Cadmium accumulation related genes in brassica and application thereof

By knocking out the BnABCG36.C06 and BnABCG36.A07 genes in rapeseed using CRISPR/Cas9 gene editing technology, a rapeseed variety with high cadmium accumulation was cultivated. This solved the problem of slow remediation speed of traditional heavy metal hyperaccumulation plants and achieved rapid and effective remediation of soil heavy metal pollution.

CN119082125BActive Publication Date: 2025-11-11NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411275855.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-12
Publication Date
2025-11-11
Estimated Expiration
2044-09-12

AI Technical Summary

Technical Problem

Traditional heavy metal hyperaccumulating plants have long growth cycles and limited biomass, resulting in slow remediation of heavy metal pollution in soil. Existing technologies are unable to quickly and effectively reduce the total amount of heavy metals in the soil.

Method used

By knocking out the BnABCG36.C06 and BnABCG36.A07 genes in rapeseed using CRISPR/Cas9 gene editing technology, the rapeseed's ability to accumulate cadmium was enhanced. By constructing a CRISPR/Cas9 system and using Agrobacterium-mediated transformation, a rapeseed with high cadmium accumulation was cultivated.

Benefits of technology

It significantly improved the cadmium accumulation and translocation efficiency of rapeseed. The mutant rapeseed lines accumulated more cadmium in the aboveground parts under cadmium stress, showing good potential for phytoremediation of soil heavy metal pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119082125B_ABST
    Figure CN119082125B_ABST
Patent Text Reader

Abstract

This invention discloses a gene related to cadmium accumulation in rapeseed and its application, belonging to the fields of genetic engineering technology and heavy metal soil pollution remediation. Based on CRISPR / Cas9 gene editing technology, this invention utilizes multiple pairs of sgRNAs to edit two homologous copies of the BnPDR8 / BnABCG36 gene, BnABCG36.C06 and BnABCG36.A07, in the recipient rapeseed, obtaining a mutant rapeseed line with a mutated BnPDR8 / BnABCG36 gene. Under cadmium stress, the mutant rapeseed accumulated more cadmium in its stems, and its cadmium translocation coefficient was significantly higher than that of the wild type. This indicates that this rapeseed can serve as a good phytoremediation material for heavy metal soil pollution, possessing good potential for phytoremediation applications and providing an effective strategy to improve the efficiency and application level of phytoremediation for heavy metal pollution.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering technology and heavy metal soil pollution remediation, and relates to rapeseed cadmium enrichment-related genes and their applications. Background Technology

[0002] With economic development and the unreasonable discharge of industrial waste, soil pollution has become an increasingly prominent problem. A significant portion of polluted arable land is still used for food production, causing pollutants to accumulate through the food chain and posing a serious threat to human health.

[0003] Traditional soil physiochemical remediation methods primarily mitigate the harmful effects of heavy metals by reducing the concentration of pollutants in the soil or increasing their stability. For example, passivating agents are used to form complexes with heavy metals in the soil, reducing the absorption rate of heavy metals by crops. However, this type of remediation is prone to secondary pollution when subjected to prolonged rainwater leaching. In contrast, phytoremediation is currently the only method that can effectively reduce the total amount of heavy metals in the soil. Phytoremediation technology utilizes heavy metal hyperaccumulating plants to absorb heavy metals from the soil and accumulate them in their above-ground parts, thereby effectively removing pollutants, avoiding secondary pollution, and facilitating subsequent treatment.

[0004] Traditional heavy metal hyperaccumulating plants typically have long growth cycles and limited biomass, resulting in slow remediation rates that can take decades or even centuries to restore contaminated soil to background levels. Therefore, further research into gene pathways and detoxification mechanisms involved in heavy metal transport, and enhancing the remediation capacity of plants through bioengineering techniques—especially creating fast-growing, high-biomass heavy metal hyperaccumulating plants with broad-spectrum heavy metal accumulation capabilities—is crucial to overcoming these technical limitations and promoting the practical application of phytoremediation technologies.

[0005] Rapeseed, as the most widely planted oilseed crop and the largest oilseed crop in terms of planting area, exhibits significantly higher biomass and growth rate than other common heavy metal hyperaccumulators, such as Sedum aizoon and Pteris vittata. Furthermore, rapeseed possesses a certain capacity for heavy metal adsorption and is not demanding in terms of its growing environment; even in areas contaminated with heavy metals, the edible value of its seeds remains unaffected. Therefore, rapeseed holds significant potential in the remediation of heavy metal-contaminated soils. Developing rapeseed varieties specifically designed for heavy metal soil remediation through transgenic or gene-editing bioengineering technologies will have broad application prospects.

[0006] Plants under cadmium stress exhibit typical physiological and morphological changes, including stunted growth, yellowing leaves, and decreased yield. Cadmium is not an essential element for plant growth and metabolism; therefore, plants typically mitigate its toxic effects by chelating cadmium ions and distributing them throughout various tissues. Within the plant, extracellular chelated cadmium ions require essential ion transport proteins or ion channels to enter the cell. Members of the IRT, HMA, Nramp, and YSL transporter families play a crucial role in this process, responsible for absorbing cadmium ions from the roots and transporting them to various parts of the plant.

[0007] The ABC (ATP-binding cassette) family of transport proteins is one of the largest and oldest protein families, participating in a variety of important physiological processes within plants. ABC transport proteins play a crucial role in maintaining metal homeostasis in plants. Multidirectional resistance proteins (PDRs), belonging to the ABCG subfamily, are also part of the ABC family and primarily function in protecting plants from biotic and abiotic stresses. Furthermore, transport proteins in the PDR subfamily are also involved in heavy metal transport. Summary of the Invention

[0008] The purpose of this invention is to provide a gene related to cadmium enrichment in rapeseed and its application in the cultivation of transgenic rapeseed, which can enrich cadmium in the soil, thereby achieving the remediation of heavy metal contaminated soil. This invention utilizes emerging bioengineering technologies such as the CRISPR / Cas9 system to provide a new breeding method for preparing rapeseed specifically for heavy metal contaminated soil.

[0009] In a first aspect, the present invention provides a rapeseed cadmium enrichment-related gene, wherein the rapeseed cadmium enrichment-related gene is BnABCG36.C06 and BnABCG36.A07, which are homologous genes to the gene BnPDR8 / BnABCG36;

[0010] The nucleotide sequence of BnABCG36.C06 is shown in SEQ ID NO.1;

[0011] The nucleotide sequence of BnABCG36.A07 is shown in SEQ ID NO.2.

[0012] Furthermore, this invention knocks out the cadmium enrichment-related genes BnABCG36.C06 and BnABCG36.A07 in rapeseed, thereby improving the rapeseed's ability to enrich the heavy metal cadmium.

[0013] Secondly, this invention provides a method for cultivating rapeseed with high cadmium enrichment, which uses the CRISPR / Cas9 system to edit BnABCG36.C06 and BnABCG36.A07 in rapeseed to obtain rapeseed with high cadmium enrichment.

[0014] Furthermore, the method for cultivating rapeseed with high cadmium accumulation according to the present invention specifically includes the following steps:

[0015] s1. Design target sgRNAs 1-5 targeting BnABCG36.C06 and BnABCG36.A07, and synthesize and construct vector-related primers;

[0016] s2. Construct the CRISPR / Cas9 system;

[0017] s3. Extract plasmids and transform them into Agrobacterium;

[0018] s4. Utilizing Agrobacterium-mediated transformation of rapeseed;

[0019] s5. Harvest the transformed rapeseed seeds;

[0020] s6. After Hyg resistance screening, the seeds were sown, genomic DNA was extracted, and the edited site sequence was verified to obtain rapeseed with high enrichment of heavy metal cadmium.

[0021] Furthermore, the nucleotide sequences of target sgRNA1-5 described in this invention are shown in SEQ ID NO.3-7.

[0022] Furthermore, the construction of the CRISPR / Cas9 system described in this invention includes: using the dicotyledonous gene editing vector pHSE401 as a base, starting sgRNA1-5 with the AtU6-26 Arabidopsis thaliana promoter, starting the Cas9 protein with CaMV 35S, and inserting the target sgRNA1-5 into the BsaI-BsaI restriction site of pHSE401.

[0023] Furthermore, the part of rapeseed that is transformed by Agrobacterium-mediated transformation in this invention is the hypocotyl of rapeseed.

[0024] Furthermore, the Agrobacterium species described in this invention is GV3101.

[0025] Furthermore, the rapeseed described in this invention is Brassica napus.

[0026] Thirdly, this invention provides the application of rapeseed cadmium enrichment-related genes in the breeding of rapeseed varieties for cadmium-contaminated soil remediation.

[0027] Furthermore, this invention provides the application of a rapeseed cadmium enrichment-related gene in the breeding of rapeseed varieties for cadmium-contaminated soil remediation. By knocking out the genes BnABCG36.C06 and BnABCG36.A07, the ability of rapeseed to enrich the heavy metal cadmium in the soil is improved.

[0028] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0029] This invention, based on CRISPR / Cas9 gene editing technology, utilizes multiple pairs of sgRNAs to edit two homologous genes, BnABCG36.C06 and BnABCG36.A07, of the BnPDR8 / BnABCG36 gene in the recipient rapeseed, obtaining mutant rapeseed lines with BnPDR8 / BnABCG36 gene mutations. Compared with the gene-edited recipient parent K407 (control group), the aboveground parts (stems) of the mutant rapeseed lines accumulated more cadmium under cadmium stress, and their cadmium translocation coefficient was significantly higher than that of the wild type (parental K407). This indicates that this mutant rapeseed can serve as a good phytoremediation material for soil heavy metal pollution, possessing good potential for phytoremediation applications and providing an effective strategy for improving the efficiency and application level of phytoremediation of heavy metal pollution. Attached Figure Description

[0030] Figure 1 A schematic diagram of the dicotyledonous gene editing backbone vector pHSE401.

[0031] Figure 2 A schematic diagram of the process for constructing gene editing transformation vectors.

[0032] Figure 3 The distribution of target sequences sgRNA1–5 on two homologous genes of BnPDR8 / BnABCG36, BnABCG36.C06 and BnABCG36.A07.

[0033] Figure 4 This is a flowchart illustrating the preparation of rapeseed gene-edited lines using the hypocotyl genetic transformation method. In the flowchart, a represents seed disinfection; b represents seed germination; c represents Agrobacterium preparation; d represents pre-culture of the lines; e represents Agrobacterium infection and co-culture; f represents callus induction culture; g represents stem germination; h represents root germination; and i represents transplanting and greenhouse cultivation.

[0034] Figure 5 The results show the cadmium enrichment of gene-edited rapeseed. In the figures, a represents the cadmium content of gene-edited rapeseed cultured in culture medium; b represents the translocation coefficient of gene-edited rapeseed cultured in culture medium; c represents the cadmium enrichment amount of gene-edited rapeseed cultured in culture medium; d represents the cadmium content of gene-edited rapeseed cultured in soil; e represents the translocation coefficient of gene-edited rapeseed cultured in soil; f represents the cadmium enrichment amount of gene-edited rapeseed cultured in soil; WT represents wild type, and 8-26 and 8-42 are gene-edited rapeseed varieties. Detailed Implementation

[0035] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially.

[0036] Example 1

[0037] This embodiment provides the editing and transformation of the relevant gene BnPDR8 / BnABCG36, as well as the construction and transformation of the vector.

[0038] 1. Design of sgRNA target sequences and synthesis of homologous recombination primers

[0039] The sequences of two homologous genes, BnABCG36.C06 and BnABCG36.A07, of BnPDR8 / BnABCG36 were obtained from the Brassica napus multi-omics information resource (BnIR, https: / / yanglab.hzau.edu.cn / ), with sequence registration numbers BnaC06G0240100ZS and BnaA07G0222800ZS, respectively. The nucleotide sequence of BnaC06G0240100ZS is shown in SEQ ID NO.1, and the nucleotide sequence of BnaA07G0222800ZS is shown in SEQ ID NO.2. Based on the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, universal target sgRNAs 1-5 capable of simultaneously targeting BnABCG36.C06 and BnABCG36.A07 were designed using the CRISPR online website (http: / / skl.scau.edu.cn / home / ). The specific sequences are shown in Table 1. The specific locations of the universal target sgRNAs 1-5 in the genes BnABCG36.C06 and BnABCG36.A07 are shown in Table 1. Figure 3 As shown.

[0040] Table 1. Universal target sgRNAs 1–5 targeting BnABCG36.C06 and BnABCG36.A07

[0041] Serial Number name sequence SEQ ID NO.3 sgRNA1 CCAGCAGAAACCTCGAAGACATC SEQ ID NO.4 sgRNA2 GGTCACCTCCAAGAAAGACCAGG SEQ ID NO.5 sgRNA3 ATTGGGGTTGGAGCCTTGCTTGG SEQ ID NO.6 sgRNA4 GAGCAGCAGCTATTGTGATGAGG SEQ ID NO.7 sgRNA5 CTCATCGTCTATGCCATGGT

[0042] The designed sgRNA sequences are given sticky ends with BsaI restriction sites to form the corresponding homologous recombination primers, which are synthesized by Sangon Biotech.

[0043] 2. Construction of CRISPR / Cas9 final vector

[0044] The designed sgRNA1-5 primers were incubated at 65℃ for 5 min, then diluted 10 times for later use.

[0045] Prepare the dicotyledonous gene editing transformation vector pHSE401 (Addgene plasmid#62201, as follows) Figure 1 (As shown), for reference Figure 2 The flowchart shows the process of digesting the vector pHSE401 with BsaI and recovering the digested fragments. The digested plasmid and diluted primer fragments were ligated overnight using T4 ligase to obtain the final CRISPR / Cas9 vector. Specifically, sgRNA1–5 were initiated by the AtU6-26 Arabidopsis promoter, and the Cas9 protein was initiated by CaMV 35S. The target sequences sgRNA1–5 were inserted into the BsaI-BsaI restriction sites of the basic vector to obtain the final CRISPR / Cas9 vector. The vector was transformed into competent *E. coli* cells using the heat shock method, activated at 37°C for 60 min, and then plated on antibiotic-resistant solid medium for 12 h. Single colonies were picked and shaken, and then positive plasmids were verified by colony PCR using universal primers M13-F and gRNAScfd-R and sent for sequencing.

[0046] 3. Transformation using Agrobacterium vector

[0047] Take the E. coli carrying the positive plasmid from step 2, shake it overnight, extract the positive plasmid using a plasmid extraction kit, and introduce it into Agrobacterium competent cells GV3101 by electroporation. Then, culture it on rifampicin and kanamycin resistant solid medium at 28°C for 2-3 days. Subsequently, pick single clones of GV3101 strain, shake it slightly, perform GV3101 bacterial culture PCR and send it for sequencing verification. Add glycerol to the final positive GV3101 strain to a glycerol concentration of 25% and store it at -80°C.

[0048] Example 2

[0049] This embodiment provides a method for creating gene-edited rapeseed lines using hypocotyl genetic transformation.

[0050] The specific procedures for preparing rapeseed gene-edited lines using hypocotyl genetic transformation are as follows: Figure 4 As shown. The gene-editing recipient parent in this embodiment is Brassica napus K407.

[0051] 1. Seed disinfection

[0052] (1) Place the selected plump seeds into a sterilized Erlenmeyer flask and soak them in deionized water for 20 minutes. In a laminar flow hood, disinfect the soaked seeds with 75% ethanol for 30 seconds, and then disinfect the seeds with 1.5% to 2.5% sodium hypochlorite solution for 10 minutes. During the disinfection process, the Erlenmeyer flask needs to be shaken continuously.

[0053] (2) After disinfection, pour off the sodium hypochlorite solution, rinse the seeds with 75 mL of sterile deionized water for 5 min, and shake during the rinsing process to ensure that there is no disinfectant residue on the seed surface.

[0054] (3) After pouring out the rinsing water, add 50 mL of sterile water and rinse quickly for 1 minute. Repeat the operation 4 times until the disinfectant and other impurities on the surface of the seeds are completely removed.

[0055] (4) Place the disinfected and rinsed seeds in a petri dish containing sterile filter paper, use aseptic techniques to dry the moisture on the surface of the seeds, and then transfer them to another new petri dish containing filter paper for further drying on a clean bench.

[0056] 2. Seed germination

[0057] (1) Using flame-sterilized tweezers (ensuring the tweezers surface is sterile), transfer the sterilized seeds to seed germination medium M0. Seed germination medium M0 consists of 1 / 2 MS + 20 g / L sucrose + 10 g / L agar. Place approximately 30 seeds in each seed germination medium M0. This step must be performed under sterile conditions to avoid microbial contamination of the seeds. Open the lid of the seed germination medium M0 containing the seeds and place it in an incubator.

[0058] (2) Place the incubation box in the dark or under light conditions and allow the seeds to germinate within a temperature range of 22-25℃. Allow the seeds to germinate for 4 days under the above conditions.

[0059] 3. Preparation of Agrobacterium

[0060] (1) Prepare Agrobacterium tumefaciens 2 days after seed germination. Use the GV3101 strain containing the gene editing vector, streak it onto a solid medium containing 100 μg / mL rifampin and 50 μg / mL kanamycin, and incubate at 28°C for 2 days.

[0061] (2) The positive single clone GV3101 bacterial culture was inoculated into 100 mL of YEP medium containing 100 μg / mL rifampicin and 50 μg / mL kanamycin and cultured at 28℃ and 220 rpm for 36 h. The OD value at 600 nm was measured using a spectrophotometer.

[0062] (3) Centrifuge at 5000 rpm for 10 min at room temperature, discard the supernatant, and add acetylsuccinone (AS, 50 mg / mL) to DM medium to wash the precipitated Agrobacterium GV3101 cells to obtain Agrobacterium GV3101 suspension. The DM medium is MS liquid + 30 g / L sucrose.

[0063] 4. Pre-culture

[0064] Remove the hypocotyl, that is, open the culture box and take the cotyledon petiole of the seedling at 4 days old. After cutting off the bud with scissors, cut off all the petioles. Clamp the petiole with tweezers and cut it to 8mm-10mm with a scalpel.

[0065] 5. Infection and co-culture of Agrobacterium

[0066] The ends of the cotyledonary explants were immersed in Agrobacterium GV3101 suspension for 15 min. After removing the bacterial suspension on sterilized filter paper, the cotyledonary explants were placed on M1 medium, with approximately 30 explants per medium. The composition of M1 medium was MS + 18 g / L mannitol + 30 g / L sucrose + 8 g / L agar + 1 mg / L 2,4-D + 0.3 mg / L KT. The M1 medium containing the cotyledonary explants was incubated in the dark for 2 days at a temperature of 22–25 °C.

[0067] 6. Callus induction culture

[0068] (1) Place the cotyledon petiole explants cultured for 2 days in step 5 into a sterile Erlenmeyer flask, add 100 mL of sterile water, rinse for 5 min, and repeat the rinsing 3 times with fresh sterile water.

[0069] (2) Rinse again with sterile water containing carbenicillin (500 mg / L) for 10 min, absorb the surface moisture, and then insert the cotyledonary explants into callus induction medium M2. The number of cotyledonary explants inserted into each callus induction medium M2 is 40, and culture for 20 days. The composition of callus induction medium M2 is: M1 + 5 mg / L STS + 300 mg / L TMT + 25 mg / L Hygromycin.

[0070] 7. Stem sprouting

[0071] Using sterile forceps, cotyledonous explants induced by callus induction were transferred into stem germination medium M4 containing 5 mg / L Hyg. The medium was cultured at 25°C under light for 3–4 weeks to obtain green seedlings. The stem germination medium M4 consisted of: 1 / 2 MS + 20 g / L sucrose + 0.1 mg / L NAA + 8 g / L Agar + 200 mg / L TMT.

[0072] 8. Root sprouting

[0073] Using sterile forceps, transfer the green seedlings into root germination culture containers containing M4 medium, ensuring that the base of the seedling is centered in the M4 medium and in good contact with it. Then, incubate the root germination culture containers at 25°C under light for 1–2 weeks to obtain the plants.

[0074] 9. Transplanting and greenhouse cultivation

[0075] (1) Remove the plant with tweezers and rinse it with tap water to remove the agar. Use tweezers to make a small hole in the potting soil, place the plant roots into it, cover it with potting soil, and gently press the potting soil around the plant roots firmly. Then cover the plant with a layer of plastic film to retain moisture and warmth.

[0076] (2) Collect all the seeds harvested from the plants, screen them with Hyg resistance medium, sow them for propagation, extract genomic DNA from the leaves during the seedling stage, and send them for PCR testing to verify the editing site sequence. Finally, the rapeseed with the target gene edited was obtained and named PDR8.

[0077] Example 3

[0078] This embodiment demonstrates the cadmium enrichment capacity of gene-edited rapeseed.

[0079] 1. Cadmium enrichment in gene-edited rapeseed cultured in culture medium

[0080] Genetically edited rapeseed T1 generation seeds were disinfected with 75% alcohol solution for 30 seconds and 2% sodium hypochlorite solution for 10 minutes before being sown in 1 / 2 MS selection medium containing 25 mg / L Hyg. After culturing in the dark for 2 days, the genetically edited rapeseed was transferred to a culture room for 5 days. The culture room environment was set at 25℃, with a light-to-dark ratio of 2:1 (16 h light + 8 h dark). Genetically edited rapeseed with similar growth characteristics was selected as the experimental group, and the gene-editing recipient parent, Brassica napus K407, was selected as the control group. Both groups were cultured in dishes containing 200 μM / L cadmium. After 7 days of growth, roots and stems of the genetically edited rapeseed were collected, and the cadmium enrichment in the genetically edited rapeseed was measured and analyzed using a flame atomic absorption spectrophotometer.

[0081] 2. Cadmium enrichment in gene-edited rapeseed under soil culture

[0082] Genetically edited rapeseed T1 generation seeds were disinfected with 75% alcohol solution for 30 seconds and 2% sodium hypochlorite solution for 10 minutes before being sown in 1 / 2 MS selection medium containing 25 mg / L Hyg. After culturing in the dark for 2 days, the genetically edited rapeseed was transferred to a culture room for 5 days. The culture room environment was set at 25℃, with a light-to-dark ratio of 2:1 (16 h light + 8 h dark). Then, the genetically edited rapeseed was transferred to nutrient soil for 20 days. Genetically edited rapeseed with similar growth characteristics was selected as the experimental group, and the gene-editing recipient parent, Brassica napus K407, was used as the control group. Both groups were irrigated with a 200 μm / L cadmium solution. After 14 days of culture, roots and stems of the genetically edited rapeseed were collected, and the cadmium enrichment in the genetically edited rapeseed was measured and analyzed using a flame atomic absorption spectrophotometer.

[0083] 3. Method for determining cadmium content in rapeseed tissue using flame atomic absorption spectrophotometry

[0084] (1) Pretreatment of test equipment

[0085] Volumetric flasks, small funnels, pipettes and other containers should be soaked in an aqueous solution containing 10% dilute nitric acid for more than 48 hours, then rinsed with deionized water 2-3 times, and dried before use.

[0086] (2) Sample digestion

[0087] After completely drying the roots and stems of the gene-edited rapeseed, weigh them (0.25g) and number them. Then, place them into the corresponding digestion tubes according to their numbers, add 5mL of concentrated nitric acid, and let stand overnight. Digest the tubes first at 60℃ for 1 hour, then at 120℃ for 3 hours. After digestion, let the tubes cool to room temperature, add 1mL of hydrogen peroxide solution, and digest at 120℃ for 1 hour, repeating twice. Remove the acid from the digestion tubes at 150℃–180℃. After 15 minutes, observe the liquid content in the digestion tubes. Stop removing the acid when the liquid content is approximately 500μL. Dilute the remaining solution to 500mL in a centrifuge tube, filter with qualitative filter paper, and obtain the test solution.

[0088] (3) Determination of cadmium content

[0089] Transfer the standard solution and the test solution to 50 mL centrifuge tubes respectively, and measure the corresponding absorbance values ​​on a flame atomic absorption spectrophotometer. Substitute the obtained absorbance values ​​into the standard curve to obtain the cadmium content of the test solution.

[0090] 4. Analysis of cadmium enrichment in gene-edited rapeseed

[0091] Figure 5In the figure, 'a' represents the cadmium content in the aboveground stems of gene-edited rapeseed under culture medium conditions. The cadmium content in the aboveground stems of PDR8-42 was 1.56 times that of the wild type, and PDR8-26 was also significantly higher than that of the wild material. Figure 5 In the analysis of the translocation coefficients (cadmium content in aboveground stems / cadmium content in underground roots) of gene-edited rapeseed, both PDR8-26 and PDR8-42 were significantly higher than those of wild-type materials. The translocation coefficient of PDR8-42 was about 2.3 times that of wild-type, and the translocation coefficient of PDR8-26 was about 1.6 times that of wild-type. Figure 5 In the c-cell analysis, the enrichment level of PDR8-26 was approximately 1.37 times that of the wild-type material, and PDR8-42 was also significantly higher. These data indicate that gene-edited rapeseed cultured in the culture medium exhibited a stronger cadmium enrichment capacity.

[0092] Figure 5 In the study, under soil culture conditions, the cadmium content in the aboveground stems of gene-edited rapeseed PDR8-26 was 1.4 times that of the wild type, which was superior to the 1.32 times that of PDR8-42, and its translocation coefficient was also significantly higher than that of the wild type (1.9 times). Figure 5 The enrichment of PDR8-42 (e) was also 1.69 times better than that of PDR8-42; the enrichment of individual plants was significantly higher in PDR8-42 than in the wild type. Figure 5 The cadmium accumulation (f) in the soil culture condition was 1.56 times that of the wild type. In conclusion, the gene-edited rapeseed under soil culture conditions exhibited a stronger cadmium accumulation capacity, consistent with the results obtained from gene-edited rapeseed under culture medium conditions.

[0093] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art through related deductions and substitutions based on the inventive concept, without inventive effort, are within the scope of protection of the present invention.

Claims

1. A method for cultivating rapeseed with high cadmium enrichment, characterized in that, Using the CRISPR / Cas9 system to study rapeseed BnABCG36.C06 and BnABCG36.A07 Editing was performed to obtain rapeseed with high cadmium enrichment; The BnABCG36.C06 The nucleotide sequence is shown in SEQ ID NO.1; The BnABCG36.A07 The nucleotide sequence is shown in SEQ ID NO.2; The nucleotide sequences of target sgRNA1-5 in the CRISPR / Cas9 system are shown in SEQ ID NO.3-7.

2. The method according to claim 1, characterized in that, The method specifically includes the following steps: s1. Design target BnABCG36.C06 and BnABCG36.A07 The target sgRNAs 1-5 were identified, and vector-related primers were synthesized and constructed. s2. Construct the CRISPR / Cas9 system; s3. Extract plasmids and transform them into Agrobacterium; s4. Utilizing Agrobacterium-mediated transformation of rapeseed; s5. Harvest the transformed rapeseed seeds; s6. After Hyg resistance screening, the seeds were sown, genomic DNA was extracted, and the edited site sequence was verified to obtain rapeseed with high enrichment of heavy metal cadmium.

3. The method according to claim 2, characterized in that, The construction of the CRISPR / Cas9 system includes: using a dicotyledonous gene editing vector. pHSE401 Based on this, sgRNA1-5 are initiated by the AtU6-26 Arabidopsis promoter, and Cas9 protein is initiated by CaMV 35S to insert the target sgRNA1-5 into the target RNA. pHSE401 of BsaI-BsaI Enzyme cleavage site.

4. The method according to claim 2, characterized in that, The site of transformation of rapeseed mediated by Agrobacterium is the hypocotyl of rapeseed.

5. The method according to claim 2, characterized in that, The Agrobacterium species is GV3101.

6. The method according to claim 2, characterized in that, The rapeseed in question is Brassica napus.

7. The application of a rapeseed cadmium enrichment-related gene in the breeding of rapeseed varieties for cadmium-contaminated soil remediation, characterized in that, Knockout of genes associated with cadmium enrichment in rapeseed BnABCG36.C06 and BnABCG36.A07 This enhances the ability of rapeseed to accumulate cadmium, a heavy metal in the soil. The cadmium enrichment-related genes in rapeseed BnABCG36.C06 and BnABCG36.A07 With genes BnPDR8 / BnABCG36 They are homologous genes; The BnABCG36.C06 The nucleotide sequence is shown in SEQ ID NO.1; The BnABCG36.A07 The nucleotide sequence is shown in SEQ ID NO.2.