Attractant for termites and screening method thereof

Abstract

The invention relates to the technical field of termite prevention and control, and particularly discloses an attractant for termites and a screening method thereof.The attractant comprises one or more of a (1R)-(+)-alpha-pinene solution and a eudesmol solution; the screening method for the termite attractant comprises the following steps: acquiring an antenna template and an odorant binding protein gene sequence of termites; obtaining plant volatile matters; obtaining an odor binding protein gene based on the odor binding protein gene sequence, and expressing odor binding protein through a prokaryotic expression system based on the odor binding protein gene to obtain odor binding protein; and determining the binding capacity of the odor binding protein and each odor component in the plant volatile matter by adopting a fluorescent competitive binding test so as to obtain the attractant component for the termites. The attractant is stable in attraction effect, termites can be accurately and efficiently attracted out from hidden places to be killed, and large-area use of killing agents for prevention and control is not needed.

Description

Technical Field

[0001] The invention relates to the technical field of termite control, and specifically discloses an attractant for termites and a screening method thereof. Background Art

[0002] Termite damage is a well-known major hazard that affects the national economy and people's livelihood, as well as the safety of life and property of the people. Termites (scientific name: Macrotermes barneyi) have the characteristics of strong concealment and strong mobility. Traditional methods of killing and controlling termites mainly include: large-scale use of killing agents for control, killing agents include chemical agents such as fipronil, hexaflumuron, avermectin, imidacloprid and fipronil termite baits, etc. The use of large-scale chemical agents has caused the "3R" problem in termite control, namely, pesticide residues (res idece), pest resistance (res i stant), and pests are rampant again (resergence). The environment will face serious pollution, and the natural enemies of pests will also be destroyed in large quantities. Therefore, traditional methods of killing and controlling termites have the disadvantages of being time-consuming and labor-intensive, and causing significant impacts on the ecological environment.

[0003] At the same time, the current technology for attracting termites in the industry also includes: directly using the branches and trunks of camphor trees and osmanthus trees that termites like to eat as attractant media, or simply physically crushing them to make termite attractants. The attracting effect is not good and is far from achieving the effect of accurately luring termites. Summary of the invention

[0004] In view of the above problems, the first object of the present invention is to provide an attractant for termites, which has a stable attracting effect and can accurately and efficiently lure termites out of hiding for killing without the need to use killing agents on a large scale for prevention and control.

[0005] The second object of the present invention is to provide a screening method for termite attractants. The screening method explores the preference of termites for host odors based on the molecular characteristics of termite odor-binding proteins, thereby finding active odor-binding proteins in termites, and using reverse chemical ecological design to prepare termite attractants, so that the termite attractants can accurately and efficiently lure termites out of hiding for killing, effectively solving the 3R problem in the current termite control process.

[0006] The first technical solution adopted by the present invention is: an attractant for termites, comprising one or more of (1R)-(+)-α-pinene solution and eucalyptol solution.

[0007] Preferably, the concentrations of the (1R)-(+)-α-pinene solution and the eucalyptol solution are both 1 ug / uL-100 ug / uL.

[0008] Preferably, the (1R)-(+)-α-pinene solution or eucalyptol solution is prepared by the following method:

[0009] The (1R)-(+)-α-pinene solution or eucalyptol solution is added into an organic solvent to obtain a (1R)-(+)-α-pinene solution or eucalyptol solution; the organic solvent comprises one or more of n-hexane, methanol, acetone and ethanol.

[0010] The second technical solution adopted by the present invention is: a method for screening termite attractants, comprising the following steps:

[0011] S1: Obtain antenna templates and odorant binding protein gene sequences of termites;

[0012] S2: Obtain plant volatiles;

[0013] S3: obtaining an odor binding protein gene based on the odor binding protein gene sequence, and expressing the odor binding protein through a prokaryotic expression system based on the odor binding protein gene to obtain the odor binding protein;

[0014] S4: using a fluorescence competition binding test to determine the binding ability of the odor binding protein with each odor component in the plant volatiles, thereby obtaining an attractant component for termites.

[0015] Preferably, the step S1 comprises:

[0016] RNA was extracted from the antennae of termites using Trizol reagent as an antennae template; RNA was extracted from the antennae of termites using Trizol reagent, and eukaryotic reference-free transcriptome sequencing was performed to obtain an odorant binding protein gene sequence, wherein the odorant binding protein gene sequence was the nucleotide sequence shown in SEQ ID NO.1.

[0017] Preferably, the plant volatiles include linalool, trans-nerolidol, α-pinene, trans-caryophyllene, (1S)-(-)-camphor, D(+)-camphor, (1R)-(+)-α-pinene, eucalyptol and phellandrene.

[0018] Preferably, step S3 comprises:

[0019] S31: designing primers based on the odorant binding protein gene sequence, and performing PCR amplification based on the primers and the antennae template to obtain the odorant binding protein gene;

[0020] S32: constructing a genetically engineered bacterium expressing an odor binding protein based on the odor binding protein gene and the plasmid vector;

[0021] S33: Production of odorant binding proteins using genetically engineered bacteria expressing odorant binding proteins.

[0022] Preferably, the designed primers include:

[0023] Design homology arm primers F: GCCATGGCTGATATCGGATCCG; R: GTGGTGGTGGTGGTGCTCGAG.

[0024] Preferably, the step S4 comprises:

[0025] S41: 1-NPN was selected as the fluorescent probe;

[0026] S42: preparing a solution of plant volatiles with methanol; adding Tris-HCl, 1-NPN and termite odor-binding protein to the solution, and detecting the change in fluorescence intensity at the maximum emission peak by an endpoint method, thereby screening out attractant components for termites.

[0027] Preferably, the attractant component for termites includes (1R)-(+)-α-pinene and / or eucalyptol.

[0028] Beneficial effects of the above technical solution:

[0029] (1) The termite attractant disclosed in the present invention has a stable attracting effect and can accurately and efficiently attract termites from hiding places for killing.

[0030] (2) The screening method of termite attractants disclosed in the present invention explores the preference of termites for host odors based on the molecular characteristics of termite odor binding proteins, thereby finding active odor binding proteins in termites, and using reverse chemical ecological design to prepare attractants for termites, so that the termite attractants can accurately and efficiently lure termites out of hiding for killing, effectively solving the 3R problem in the current termite control process

[0031] (3) The termite attractant disclosed in the present invention is used to accurately attract termites lurking in dams, green spaces, buildings, cultural relics, optical fiber cables, etc., so as to facilitate the use of killing technology to reduce or avoid the harm caused by termites.

[0032] (4) The present invention can effectively solve the problems of high labor costs required for traditional termite extermination and nest digging, secondary economic losses caused by damage to surface crops, inability to implement termite nest digging construction during flood season, and soil erosion caused by large-scale excavation; it can effectively solve the problems of ecological environment damage, death of terrestrial and aquatic plants and animals, and personal injury caused by large-scale application of pesticides in traditional termite extermination. Through precise lure, the loss of traditional termite extermination methods to dams and the ecological environment is reduced to almost zero. It is currently the most scientific and economical way to kill termites without entering the nest and using less pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 A graph showing the binding curve between termite OBP and probe 1-NPN provided in one embodiment of the present invention;

[0034] Figure 2 A graph showing the combination of termite OBP and plant volatiles provided in one embodiment of the present invention;

[0035] Figure 3 This is a diagram showing the olfactory response of termites to a (1R)-(+)-α-pinene solution and a eucalyptol solution provided in one embodiment of the present invention. DETAILED DESCRIPTION

[0036] The present invention is further described below through specific embodiments. It should be pointed out that, for ordinary technicians in this field, several modifications and improvements can be made without departing from the principle of the present invention, and these should also be regarded as belonging to the protection scope of the present invention.

[0037] Embodiment 1

[0038] The invention discloses an attractant for termites, comprising one or more of a (1R)-(+)-alpha-pinene solution and a eucalyptol solution. The termite attractant can effectively attract termites.

[0039] The concentrations of the (1R)-(+)-α-pinene solution and the eucalyptol solution are both 1ug / uL-100ug / uL.

[0040] The (1R)-(+)-α-pinene solution and / or eucalyptol are added into an organic solvent to obtain a termite attractant; the organic solvent comprises one or more of n-hexane, methanol, acetone and ethanol.

[0041] Embodiment 2

[0042] The invention discloses a method for screening an attractant for termites, comprising the following steps:

[0043] S1: Obtain antenna templates and odorant binding protein gene sequences of termites;

[0044] Olfaction plays an important role in insect behavioral responses. Insects' physiological activities such as host location, feeding, courtship, and mating all rely on the olfactory system. Odor-binding proteins are a class of functional proteins that play a key role in the insect peripheral olfactory system. Odor-binding proteins can specifically identify and bind to odor molecules in the external environment and transport odor molecules to the corresponding odor receptors. They are the first step in the odor molecule conduction process in the insect olfactory system. Different species of termites or termites active in different areas have different odor-binding protein genes.

[0045] A large number of termite antennae tissues were collected (about 100 termites as a biological replicate), and RNA was extracted from the termite antennae tissues using Trizol reagent as an antennae template; and 3 biological replicates of RNA were extracted from the termite antennae tissues using Trizol reagent and sent to Shanghai Meiji Biomedical Technology Co., Ltd. for eukaryotic non-reference transcriptome sequencing. The transcriptome data was subsequently analyzed and searched in the NR (Non-Redundant Protein Sequence Database) non-redundant protein database obtained by this transcriptome sequencing to obtain the odor binding protein gene sequence, and the odor binding protein gene sequence was the nucleotide sequence shown in SEQ ID NO.1.

[0046] Eukaryotic reference-free transcriptome sequencing: All messenger ribonucleic acids (mRNA) transcribed in specific tissues of eukaryotic organisms under a specific state are sequenced through high-throughput sequencing technology, the raw data are spliced ​​and assembled, and the obtained transcripts are used as reference sequences for subsequent analysis, providing a powerful technical means for studying gene functions and revealing the molecular mechanisms of specific biological processes.

[0047] S2: Obtain plant volatiles;

[0048] Some active components in plant volatiles can attract insects, and the branches and leaves of camphor trees can attract termites. The present invention directly selects the main volatiles of camphor trees as odor components and purchases pure products of these substances as plant volatiles to be measured. The plant volatiles include various odor components; the plant volatiles include linalool, trans-nerolidol, α-pinene, trans-caryophyllene, (1S)-(-)-camphor, D(+)-camphor, (1R)-(+)-α-pinene, eucalyptol and phellandrene.

[0049] S3: obtaining an odor binding protein gene based on the odor binding protein gene sequence, and expressing the odor binding protein through a prokaryotic expression system based on the odor binding protein gene to obtain the odor binding protein;

[0050] The prokaryotic expression system is a method of using gene cloning technology to construct an expression vector (pET-32a) and introduce it into an expression strain (BL21 (DE3) competent cells) to express the odor binding protein gene (i.e., the exogenous target gene) in a specific Escherichia coli; based on the odor binding protein gene, the odor binding protein is expressed by the prokaryotic expression system, which specifically includes the following sub-steps:

[0051] S31: designing primers based on the odorant binding protein gene sequence, and performing PCR amplification based on the primers and antennae template to obtain the odorant binding protein gene;

[0052] Designing primers includes: designing homology arm primers F: GCCATGGCTGATATCGGATCCG (SEQ ID NO.2); R: GTGGTGGTGGTGGTGCTCGAG (SEQ ID NO.3), performing PCR amplification based on the primers and antenna template to obtain the odorant binding protein gene;

[0053] The reaction system of PCR amplification is, for example: 12.5 μL of enzyme Phanta Max Master Mix, 9.5 μL of water, 1 μL of antenna template with a concentration of 50 ng / μL (i.e., RNA extracted from antenna tissue of termites), and 1 μL of forward and reaction primers (10 μM), and the reaction program is: 95°C pre-denaturation for 3 minutes, 34 cycles including 95°C denaturation for 15 seconds, 55°C annealing for 15 seconds, extension reaction at 72°C for 90 seconds, and finally total extension at 72°C for 5 minutes. After the PCR amplification is completed, agarose gel electrophoresis is performed, and gel recovery is performed using a kit (AxyPrep DNA Gel Extraction Kit) to obtain the gel recovery product, that is, the odorant binding protein gene.

[0054] S32: constructing a genetically engineered bacterium expressing an odor binding protein based on the odor binding protein gene and the plasmid vector;

[0055] The odorant binding protein gene and the plasmid vector are homologously recombined using a kit (ClonExpress Ultra One Step Cloning Kit V2), and the plasmid vector is selected from one of the empty expression vectors pET32a, pET28a and pET39a. The homologous recombination reaction system includes, for example, 1 μL (100 ng) of the plasmid vector, 2 μL of the odorant binding protein gene (20 ng), 5 μL of CE Mix enzyme and 2 μL of water; react in a PCR instrument at 50°C for 5 minutes, and immediately cool on ice to obtain a recombinant product.

[0056] The recombinant product was then added to competent Escherichia coli cells, added to LB liquid culture medium, and cultured at 37°C to extract the recombinant plasmid containing the odor binding protein gene; the recombinant plasmid was sequenced to verify that the reading frame of the recombinant plasmid was correct, and the strain with the completely correct odor binding protein gene was selected, which was the genetically engineered bacteria expressing the odor binding protein.

[0057] For example, add the recombinant product to 50 μL of competent cells and place on ice for 30 minutes; heat shock in a 42°C water bath for 30 seconds, and immediately place on ice to cool for 2 minutes; add 1000 μL of LB liquid culture medium (without adding antibiotics) and shake at 37°C for 1 hour; spread the bacterial solution on a plate containing kanamycin resistance and gently spread it evenly; culture inverted in a 37°C incubator overnight, extract the recombinant plasmid containing the odor binding protein gene and perform sequencing verification.

[0058] S33: Production of odorant binding protein using genetically engineered bacteria expressing odorant binding protein;

[0059] Take 3 μL of the correctly sequenced recombinant plasmid (50 ng / μL) (i.e., the genetically engineered bacteria expressing the odorant binding protein) and transfer it into BL21 (DE3) competent cells, and place it on ice for 30 minutes; heat shock in a 42°C water bath for 45 seconds, and immediately place it on ice for 2 minutes; add 1000 μL of LB liquid culture medium (without adding antibiotics) and shake the culture at 37°C for 1 hour; spread the bacterial solution on a plate containing kanamycin resistance and spread it evenly; invert and culture it in a 37°C incubator overnight; pick a single colony for shaking culture, and when it is 6 When the absorbance at a wavelength of 00 nm is 0.6-0.8, isopropyl-β-D-thiogalactoside (IPTG) is added to perform shaking culture at 37° C. for expansion and induction; the bacterial solution is centrifuged at high speed in a 50 mL centrifuge tube to collect the bacteria, and then the bacteria are disrupted by an ultrasonic cell disruptor; the cells are centrifuged after disruption, and the supernatant is collected (the odor binding protein is determined to be a soluble protein by electrophoresis detection through SDS-PAGE gel, so the odor binding protein is in the supernatant), and the supernatant is purified by Ni NTA agarose magnetic beads (Ni magnetic beads) to obtain the purified odor binding protein; further, the purified odor binding protein is renatured by dialysis in a decreasing urea gradient, and the salt ions are also dialyzed in a decreasing gradient to obtain the odor binding protein for subsequent determination.

[0060] S4: Using a fluorescence competition binding test to determine the binding ability of the odor binding protein with each odor component in the plant volatiles, thereby obtaining the active components of the termite attractant, specifically including:

[0061] S41: The fluorescent probe 1-NPN (N-pheny l-1-naphthy l amine) was selected, and the binding ability of the termite odor binding protein (i.e., the target protein) with the probe was measured at an excitation wavelength of 337 nm using a scanning method (spectrum) at a wavelength of Em = 400-500 nm. Figure 1As shown, the binding constant of termite odor binding protein and 1-NPN is 7.03μmol / L. If the binding constant of odor binding protein and 1-NPN is less than 10μmol / L, 1-NPN is judged to be a suitable probe. The reaction system is a system with a total volume of 250μL, in which 0.05mol / L Tris-HCl buffer is added, 2μmol / L 1-NPN and 2μmol / L odor binding protein are added, and the pH value of the system is 7.4.

[0062] S42: After determining that 1-NPN is a suitable probe, plant volatiles are prepared with methanol to 0.1 μmol / L; 0.05 mol / L Tris-HCl, 2 μmol / L 1-NPN, 2 μmol / L termite odor binding protein and 2 μmol / L-20 μmol / L plant volatiles are added to a system with a total reaction volume of 250 μL, and the change in fluorescence intensity at the maximum emission peak is detected using the endpoint method; Figure 2 As shown, if the fluorescence intensity drops below 50%, it indicates that the plant volatiles have binding activity with termite proteins, thereby screening out the odor components that bind to termite odor binding proteins: (1R)-(+)-α-pinene and eucalyptol; these two plant volatile components can be used as attractants for termites.

[0063] Fluorescence competition binding test refers to the use of the fluorescent probe (1-NPN) with the characteristic of emitting fluorescence. Binding to odor binding protein will be accompanied by a significant increase in fluorescence intensity. The odor components in the added plant volatiles will compete with the fluorescent probe for binding protein. By analyzing the binding ability and selectivity of odor binding protein with different odor components, the odor components that can bind to odor binding protein can be inferred. These odor components can be used as active components of termite attractants.

[0064] The present invention prepares a termite attractant specifically for termites, so as to accurately and efficiently attract termites from hiding places for killing; the attractant for termites has a stable attracting effect and can achieve the effect of accurately attracting termites.

[0065] Embodiment 3

[0066] like Figure 3As shown in the figure, the olfactory behavioral response of termites to (1R)-(+)-α-pinene and eucalyptol can be measured by a Y-shaped olfactometer (the main arm and the two side arms are both 25 cm long and the inner diameter is 5 cm). During the measurement, 10 μL of (1R)-(+)-α-pinene and eucalyptol were evenly dropped on a folded filter paper strip (0.4 cm×4 cm) and placed in a flavor source bottle as the experimental group. A filter paper strip with an equal amount of n-hexane was placed in another flavor source bottle as a control. During the measurement, termites were placed into the Y-shaped tube from the main arm. When they crawled through 1 / 2 of the length of the side arm, the number of choices was recorded and the selection rate was calculated.

[0067] The experimental results show that (1R)-(+)-α-pinene and eucalyptol can significantly attract termites, that is, these two plant volatiles as attractant components can effectively attract termites.

[0068] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

[0069] Sequence Listing

[0070] <110> Hunan Tongda Biotechnology Co., Ltd.

[0071] <120> An attractant for termites and screening method thereof

[0072] <160> 3

[0073] <170> WIPOSequence 2.2.0

[0074] <210> 1

[0075] <211> 483

[0076] <212> DNA

[0077] <213> Artificial Sequence

[0078] <400> 1

[0079] atggcgctgc ttcgctgcct ggtcattcta gcatcttctc agctcttggt gctggtgaat60gcagtaccag cgtctaacgc taaggtggac gtgaaggaaa ttatgaataa gtgcaatgag120agtaacccaa tagacccagc ctacctggat gagtttaaca tgactggcag ttttcctgat180gagaacgtta gacctgccaa gtgtttcatt cgatgtattt ttatggaaac tggactgatg240gattctgaag gcaacttgct agctgacaag ataaaggatg tcttcaaaac gcaccaggaa300cctgtgggca acaaagacgg cgacctggag aatttcgtgg atgcttgtgt aactaagaat360gccgatgtga agtgccagtg cgagagggct tatctcttct ccaagtgcct gatgacacag420gagatattga aaaacggaga cctcagcaag ttgagtggta agagagatga agggggatac 480tga483

[0080] <210>2

[0081] <211>22

[0082]

Claims

1. An attractant for termites, It is characterized in that It includes one or more of (1R)-(+)-α-pinene solution and eucalyptol solution.

2. The attractant according to claim 1, It is characterized in that The concentrations of the (1R)-(+)-α-pinene solution and the eucalyptol solution are both 1ug / uL-100ug / uL.

3. The attractant according to claim 1, It is characterized in that The (1R)-(+)-α-pinene solution or eucalyptol solution is prepared by the following method: The (1R)-(+)-α-pinene solution or eucalyptol solution is added into an organic solvent to obtain a (1R)-(+)-α-pinene solution or eucalyptol solution; the organic solvent comprises one or more of n-hexane, methanol, acetone and ethanol.

4. A method for screening termite attractants, It is characterized in that The following steps are involved: S1: Obtain antenna templates and odorant binding protein gene sequences of termites; S2: Obtain plant volatiles; S3: obtaining an odor binding protein gene based on the odor binding protein gene sequence, and expressing the odor binding protein through a prokaryotic expression system based on the odor binding protein gene to obtain the odor binding protein; S4: using a fluorescence competition binding test to determine the binding ability of the odor binding protein with each odor component in the plant volatiles, thereby obtaining an attractant component for termites.

5. The screening method according to claim 4, It is characterized in that The step S1 comprises: RNA was extracted from the antennae of termites using Trizol reagent as an antennae template; RNA was extracted from the antennae of termites using Trizol reagent, and eukaryotic reference-free transcriptome sequencing was performed to obtain an odorant binding protein gene sequence, wherein the odorant binding protein gene sequence was the nucleotide sequence shown in SEQ ID NO.

1.

6. The screening method according to claim 4, It is characterized in that The plant volatiles include linalool, trans-nerolidol, α-pinene, trans-caryophyllene, (1S)-(-)-camphor, D(+)-camphor, (1R)-(+)-α-pinene, eucalyptol and phellandrene.

7. The screening method according to claim 4, It is characterized in that The step S3 comprises: S31: designing primers based on the odorant binding protein gene sequence, and performing PCR amplification based on the primers and the antennae template to obtain the odorant binding protein gene; S32: constructing a genetically engineered bacterium expressing an odor binding protein based on the odor binding protein gene and the plasmid vector; S33: Production of odorant binding proteins using genetically engineered bacteria expressing odorant binding proteins.

8. The screening method according to claim 7, It is characterized in that The designed primers include: Design homology arm primers F: GCCATGGCTGATATCGGATCCG; R: GTGGTGGTGGTGGTGCTCGAG.

9. The screening method according to claim 4, It is characterized in that The step S4 comprises: S41: 1-NPN was selected as the fluorescent probe; S42: preparing a solution of plant volatiles with methanol; adding Tris-HCl, 1-NPN and termite odor binding protein to the solution, and detecting the change of fluorescence intensity at the maximum emission peak by an endpoint method, thereby screening out attractant components for termites.

10. The screening method according to claim 4, It is characterized in that The attractant component for termites includes (1R)-(+)-α-pinene and / or eucalyptol.

Images