF_002263795.1, and the accession number is the accession number of NCBI RefSeq.

[0032] The nucleotide sequence of the molecular marker capable of detecting growth traits of beef cattle of the present invention is shown in SEQ ID NO.1-3, wherein the g.55672049A>G means that there is an A>G base mutation at the 91bp in the sequence shown in SEQ ID NO.1; the g.55672909C>T means that there is a C>T base mutation at the 87bp in the sequence shown in SEQ ID NO.2; and the g.55673438A>G means that there is an A>G base mutation at the 76bp in the sequence shown in SEQ ID NO.3.

[0033] The nucleotide sequence of the molecular marker is as follows:

[0034] The nucleotide sequence of g.55672049A>G is:

[0035] TTTTATGACTCAGACCTCACTATTTGGGAAAAAGACAAAATACAA CCTGTGGCAGGCCCTTTGACATCCTTTCAGTATTTCTGGGCTATGNCAG GAAGATCAGTGTTTGTTAGAGAATGTTTCATT (SEQ ID NO. 1)

[0036] The nucleotide sequence of g.55672909C>T:

[0037] TTGCTTCCGTTTTTAGCAAGTGAATTACTGCTTTTATTACTCAGAAA GTCTTGCAGGTTCATTTCCTCCTTCAATGAAAGTGACGTNGCTCAGTCG TGTCGGACTCTTTGCGACTCC(SEQ ID NO.2)

[0038] The nucleotide sequence of g.55673438A>G is:

[0039] AAAAGCATTTTTGATGTTGGCTAGTCCAGGCACTCCTTGAATGTTT GAATCTGTCCTCAGCACCCCTAAAAGGTANTGGTATGGTTTTAGGGCAT CCCCAAAAGTGAGTTGGCAGCCTACCCCCTC (SEQ ID NO. 3)

[0040] The present invention extracts genomic DNA from the Charolais cattle herd, and obtains 4,088,633 high-quality SNPs through whole genome resequencing and SNPs quality inspection and filtering. The obtained SNPs are used to calculate the gene frequency and allele frequency of three SNP sites in the second intron of the ACOX1 gene after typing the Charolais cattle population, and it is judged that the above three SNP sites are in a Hardy-Weinberg equilibrium state.

[0041] Through the association analysis between the molecular markers of the present invention and growth traits, the statistical results of the g.55675384C>T site were obtained as follows:

[0042] The height at birth, weight and body length at 6 months and 12 months of age of beef cattle with AA genotype at g.55672049A>G were significantly higher than those with AG genotype (P<0.05), and the weight at 6 months and body length at 12 months of age were significantly higher than those with GG genotype (P<0.05). Comprehensive evaluation showed that the growth indicators of beef cattle with AA genotype were the best.

[0043] The weaning weight, body height, cross height, body oblique length, chest circumference and body oblique length at 6 months of age of beef cattle with CC genotype and CT genotype at g.55672909C>T locus were significantly higher than those with TT genotype (P<0.05).

[0044] The weaning weight, body height, cross height, body oblique length, chest circumference and 6-month-old weight of beef cattle with AA and AG genotypes at the 55673438A>G locus were better than those with GG genotype (P<0.05).

[0045] The production processes, experimental methods or detection methods involved in the embodiments of the present invention, unless otherwise specified, are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, and are very clear and unambiguous in the relevant application fields. Technical personnel in the field can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0046] The various instruments, equipment, raw materials or reagents used in the embodiments of the present invention are not particularly limited in terms of their sources, and are all conventional products that can be purchased through regular commercial channels, or can be prepared according to conventional methods well known to those skilled in the art.

[0047] Example 1 Whole genome resequencing of beef cattle

[0048] (1) Charolais cattle blood sample collection and leukocyte extraction

[0049] Use a veterinary blood collection needle to collect 5 mL of blood from the jugular vein of Charolais cattle in an EDTA anticoagulant tube and store it in a refrigerator at 4°C to extract white blood cells. The specific steps are as follows:

[0050] ① Take 2-3 mL of blood sample into a 10 mL EP tube;

[0051] ② Add ultrapure water to EP to make the total liquid volume 9mL;

[0052] ③ Slowly turn the EP tube upside down 20 times and let it stand for 10 minutes;

[0053] ④Put the EP tube into the centrifuge and centrifuge at 5000rpm for 10min;

[0054] ⑤ Slowly pour out the supernatant in the EP tube;

[0055] ⑥Add ultrapure water again to make the total liquid volume 9mL;

[0056] ⑦Repeat steps ③, ④, and ⑤;

[0057] ⑧Number the extracted white blood cells and place them in a -80℃ refrigerator.

[0058] (2) Genomic DNA extraction

[0059] After extracting leukocytes from Charolais cattle blood samples, Beijing Tianmo DNA extraction kit was used to extract sample genomic DNA according to the manufacturer's instructions, and the samples were stored in a -80°C refrigerator after passing the quality inspection.

[0060] (3) Whole genome resequencing and SNPs detection and filtering

[0061] The DNA that passed the quality inspection was sent to the BGI platform for whole genome resequencing with a sequencing depth of 10 to obtain the original offline data. Fastp software was used to filter the raw data, and the filtering criteria were as follows: reads with adapters; reads with a certain proportion of N (N means that the base information cannot be determined) (default 5bp); reads containing more than 40% low-quality bases (quality value ≤ 20); sliding window quality trimming: with a sliding window size of 4bp, trimming of reads with an average quality of less than 20. After quality control in the above steps, cleanreads were obtained. BWA software was used to align cleanreads to the beef cattle reference genome (GCF_002263795.1_ARS-UCD1.2_genomic.fna). The BAM file of the initial alignment result was obtained, sorted using Samtools software, and Picard was used to mark duplicate reads. Then, the GATK4.2.0.0 software toolkit was used to detect SNPs sites, and the Plink software was used to filter the SNP sites (geno 0.1--maf0.05--hwe1e-06). Finally, the Beagle version 5.4 software was used to fill in the genotypes, and finally 4,088,633 high-quality SNPs were obtained. The distribution of SNPs on chromosomes was detected and it was found that they were distributed on autosomes. The distribution is as follows Figure 1 shown.

[0062] Example 2 Detection of polymorphic distribution of molecular markers in beef cattle populations

[0063] (1) Charolais cattle phenotypic data collection

[0064] A total of 240 Charolais cattle born between 2013 and 2023 were selected as the research subjects, and the weight, body height, cross height, body oblique length and chest circumference data of the Charolais cattle group at birth, weaning, 6 months and 12 months of age were collected.

[0065] (2) Genotype frequency and allele frequency analysis

[0066] The genotype frequency and allele frequency of the three SNP sites in the second intron of the ACOX1 gene were calculated after typing the Charolais cattle population. The specific formula and method are as follows:

[0067] Genotype frequency = number of individuals with the genotype / total number of samples in the test population;

[0068] Allele frequency = allele homozygous genotype frequency + gene heterozygous genotype frequency / 2.

[0069] (3) Hardy-Weinberg equilibrium test

[0070] Hardy-Weinberg equilibrium is a population under ideal conditions (not affected by specific interference factors, such as non-random mating, selection, migration, mutation or limited population size), over many generations, the gene frequency and genotype frequency will remain constant and in a stable equilibrium state.

[0071] p 2 represents the frequency of homozygous allele (such as Y), q 2 represents the frequency of homozygous alleles (such as y), and 2pq represents the frequency of heterozygotes (such as Yy). If a population reaches genetic equilibrium, its genotype frequency should conform to (p+q) 2 =p 2 +2pq+q 2 =1, based on the theoretical value, the actual value can be calculated to perform a chi-square test to determine whether each gene is in a Hardy-Weinberg equilibrium state in the population. The test formula is as follows:

[0072] χ 2 =∑(Oi-Ei) 2 / Ei

[0073] Where O represents the observed value of gene frequency, E represents the expected value of gene frequency, and χ 2 is the obtained chi-square test value. Compare the calculated chi-square value with the corresponding chi-square table. If the P value range is greater than 0.05, it means that this site conforms to the Hardy-Weinberg equilibrium. If it is less than 0.05, this site deviates from the Hardy-Weinberg equilibrium.

[0074] The test results are shown in Table 1: The three SNP loci showed three genotypes in the beef cattle population. g.55672049A>G was dominated by homozygous AA, and allele A was the dominant allele; g.55672909C>T was dominated by heterozygous CT, and allele C was the dominant allele; g.55673438A>G was dominated by heterozygous AG, and allele A was the dominant allele. And the chi-square test found that these three SNP loci all met the Hardy-Weinberg equilibrium (P>0.05).

[0075] Table 1 Genotype frequency and allele frequency of ACOX1 gene SNP loci in beef cattle population

[0076]

[0077]

[0078] Note: The numbers in () are the number of cattle

[0079] Example 3 Association analysis and application of molecular markers and growth traits

[0080] (1) Association analysis between genotype and growth traits

[0081] The association analysis between genotype and growth traits was calculated using SAS self-programming language, using fixed linear models. Multiple regression and analysis of variance were performed on the traits to determine the fixed effects for subsequent analyses. Several models with all possible combinations of fixed effects were tested, and the significance of each effect was systematically evaluated, and each non-significant effect was removed from the model in a stepwise manner.

[0082] The final model is as follows:

[0083] Y ikjlm =μ+I i +A k +B j +C l +D m +E ikjlm

[0084] Y is the trait value, I is the genotype fixed effect, A is the sire fixed effect, B is the age fixed effect, C is the sex fixed effect, D is the animal random effect, μ is the mean of a single trait, and E is the random error.

[0085] (2) Analysis of additive dominant effect value

[0086] SAS statistical software was used to analyze the genetic effects of genotype on growth traits using linear models, and the GLM program was used for association analysis between markers and traits. The model used was as follows:

[0087] Model 1: Y = overall mean + genotype + farm environment effect + residual

[0088] Model 2: Y = overall mean + additive effect + dominant effect + farm environment effect + residual

[0089] Among them, Y is the phenotypic value of the trait, additive effect = (homozygous 1 - homozygous 2) / 2, with 1, 0, and -1 representing homozygous 1, heterozygous, and homozygous 2 respectively; dominant effect = heterozygous - (homozygous 1 + homozygous 2) / 2, with 1, -1, and 1 representing homozygous 1, heterozygous, and homozygous 2 respectively.

[0090] The statistical results of the g.55672049A>G locus are shown in Table 2: The height at birth, weight and body length at 6 months of age, and weight and body length at 12 months of age of beef cattle with AA genotype were significantly higher than those with AG genotype (P<0.05), and the weight at 6 months of age and body length at 12 months of age were significantly higher than those with GG genotype (P<0.05). Comprehensively evaluated, the growth indicators of beef cattle with AA genotype were the best.

[0091] The statistical results of the g.55672909C>T locus are shown in Table 3: the weaning weight, body height, cross height, body oblique length, chest circumference and body oblique length at 6 months of age of beef cattle with CC genotype and CT genotype were significantly higher than those with TT genotype (P<0.05).

[0092] The statistical results of the 55673438A>G locus are shown in Table 4: the weaning weight, body height, cross height, body oblique length, chest circumference and 6-month-old weight of beef cattle with AA genotype and AG genotype were better than those with GG genotype (P<0.05).

[0093] Table 2g. Association analysis between 55672049A>G locus and growth traits of beef cattle

[0094]

[0095]

[0096] Note: The numbers in () refer to the number of cattle; the values ​​in the table are expressed as mean ± standard error; different lowercase letters in the same row of data indicate significant differences (P<0.05), and the same letters or no letters indicate no significant differences (P>0.05).

[0097] Table 3g. Association analysis between 55672909C>T locus and growth traits of beef cattle

[0098]

[0099]

[0100] Note: The numbers in parentheses are the number of cattle; the values ​​in the table are expressed as mean ± standard error; different lowercase letters in the same row of data indicate significant differences (P<0.05), and the same letters or no letters indicate no significant differences (P>0.05)

[0101] Table 4g. Association analysis between 55673438A>G locus and growth traits of beef cattle

[0102]

[0103]

[0104]

[0105] Note: The numbers in () refer to the number of cattle; the values ​​in the table are expressed as mean ± standard error; different lowercase letters in the same row of data indicate significant differences (P<0.05), and the same letters or no letters indicate no significant differences (P>0.05).

[0106] In summary, the g.55672049A>G, g.55672909C>T and g.55673438A>G sites in the second intron of the ACOX1 gene can be used as new molecular markers for genetic improvement of growth traits in beef cattle.

[0107] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The use of a reagent for detecting molecular markers in the second intron of ACOX1 gene in beef cattle in detecting growth traits of beef cattle, characterized in that: The molecular markers are one or more of the A>G base mutation at the g.55672049 site, the C>T base mutation at the g.55672909 site, and the A>G base mutation at the g.55673438 site in the beef cattle genome version ARS-UCD1.2; the beef cattle growth traits are the weight, body height, cross height, body oblique length and chest circumference of the beef cattle; the detection stages of the weight, body height, cross height, body oblique length and chest circumference of the beef cattle are the newborn, weaning, 6 months and 12 months of age of the beef cattle; the beef cattle are Charolais cattle; The height at birth, weight and body length at 6 months, and weight and body length at 12 months of the AA genotype beef cattle with g.55672049 A>G were better than those of the AG genotype and the GG genotype. The CC genotype and CT genotype of g.55672909 C>T had higher weaning weight, body height, cross height, body oblique length and chest circumference, as well as body oblique length at 6 months of age than the TT genotype. The weaning weight, body height, cross height, body oblique length and chest circumference of beef cattle with the AA genotype and AG genotype of g.55673438 A>G, as well as the weight at 6 months of age were better than those of the GG genotype.

2. A method for detecting growth traits of beef cattle, characterized in that: The weight, height, cross height, oblique length and chest circumference of the beef cattle are tested; the testing stages of the weight, height, cross height, oblique length and chest circumference of the beef cattle are birth, weaning, 6 months and 12 months of age; the beef cattle are Charolais cattle; Detect one or more of the g.55672049, g.556761122909, and g.55673438 loci in the beef cattle genome version ARS-UCD1.2; Or one or more of the base type at the 91st bp in the sequence shown in SEQ ID NO.1, the base type at the 87th bp in the sequence shown in SEQ ID NO.2, and the base type at the 76th bp in the sequence shown in SEQ ID NO.3; In the base type at the g.55672049 site or the 91st bp in the sequence shown in SEQ ID NO.1, the height at birth, weight and body length at 6 months, and weight and body length at 12 months of age of beef cattle with AA genotype are superior to those with AG genotype and GG genotype; The weaning weight, body height, cross height, body length and chest circumference of CC genotype and CT genotype beef cattle at g.55672909 or the base type at 87 bp in the sequence shown in SEQ ID NO.2, and the body length at 6 months of age was higher than that of TT genotype; The weaning weight, body height, cross height, body oblique length and chest circumference of beef cattle with AA genotype and AG genotype in the g.55673438 site or the base type at the 76th bp in the sequence shown in SEQ ID NO.3, and the weight at 6 months of age were better than those of beef cattle with GG genotype.

3. Application of a reagent for detecting molecular markers in the second intron of ACOX1 gene in beef cattle in genetic breeding of beef cattle, characterized in that: The genetic breeding is to improve the growth traits of offspring beef cattle; the growth traits are weight, body height, cross height, body oblique length and chest circumference of beef cattle; the detection stages of weight, body height, cross height, body oblique length and chest circumference of beef cattle are birth, weaning, 6 months and 12 months of age of beef cattle; the beef cattle are Charolais cattle; The molecular marker is one or more of the base type at the 91st bp in the sequence shown in SEQ ID NO.1, the base type at the 87th bp in the sequence shown in SEQ ID NO.2, and the base type at the 76th bp in the sequence shown in SEQ ID NO.3; The breeding of cattle is to select the AA type individuals at the 91st bp of the sequence shown in SEQ ID NO.1, and eliminate the AG and GG type individuals; The breeding selected the CC and CT type individuals at the 87th bp of the sequence shown in SEQ ID NO.2, and eliminated the TT type individuals; The breeding selected individuals whose base at the 76th bp in the sequence shown in SEQ ID NO.3 was AA and AG, and eliminated GG individuals.

4. A genetic breeding method for improving growth traits of beef cattle, characterized in that: Make corresponding selections based on the single nucleotide polymorphism of beef cattle SNP sites: select the individuals with AA type at the 91st bp in the sequence shown in SEQ ID NO.1 for the successive breeding of cattle, and eliminate the AG and GG type individuals; In the sub-breeding of breeding cattle, the individuals with CC and CT bases at the 87th bp in the sequence shown in SEQ ID NO.2 are selected, and the TT individuals are eliminated; In the sub-breeding of breeding cattle, the individuals with AA and AG bases at the 76th bp in the sequence shown in SEQ ID NO.3 are selected, and the GG type individuals are eliminated; The beef cattle are Charolais cattle; The growth traits of the beef cattle are weight, body height, cross height, body oblique length and chest circumference of the beef cattle; the detection stages of the weight, body height, cross height, body oblique length and chest circumference of the beef cattle are birth, weaning, 6 months and 12 months of age.

Images