A specific genomic region sequence, primer set, detection method and application of SsMj strain

By screening the specific genomic region sequence of S. symbiotica SsMj and designing primer sets, the problem of strain detection confusion in existing technologies was solved, and accurate detection and identification of SsMj was achieved, supporting its in-depth research and utilization.

CN119082325BActive Publication Date: 2025-09-12SUN YAT SEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410842931.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-27
Publication Date
2025-09-12
Estimated Expiration
2044-06-27

AI Technical Summary

Technical Problem

Existing technologies are unable to distinguish different strains of S. symbiotica at the strain level, which leads to confusion in detection methods. In addition, not all strains can be isolated using existing culture media, hindering the research and utilization of SsMj.

Method used

The specific genomic region sequences of S. symbiotica SsMj were screened through sequencing analysis and bioinformatics methods, and specific primer sets were designed for accurate detection and identification of SsMj strains.

Benefits of technology

It has achieved accurate identification of whether the SsMj strain is infected and the degree of infection. It is simple to operate, low-cost and highly specific, supporting in-depth research and utilization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119082325B_ABST
    Figure CN119082325B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of microbial technology and discloses a specific genomic region sequence, a primer set, a detection method, and an application of an SsMj strain. The present invention screens and obtains a specific genomic region sequence of Serratia symbiotica SsMj, and uses the specific genomic region sequence as a target gene in the detection and / or identification of S.symbiotica SsMj. The present invention provides a primer set for detecting and / or identifying S.symbiotica SsMj. The specific genomic region sequence of S.symbiotica SsMj of the present invention provides a basis for simple and feasible specific detection or identification of SsMj strains. The detection or identification method of the present invention can accurately identify whether SsMj is infected and the degree of infection in a strain-specific manner, and is simple to operate, low in cost, and highly specific. It is conducive to in-depth research and utilization of SsMj.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a specific genome region sequence, a primer set, a detection method and an application of an SsMj strain. Background Art

[0002] The bacterium Serratia symbiotica is one of the most common symbionts in aphids. Different strains of S. symbiotica exhibit significant differences in their relationships with their hosts, with some assisting with nutrient synthesis (Zhou et al., 2021), others helping to withstand high temperatures (Burke et al., 2010), and others protecting the host by interfering with the search and development of natural enemies (Attia et al., 2021). S. symbiotica can also impose burdens on the host, such as shortened lifespan and reduced fecundity (Pons et al., 2019a). The S. symbiotica strain SYSUMjSs (referred to herein as S. symbioticaSsMj) (accession number: LDBAF64, its genome uploaded to the NCBI Genome Database with accession number GCA 020404805) is derived from the pea aphid population at Sun Yat-sen University and has been shown to significantly affect the performance of both aphids and ladybugs (Du et al., 2022). Therefore, fully understanding the interaction between SsMj and its host and developing technologies to intervene in and utilize SsMj will hopefully increase the effectiveness of integrated aphid control.

[0003] Current techniques for manipulating S. symbiotica primarily include detection, isolation, elimination, and addition. PCR primers targeting universal bacterial 16S rRNA can amplify S. symbiotica DNA fragments, and the amplified products can be sequenced to identify the bacterial species. PCR primers designed for S. symbiotica 16S rRNA (16SA1 and PASScmp) can specifically amplify S. symbiotica (Fukatsu et al., 2000). A specific fluorescent probe (PASSisR) can specifically bind to S. symbiotica DNA, allowing for in situ observation (Koga et al., 2003). Using 863 medium or tryptic soy broth (TSB) medium, several free-living strains of S. symbiotica can be isolated from aphid gut contents (Sabri et al., 2011). Penicillin can eliminate some facultative symbiotic strains of S. symbiotica (Koga et al., 2007). Sharing host plants with aphids infected with a free-living strain of S. symbiotica can allow other aphids to become infected with the same strain (Pons et al., 2019b). For some free-living strains of S. symbiotica, it is possible to obtain uninfected aphids by transferring newly hatched aphid progeny to plants that have not been fed by aphids (Pons et al., 2019c).

[0004] The biggest problem with existing S. symbiotica manipulation techniques is their lack of strain specificity. Different strains of S. symbiotica exhibit significant biological differences, but existing techniques for detecting them fail to distinguish them at the strain level. This results in these methods being prone to strain confusion, impacting their practical application. Furthermore, not all free-living S. symbiotica strains can be isolated using 863 and TSB media. Whether currently reported methods for isolating, eliminating, and adding S. symbiotica are applicable to SsMj remains unclear, hindering the research, development, and utilization of SsMj. Summary of the Invention

[0005] The purpose of the present invention is to overcome the shortcomings of the existing technology and provide a specific genomic region sequence, primer set and detection method and application of the SsMj strain.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention screens and obtains a specific genomic region sequence of S. symbiotica SsMj, the nucleotide sequence of which is any one of SEQ ID NOs: 1-4.

[0008] The present invention compares sequences of different strains of S. symbiotica using sequencing analysis and bioinformatics methods to screen out a specific sequence for S. symbiotica SsMj. Primers are designed based on this specific sequence, providing a basis for a simple and feasible method for specific detection or identification of the SsMj strain.

[0009] In a second aspect, the present invention uses the specific genomic region sequence as a target gene in the detection and / or identification of S. symbiotica SsMj.

[0010] In a third aspect, the present invention provides a primer set for detecting and / or identifying S. symbiotica SsMj, wherein the nucleotide sequence thereof is selected from any one of the following primer pairs:

[0011] a. The nucleotide sequences are SEQ ID NOs: 5 and 6;

[0012] b. The nucleotide sequences are SEQ ID NOs: 7 and 8;

[0013] c. The nucleotide sequences are SEQ ID NOs: 9 and 10;

[0014] d. The nucleotide sequences are SEQ ID NOs: 11 and 12;

[0015] e. The nucleotide sequences are SEQ ID NOs: 13 and 14;

[0016] f. The nucleotide sequences are SEQ ID NOs: 15 and 16;

[0017] g. The nucleotide sequences are SEQ ID NOs: 17 and 18;

[0018] h. The nucleotide sequences are SEQ ID NOs: 19 and 20.

[0019] In a fourth aspect, the present invention provides a kit comprising the primer set for detecting and / or identifying S. symbiotica SsMj.

[0020] As a preferred embodiment of the kit of the present invention, it also includes acceptable excipients and auxiliary agents.

[0021] In a fifth aspect, the present invention uses the primer set and the kit in the detection and / or identification of S. symbiotica SsMj.

[0022] In a sixth aspect, the present invention provides a method for detecting and / or identifying S. symbiotica SsMj, comprising extracting genomic DNA of the test strain as a template and conducting a PCR reaction using a primer set having nucleotide sequences of SEQ ID NOs: 17 and 18; if a band is displayed, the test strain is S. symbiotica SsMj.

[0023] As a preferred embodiment of the method of the present invention, the system and conditions of the PCR reaction are:

[0024] System: The conventional PCR reaction system is 25 μl, containing 12.5 μl 2xPro Taq Master Mix, 8.5 μl sterile water, 1 μl of each forward and reverse primer, and 2 μl of DNA template; conditions: initial 95°C for 3 min; then 95°C for 30 s, 56°C for 30 s, and 72°C for 1 min, for a total of 35 cycles; finally, 72°C for 10 min.

[0025] In a seventh aspect, the present invention provides a method for quantitative detection of S. symbiotica SsMj, comprising extracting genomic DNA of the strain to be tested as a template, and performing a PCR reaction using a primer set having nucleotide sequences of SEQ ID NOs: 7 and 8 or nucleotide sequences of SEQ ID NOs: 15 and 16; and calculating the amount of the strain to be tested based on the content of the PCR product.

[0026] As a preferred embodiment of the method of the present invention, the system and conditions of the PCR reaction are:

[0027] System: 10 μL SYBR Green Pro Taq, 8.2 μL sterile water, 0.4 μL forward and reverse primers respectively, 1 μL DNA template; conditions: initially 95°C for 5 min; then 95°C for 5 s, 60°C for 30 s, for a total of 40 cycles; then 95°C for 5 s; finally 65°C for 5 s.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention uses sequencing analysis and bioinformatics to compare sequences from different strains of S. symbiotica, identifying sequences specific to S. symbiotica SsMj. Primers are designed based on this specific sequence, providing a basis for a simple and feasible method for specific detection or identification of SsMj strains. The detection or identification method of the present invention can accurately and strain-specifically determine the presence and degree of infection in SsMj, with simple operation, low cost, and high specificity. This method facilitates in-depth research and utilization of SsMj. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The electrophoresis diagram of the PCR amplification products of the candidate SsMj-specific genomic regions shows, from left to right, the amplification products of Marker, SSMJ-1-1, SSMJ-1-2, SSMJ-2-1, SSMJ-2-2, SSMJ-3-1, SSMJ-3-2, SSMJ-4-1, and SSMJ-4-2;

[0031] Figure 2 Electropherograms of PCR amplification products using the reported Serratia symbiotica-specific primers PASScmp / 16SA1 and the designed SSMJ4-1F / SSMJ4-1R against Staphylococcus xylosus and S. symbiotica SsMj DNA. Each primer pair amplified two S. xylosus DNA samples in triplicate. Positive controls were the amplification of S. symbiotica SsMj DNA by each primer pair. From left to right, the following are: Maker, PASScmp / 16SA1 amplification products (P1-1, P1-2, P1-3, P2-1, P2-2, P2-3), a positive control using SsMj DNA (P0), a blank control (CK), Maker, SSMJ4-1-1-1 amplification products (SS1-1, SS1-2, SS1-3, SS2-1, SS2-2, SS2-3), a positive control (SS0), and a blank control (CK). DETAILED DESCRIPTION

[0032] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0033] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0034] Example 1: SsMj-specific genomic regions

[0035] By comparing the genomes of different strains of S. symbiotica, we discovered SsMj-specific genomic regions. Specifically:

[0036] (1) The genome sequences of the remaining S. symbiotica strains were downloaded from the NCBI Genome database (https: / / www.ncbi.nlm.nih.gov / genome / ). Genome annotation was performed using Prodigal, and the genome quality of the SsMj strain was checked using CheckM. The genome quality assessment results focused on completeness and contamination. In bacteria, genomes with completeness > 90% and contamination < 30% are considered to have good assembly quality.

[0037] After screening, 19 strains were used to assemble high-quality genomes (strain names, NCBI accession numbers, and CheckM quality assessment results are shown in Table 1 ) for comparative genome analysis.

[0038] Table 1 Genome quality assessment results of different strains of S. symbiotica

[0039]

[0040]

[0041] (2) Orthofinder was used to cluster gene families using the protein sequences of 19 strains of SsMj. The Orthofinder operating parameters were orthofinder-f protein-t 16-M msa-A mafft. A total of 8002 homologous gene families were constructed. Among them, gene families that clustered only with SsMj sequences were screened, and a total of 6 gene families were screened.

[0042] The protein sequence was mapped back to the corresponding CDS (coding sequencing) sequence on the genome, and the CDS sequence was selected as the candidate SsMj-specific gene.

[0043] The NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) was used to detect the similarity between the candidate SsMj-specific gene CDS sequences and those of other bacterial species or strains. CDS sequences that matched those of Serratia spp. or other bacterial species were removed, and four CDS sequences were identified as SsMj-specific genomic region sequences. The sequence information is shown in Table 2.

[0044] Table 2 Sequence information of SsMj-specific genomic regions

[0045]

[0046]

[0047]

[0048] Example 2: Primer design for specific regions of the SsMj genome

[0049] Using NCBI's Primer-BLAST (tool website: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) for the four SsMj genomic regions in Example 1, eight primer pairs were designed (Table 3) with a primer temperature of 55°C-57°C and an amplification product length of 90 bp-300 bp. Primer specificity was tested on NCBI primers, and no primers were predicted to amplify other known sequences in NCBI.

[0050] Table 3 PCR primers for detecting candidate SsMj-specific genomic regions

[0051] Sequence Primer Name F - end Sequence R - end Sequence JAIFZP4.1_33 SSMJ - 1 - 1 TGAAACGCGAAAAGTGAAAG ATCCGTTTGTTTTCTGTGCT JAIFZP4.1_33 SSMJ - 1 - 2 TCAGAAAATGCTGGAACAGT ACGGAGAGAAAGAACCTCAT JAIFZP2.1_32 SSMJ - 2 - 1 ATAGGTAGTGGAACTGGGTG TCTCCCGACTACAACATCAA JAIFZP2.1_32 SSMJ - 2 - 2 TTGATGTTGTAGTCGGGAGA TTGTACGGTCCCATAAACCT JAIFZP4.1_10 SSMJ - 3 - 1 ACTCTCAGGGAAAGGAGATG GACGACATGACAATTCCCAA JAIFZP4.1_10 SSMJ - 3 - 2 TGGAGTAGGTAACGGCTATG CCTTTCCCTGAGAGTAACCA JAIFZP4.1_11 SSMJ - 4 - 1 GCCATACCTCTATCGCAAAA CACTGAATGCCTGACCTTTA JAIFZP4.1_11 SSMJ - 4 - 2 TTAAGGAGCGAAGAACCCTT CAAGTGAGGCGGAATAAACC

[0052] Example 3: Detection method of SsMj

[0053] (1) Separation of SsMj

[0054] Prepare LB medium (10 g / L NaCl, 5 g / L yeast extract, 10 g / L tryptone, 15 g / L agar powder) and LB culture fluid (10 g / L NaCl, 5 g / L yeast extract, 10 g / L tryptone) respectively. Take a single SsMj colony and inoculate it into the LB culture fluid for culture.

[0055] (2) The LB culture solution of SsMj was collected and the genomic DNA was extracted; the 8 pairs of primers in Example 2 were used to perform PCR reaction on the DNA template of SsMj.

[0056] Reaction system: The reaction system is 25 μL, including 12.5 μL 2 x Pro Taq Master Mix, 8.5 μL sterile water, 1 μL each of forward and reverse primers, and 2 μL of DNA template;

[0057] Reaction conditions: 95°C for 3 min; 95°C for 30 s, 56°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and finally at 72°C for 10 min.

[0058] like Figure 1 As shown, the band of SSMJ-4-1 had no nonspecific amplification and the highest brightness. Sequencing verification showed that the band length accuracy was the best and the amplification efficiency was the highest. SSMJ-4-1 was selected as the primer for routine specific PCR detection of SsMj.

[0059] To further compare the specificity of different primers for SsMj amplification, primer SSMJ4-1 and the reported S. symbiotica specific primer PASScmp / 16SA1 were used to perform PCR amplification of DNA from SsMj and various bacteria. Figure 2 As shown, while PASScmp / 16SA1 successfully amplified SsMj DNA, it also nonspecifically amplified DNA from Staphylococcus xylosus, a bacterium found in the aphid gut. In contrast, SSMJ4-1 did not amplify DNA from bacteria other than SsMj. This demonstrates that SSMJ4-1 has a superior amplification capability compared to PASScmp / 16SA1.

[0060] Example 4: Method for detecting the degree of infection of SsMj

[0061] According to the PCR results of implementation case 3, the primer SSMJ-3-2 with the shortest amplification product length of 90-150 bp was selected as the candidate primer for quantitative PCR.

[0062] The reaction system and reaction conditions of the quantitative PCR reaction are as follows:

[0063] The reaction system was: 10 μL of SYBR Green Pro Taq, 8.2 μL of sterile water, 0.4 μL of each forward and reverse primer, and 1 μL of DNA template;

[0064] The reaction conditions were: 95°C for 5 min; 95°C for 5 s, 60°C for 30 s, for a total of 40 cycles; then 95°C for 5 s; and finally 65°C for 5 s.

[0065] Quantitative PCR using this primer pair on SsMj DNA templates yielded a CT value of <30, demonstrating that this quantitative PCR protocol is suitable for detecting SsMj DNA abundance. SSMJ-3-2 was selected as the primer for subsequent quantitative PCR targeting SsMj.

[0066] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

[0067] References:

[0068] Attia,S.,Renoz,F.,Pons,I., P.,Foray,V.,Piedra,J.-M.,Sanané,I.,Le Goff,G.,Lognay,G.,Hance,T.,2021.The aphid facultative symbiont Serratiasymbiotica influences the foraging behaviors and life-history traits ofthe parasitoid Aphidius ervi.Entomologia Generalis 42.21-3

[0069] Burke, G., Fiehn, O., Moran, N., 2010.Effects of facultative symbionts and heat stress on the metabolome of pea aphids.The ISME Journal 4,242-252.

[0070] Du, XY, Yang, HY, Gong, SR, Zhang, PF, Chen, PT, Liang, YS, Huang, YH, Tang, XF, Chen, QK, De Clercq, P., Li, HS, Pang, H., 2022. Aphidophagousladybird beetles adapt to an aphid symbiont.Functional Ecology 36.2593–2604.

[0071] Fukatsu,T.,Nikoh,N.,Kawai,R.,Koga,R.,2000.Applied andEnvironmental Microbiology 66,2748-2758.

[0072] Koga,R.,Tsuchida,T.,Fukatsu,T.,2003.Changing partners in an obligatesymbiosis:a facultative endosymbiont can compensate for loss of the essentialendosymbiont Buchnera in an aphid.Proc Biol Sci 270,2543-2550.

[0073] Koga,R.,Tsuchida,T.,Sakurai,M.,Fukatsu,T.,2007.Selective eliminationof aphid endosymbionts:effects of antibiotic dose and host genotype,andfitness consequences.FEMS Microbiology Ecology 60,229-239.

[0074] Pons,I.,Renoz,F.,Hance,T.,2019a.Fitness costs of the cultivablesymbiont Serratia symbiotica and its phenotypic consequences to aphids inpresence of environmental stressors.Evolutionary Ecology 33,825-838.

[0075] Pons,I.,Renoz,F.,Noel,C.,Hance,T.,2019b.Circulation of the cultivablesymbiont Serratia symbiotica in aphids is mediated by plants.Frontiers inMicrobiology 10,764.

[0076] Pons,I.,Renoz,F.,Noel,C.,Hance,T.,2019c.New insights into the natureof symbiotic associations in aphids:infection process,biological effects,andtransmission mode of cultivable Serratia symbiotica bacteria.Applied andEnvironmental Microbiology 85,e02445-02418.

[0077] Sabri,A.,Leroy,P.,Haubruge,E.,Hance,T.,Frere,I.,Destain,J.,Thonart,P.,2011.Isolation,pure culture and characterization of Serratia symbioticasp.nov.,the R-type of secondary endosymbiont of the black bean aphid Aphisfabae.Int J Syst Evol Microbiol 61,2081-2088.

[0078] Zhou,X.,Ling,X.,Guo,H.,Zhu-Salzman,K.,Ge,F.,Sun,Y.,2021.Serratiasymbiotica enhances fatty acid metabolism of pea aphid to promote hostdevelopment.Int J Mol Sci 22.

Claims

1. Application of a detection reagent for a specific genomic region sequence of S. symbioticaSsMj in the detection and / or identification of S. symbioticaSsMj, characterized in that The nucleotide sequence of the specific genomic region sequence of the S. symbioticaSsMj is shown in SEQ ID NO: 4; the accession number of the S. symbioticaSsMj in the NCBI Genome database is GCA 020404805.

2. A primer set for detecting and / or identifying S. symbioticaSsMj in the detection and / or identification of S. symbioticaSsMj, characterized in that The nucleotide sequence of the primer set is shown in SEQ ID NOs: 17 and 18; the accession number of the S. symbiotica SsMj in the NCBI Genome database is GCA 020404805.

3. Use of a kit for the detection and / or identification of S. symbioticaSsMj, characterized in that The kit comprises the primer set for detecting and / or identifying S. symbioticaSsMj according to claim 2; the accession number of the S. symbioticaSsMj in the NCBI Genome database is GCA020404805.

4. The use according to claim 3, characterized in that The kit further comprises acceptable excipients and adjuvants.

5. A method for detecting and / or identifying S. symbioticaSsMj, characterized in that The genomic DNA of the test strain was extracted as a template, and a PCR reaction was performed using a primer set with nucleotide sequences of SEQ ID NOs: 17 and 18; if a band was displayed, the test strain was S. symbiotica SsMj; the accession number of the S. symbiotica SsMj in the NCBI Genome database was GCA 020404805.

6. The method according to claim 5, characterized in that The PCR reaction conditions were as follows: 95°C for 3 min; 95°C for 30 s, 56°C for 30 s, and 72°C for 1 min, for a total of 35 cycles; and finally at 72°C for 10 min.

Citation Information

Patent Citations

  • Stenotrophomonas maltophilia capable of improving reproductive capacity of myzus persicae and application of stenotrophomonas maltophilia

    CN117363541A