Application of original cilia CCSAP protein in preparation of medicine for treating diabetic osteoporosis

Abstract

The invention discloses application of original cilia CCSAP protein in preparation of a medicine for treating diabetic osteoporosis. The original cilia CCSAP protein has a remarkable effect of treating the diabetic osteoporosis and promotes the expression of marker proteins OCN and OPN for osteogenic differentiation. According to the invention, the action mechanism of the original cilia CCSAP protein for treating the diabetic osteoporosis is defined. The cilia CCSAP protein is located at the top end and the bottom of the cilia of the osteoblast. According to the present invention, the CCSAP is subjected to overexpression, the original cilia of osteoblasts is prolonged, the hedgehog signal channel and the calcium channel are activated, the original cilia CCSAP protein interacts with the SHH and the Gli 1 protein, the original cilia CCSAP protein inhibits the Gli 1 protein ubiquitinated by the high glucose environment, the ubiquitination of the Gli 1 transcription factor is reduced, the amount of the Gli 1 protein is increased, the transcription of the osteogenic differentiation related genes OCN and OPN is activated, and the osteogenic differentiation is promoted;

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and provides application of protociliary CCSAP protein in preparing a drug for treating diabetic osteoporosis. Background Art

[0002] With the improvement of people's living standards, excessive intake of sugar, lipids and proteins has become more and more common, and the incidence of diabetes and the disability and mortality rates of diabetic complications have increased significantly. Diabetic osteoporosis is one of the serious complications caused by diabetes and is a chronic bone metabolic disease. Its specific manifestations include loose teeth, decreased bite force, decreased bone mass throughout the body, increased bone brittleness, decreased bone strength, prone to fractures, and decreased healing function after fractures. Diabetic osteoporosis seriously affects the quality of life of diabetic patients and brings a heavy economic burden to families and society. Therefore, it is of great significance to discover drugs for the treatment of diabetic osteoporosis and to clarify the molecular mechanism of its treatment.

[0003] Osteoporosis exists in diabetic patients, which is closely related to bone metabolism. Recent studies have found that diabetes affects bone metabolism through the following mechanisms: ① Insulin resistance causes osteoblast differentiation disorder and blocks osteocalcin synthesis. ② Accumulation of advanced glycation end products (AGEs) reduces osteoblast proliferation and promotes osteoclast differentiation. ③ Microvascular disease reduces bone blood supply, damages bone microstructure, and reduces bone density. ④ Long-term hyperglycemia inhibits osteoblast proliferation and differentiation and enhances osteoclast activity. ⑤ Diabetic nephropathy affects calcium and phosphorus metabolism, and the endocrine hormones (such as leptin, islet amylin, and bone formation inhibitory glycoprotein) disorders and released cytokines caused by diabetes affect the proliferation and differentiation of osteoblasts and osteoclasts. ⑥ Diabetic patients have lipid metabolism disorders, increased bone marrow adipocytes, mesenchymal stem cells enhance adipose differentiation and inhibit osteoblast differentiation, and adipocytes secrete cytokines that affect osteoblasts and osteoclasts. Although there have been recent advances in diabetic osteoporosis, its pathogenesis is still unclear.

[0004] At present, the treatment of diabetic osteoporosis mainly focuses on promoting osteogenesis and inhibiting osteoclasts. Drugs for the treatment of diabetic osteoporosis include bisphosphonates, denosumab, and estrogen receptor agonists. These drugs produce gastrointestinal reactions, fever, or skeletal muscle pain and other side effects. In addition, basic experimental studies have studied the Chinese medicine Qiangguning, Polygonatum sibiricum polysaccharide, the Chinese medicinal ingredients of Rehmannia glutinosa, triterpenoid saponins extracted from Momordica grosvenori, Rhodiola rosea extract, Pien Tze Huang, Anemarrhena asphodeloides and Phellodendron amurense, naringin, irisin, zoledronic acid, shikonin, etc., but these drugs have a wide range of effects, the effect is not obvious, and the therapeutic mechanism is unclear. Summary of the invention

[0005] In view of this, the object of the present invention is to provide the use of protociliary CCSAP protein in the preparation of a drug for treating diabetic osteoporosis.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] 1. Use of the protociliary CCSAP protein in the preparation of a drug for treating diabetic osteoporosis, wherein the amino acid sequence of the protociliary CCSAP protein is shown in SEQ ID NO.1.

[0008] 2. Use of a reagent for overexpressing the protociliary CCSAP protein, a pharmaceutical composition or a preparation containing the reagent in the preparation of a drug for treating diabetic osteoporosis, wherein the amino acid sequence of the CCSAP protein is shown in SEQ ID NO.1.

[0009] 3. Use of a gene encoding protociliary CCSAP protein in the preparation of a drug for treating diabetic osteoporosis, the nucleotide sequence of the gene being shown in SEQ ID NO.2.

[0010] 4. Use of an agonist of the aforementioned gene, a pharmaceutical composition or a preparation containing the agonist in the preparation of a drug for treating diabetic osteoporosis. The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0011] 5. A drug for treating diabetic osteoporosis, wherein the active ingredient is a reagent for overexpressing the primary ciliary CCSAP protein.

[0012] 6. A drug for treating diabetic osteoporosis, wherein the active ingredient is an agonist of the gene encoding the protociliary CCSAP protein.

[0013] As one of the preferred technical solutions, the diabetic osteoporosis includes but is not limited to: bone loss, decreased bone density, increased risk of fractures, loose teeth, decreased bite force, decreased bone mass, increased bone brittleness, decreased bone strength and easy fractures.

[0014] 7. A high-yield preparation method of primary cilia CCSAP protein, the specific steps are as follows:

[0015] (1) Design of primers: upstream primer 5'-3'ATGTCCCCGGGGAGCGGGGTGA, nucleotide sequence as shown in SEQ ID NO.3, downstream primer 5'-3'TTAAGCTCTTGCCGAATAGCACCT, nucleotide sequence as shown in SEQ ID NO.4;

[0016] (2) Using DNA ligase, the PCR product was connected and inserted into the PET32a prokaryotic expression vector, transformed into DH5α Escherichia coli, and the plasmid was extracted;

[0017] (3) The plasmid was transformed into BL-21 Escherichia coli to express the protociliary CCSAP protein and the protein was purified.

[0018] The beneficial effects of the present invention are:

[0019] The present invention discloses the use of a protociliary CCSAP protein in the preparation of a drug for treating diabetic osteoporosis. The protociliary CCSAP protein has a significant effect on treating diabetic osteoporosis and promotes the expression of osteogenic differentiation marker proteins OCN and OPN. The present invention clarifies the mechanism of action of the protociliary CCSAP protein in treating diabetic osteoporosis. The protociliary CCSAP protein is located at the top and bottom of the protociliary of osteoblasts. Overexpression of CCSAP prolongs the protociliary of osteoblasts, activates the hedgehog signaling pathway and calcium channels, and the protociliary CCSAP protein interacts with SHH and Gli 1 proteins. The protociliary CCSAP protein inhibits Gli 1 proteins ubiquitinated by a high sugar environment, reduces the ubiquitination of Gli 1 transcription factors, increases the amount of Gli 1 proteins, activates the transcription of osteogenic differentiation-related genes OCN and OPN, and promotes osteogenic differentiation.

[0020] The amount of protein expressed by the prokaryotic expression vector constructed by the prior art is too small. In order to obtain a high yield of the protociliary CCSAP protein, this application reconstructs the prokaryotic expression vector for subsequent diabetic cell experiments and diabetic animal experiments. Obtain the human CCSAP (NM_014804) cDNA clone, PET32a prokaryotic expression vector, design restriction sites (HindⅢ, BamHI), use DNA ligase, design upstream and downstream primers, connect the PCR product into the PET32a prokaryotic expression vector, transform DH5α Escherichia coli, extract the plasmid, sequence correctly, and transform the plasmid into BL-21 Escherichia coli to express the protociliary CCSAP protein and purify the protein.

[0021] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0023] Figure 1 This is a diabetic SD rat model, femoral protein western blot results, where A is the western blot result of CCSAP protein, and B is the statistical analysis result of A. (n=3, ****p<0.0001)

[0024] Figure 2 Figure 2 shows the effects of different glucose concentrations and different time gradients of normal glucose and high glucose on the expression of CCSAP protein in primary cilia. The cells are osteoblast precursor cells MC3T3-E1. Among them, a is the Western blot detection of the expression of CCSAP protein in primary cilia in osteoblasts under different glucose concentrations; b is the quantitative analysis of the expression level of CCSAP in osteoblasts under different glucose concentrations in Figure a (n=3, * p<0.05, **** p<0.0001); c is the expression of CCSAP protein in osteoblasts under different time gradients of normal glucose and 25 mM high glucose conditions detected by Western blot; d is the quantitative analysis of the expression level of CCSAP in osteoblasts under different time gradients of normal glucose and 25 mM high glucose conditions in figure c (n=3,

[0025] ** p<0.01, *** p<0.001, **** p<0.0001).

[0026] Figure 3 The effect of different glucose concentrations and different time gradients of normal glucose and high glucose on the expression of TUBA1-C protein. The cells are osteoblast precursor cells MC3T3-E1. Among them, A is the expression of TUBA1-C protein in osteoblasts under different glucose concentrations detected by Western blot; B is the quantitative analysis of the expression level of TUBA1-C in osteoblasts under different glucose concentrations in Figure A (ns=no statistical significance); C is the expression of primary cilia CCSAP protein in osteoblasts under different time gradients of normal glucose and 25mM high glucose conditions detected by Western blot; D is the quantitative analysis of the expression level of CCSAP in osteoblasts under different time gradients of normal glucose and 25mM high glucose conditions in Figure C (ns=no statistical significance).

[0027] Figure 4 The cellular localization study of TUBA1-C found that TUBA1-C protein was localized at the tip of the primary cilia of osteoblasts.

[0028] Figure 5 The expression of CCSAP in rat femoral tissue. A: Western-blot of the expression of CCSAP protein in 13 tissues of rats and statistical analysis. B shows that the CCSAP protein in the cilium is localized at the top and bottom of the cilium of osteoblasts.

[0029] Figure 6High glucose inhibits the expression of CCSAP protein in osteoblastic cilia and shortens the tip of cilia. A: Immunocytochemistry results. B: Statistical analysis of the length of cilia in Figure A. (n = 80 cells, **** p<0.0001).

[0030] Figure 7 Overexpression of CCSAP rescues osteoblast differentiation inhibited by high glucose; A is the statistical analysis result of ALP (alkaline phosphatase activity) detection, (n=3, *** p<0.001, **** p<0.0001), this enzyme is important for determining osteogenic differentiation. High glucose inhibits ALP, while overexpression of CCSAP can restore the inhibitory effect of high glucose on ALP. B is the overexpression of CCSAP to restore the expression of CCSAP protein in the cilia inhibited by high glucose, and reverse the inhibition of osteoblast differentiation by high glucose, western-blot osteogenic differentiation marker protein OPN (osteopontin), OCN (osteocalcine) and CCSAP; C is the statistical analysis of the CCSAP protein data in Figure B; D is the statistical analysis of the OCN protein data in Figure B; E is the statistical analysis of the OPN protein data in Figure B. (n=3, * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001).

[0031] Figure 8 To successfully construct the prokaryotic expression vector human gene CCSAP; among them, the left lane 1 is the DNA marker, the left lane 2 is the original PET32a-CCSAP plasmid without enzyme digestion, and the right lanes 1, 2, and 3 are the results of BamHI and HindIII double enzyme digestion of PET32a-CCSAP plasmid. It can be seen that the gene CCSAP band is above 750bp of the DNA marker, and the band size is correct, about 813bp.

[0032] Fig. 9 The PET32a-CCSAP plasmid was sent to Shanghai Bioengineering for sequencing and the results were correct.

[0033] Fig.10The expression level of CCSAP protein in the cilia of three different osteoblasts during osteogenic differentiation. A: Western-blot of MSC cells; B: Western-blot of MC3T3-E1 cells; C: Western-blot of ROB cells; D: Western-blot of ALP and OCN proteins in MC3T3-E1 cells; Figure E is the statistical analysis result of Figure D. F: Statistical analysis result of ALP activity in MC3T3-E1 cells. Figure G is the result of Alizarin red staining of MC3T3-E1 cells. Figure H is the statistical analysis result of Figure G. (n=3, * p<0.05, ** p<0.01, *** p<0.001, ns=not statistically significant).

[0034] Fig.11 To prove that overexpression of CCSAP promotes osteogenic differentiation. Figure A is a western blot of overexpression of CCSAP; Figure B is a statistical analysis of Figure A (n=3, ** p<0.01); Figure C shows overexpression of CCSAP, detection of ALP activity and statistical analysis (n=3, * p<0.05); Figure D shows overexpression of CCSAP, western blot detection of OCN and OPN; Figure E shows the statistical analysis of Figure D (n=3, *** p<0.001; Figure F shows overexpression of CCSAP, stained with Alizarin red. Figure G shows statistical analysis of Figure F (n=3, *** p<0.001).

[0035] Fig.12 To prove that overexpression of CCSAP affects cell cycle and apoptosis. A is a western blot of cyclinD1 and CyclinE1; B is a statistical analysis of A (n=3, *** p<0.001). Figure C shows the results of cell cycle detection; Figure D shows the statistical analysis of the results of Figure C (n=3, ** p<0.01, *** p<0.001). Figure E shows the results of cell apoptosis detection; Figure F shows the statistical analysis of Figure E (n=3, *** p<0.001).

[0036] Fig.13To prove that overexpression of CCSAP prolongs the growth of osteoblastic cilia. A shows that osteoblasts MC3T3-E1 were cultured for a longer time with osteogenic differentiation, and cilia-related protein antibodies acetylated α-tubulinantibody and γ-tubulin were used for western blot; B shows the statistical analysis of the results of Figure A. (n=3, *** p<0.001, ns=no statistical significance). Figure C shows overexpression of CCSAP and western blot with antibodies against protocilia-associated proteins; D shows statistical analysis of the results of Figure C. (n=3, ** p<0.01, *** p<0.001). Figure E shows immunofluorescence staining of cells overexpressing CCSAP, acetylated α-tubulin antibody, and γ-tubulin. Figure F shows statistical analysis of the length of cilia in Figure E (n=80 cells, *** p<0.001).

[0037] Fig.14 To confirm that overexpression of CCSAP activates calcium channels and hedgehog signaling pathways. Figure A shows MC3T3-E1 cells overexpressing CCSAP, extracting cell proteins, and using calcium channel protein CAMK2B and PLN antibodies for western blot; Figure B shows the statistical analysis of Figure A (n=3, *** p<0.001). C is the cell MC3T3-E1 overexpressing CCSAP, the cell protein was extracted, and the Hedgehog signaling pathway related antibodies were used for western blot; D is the statistical analysis of C (n=3, *** p<0.001).

[0038] Fig.15 CCSAP promotes osteogenic differentiation by activating calcium channels and Hedgehog signaling pathways. Figure A: Calcium antagonist (Aml) treated cells, western blot of calcium channel proteins CAMK2B and PLN; Figure B: Statistical analysis of Figure A (n=3, * p<0.05, *** p<0.001); C: cells treated with calcium antagonist (Aml), western blot on Hedgehog signaling pathway related proteins SHH and SUFU; D: statistical analysis of C (n=3, * p<0.05, ** p<0.01, ***p<0.001); Figure E: cells treated with calcium antagonist (Aml), western blot on osteogenic differentiation-related proteins OCN and OPN; Figure F: statistical analysis of Figure E (n=3, ** p<0.01, *** p<0.001); Figure G shows the statistical analysis results of ALP activity in MC3T3-E1 cells. (n=3, * p<0.05, ** p<0.01); Figure H shows cells treated with cyclopamin, an inhibitor of the Hedgehog signaling pathway, and western blot analysis of SHH and SUFU, proteins related to the Hedgehog signaling pathway; Figure I shows statistical analysis of Figure H (n=3, *** p<0.001); J shows cells treated with cyclopamin, an inhibitor of the Hedgehog signaling pathway, and western blots on calcium channel proteins CAMK2B and PLN; K shows statistical analysis of J (n=3, * p<0.05, *** p<0.001, ns=no statistical significance). Figure L shows cells treated with cyclopamin, an inhibitor of the Hedgehog signaling pathway, and western blots for osteoblast-related proteins OCN and OPN; Figure M shows statistical analysis of Figure L (n=3, *** p<0.001); Figure N shows the statistical analysis of ALP activity in MC3T3-E1 cells treated with cyclopamin, an inhibitor of the Hedgehog signaling pathway (n=3, *** p<0.001).

[0039] Fig.16 Immunoprecipitation experiments confirmed that the CCSAP protein in the pilus interacts with SHH. The CCSAP protein in the pilus interacts with Gli1 but not with Gli2. Overexpression of CCSAP inhibits the ubiquitination and degradation of Gli1 protein. A shows the interaction between the CCSAP protein in the pilus and SHH protein; B shows the interaction between the CCSAP protein in the pilus and Gli1 protein; C shows the lack of interaction between the CCSAP protein in the pilus and Gli2; D shows that overexpression of CCSAP inhibits the ubiquitination and degradation of total cellular proteins; E shows that overexpression of CCSAP inhibits the ubiquitination and degradation of the CCSAP protein in the pilus; F shows that overexpression of CCSAP inhibits the ubiquitination and degradation of Gli1 protein; G shows that overexpression of CCSAP inhibits the ubiquitination and degradation of the CCSAP protein and Gli1 protein in the pilus. DETAILED DESCRIPTION

[0040] The present invention will be further described below in conjunction with specific implementation modes.

[0041] 1. Twelve 8-week-old male SD rats were purchased (Animal House, Chongqing Medical University) and divided into two groups, 6 rats in each group. The control group was injected with the same dose of sodium chloride, and the diabetic model group was injected with streptozotocin (STZ) (Shanghai Biotechnology) dissolved in sodium citrate buffer (50 mM, pH = 4.5) with a final concentration of 100 mg / mL. The diabetic group was injected with STZ (1 mL / kg) intramuscularly. One week later, the blood glucose was greater than 250 mg / dL (13.89 mmol / L). After 90 days, the rats were anesthetized and killed, and the femurs were taken to extract proteins. Western blot was performed using rabbit anti-CCSAP antibodies (1:1000, YN3925, ImmunoWay, Plano, TX, USA) and GAPDH (1:1000, YT5052, ImmunoWay, Plano, TX, USA). The expression of CCSAP protein in the femur of diabetic mice was significantly lower than that in normal mice, suggesting that diabetes inhibits the expression of CCSAP protein in the cilia of bone tissue. Figure 1 result.

[0042] 2. The diabetic cell model has concentration gradient and time gradient to inhibit the expression of CCSAP protein in osteoblastic cilia. The osteoblast precursor cell line MC3T3-E1 cells were purchased from Shanghai Institute of Biochemistry and Cell Biology. MC3T3-E1 cells were treated with different concentrations of glucose, 5.5mM, 11mM, 25mM, and 45mM for three days, and the cell proteins were extracted. 20ug of samples were loaded, and western blot was performed using antibodies CCSAP and GAPDH. MC3T3-E1 cells were treated with different concentrations of glucose, 5.5mM and 25mM, for 1 day, 3 days, 5 days and 7 days, respectively, and the cell proteins were extracted again. 20ug of samples were loaded, and western blot was performed using antibodies CCSAP and GAPDH. See Figure 2 .

[0043] Depend on Figure 1 and Figure 2 It can be seen that both diabetic animal model and diabetic cell model experiments have confirmed that diabetes inhibits the expression of osteogenesis-related ciliary CCSAP protein.

[0044] 3. The diabetic cell model does not change the expression of TUBA1-C protein in osteoblasts. MC3T3-E1 cells were treated with different concentrations of glucose, 5.5mM, 11mM, 25mM, and 45mM for three days, and the cell proteins were extracted. 20ug of the sample was loaded, and western blot was performed using the antibody TUBA1-C (1:1000, D123443, Shanghai Bioengineering) and GAPDH. MC3T3-E1 cells were treated with different concentrations of glucose, 5.5mM and 25mM, for 1 day, 3 days, 5 days, and 7 days, respectively. The cell proteins were extracted again, and 20ug of the sample was loaded. Western blot was performed using the antibody TUBA1-C (1:1000, D123443, Shanghai Bioengineering) and GAPDH. See Figure 3 .

[0045] As a negative control, high glucose specifically inhibited the expression of CCSAP protein in the ciliary follicles of osteoblasts, but did not inhibit the expression of TUBA1-C protein in a concentration-dependent and time-dependent manner.

[0046] 4. TUBA1-C protein is localized at the tip of osteoblastic cilia. Cell immunofluorescence chemistry. MC3T3-E1 cells were cultured with 5.5 mM glucose, fixed with methanol, and incubated with primary antibodies, acetylated α-tubulin antibody (1:1000, T6793), TUBA1-C antibody (1:1000, D123443, Shanghai Biotech) at 4°C overnight, washed three times with TTBS (TBS-Tween 20), 5 minutes each time, and then incubated with secondary antibodies for 1 hour at room temperature, rabbit anti-568 (1:1000, A-11011, Invitrogen) or mouse anti-647 (1:1000, A21235, Invitrogen), washed three times with TTBS, 5 minutes each time, and then stained with DAPI (4',6-diamidino-2-phenylindole, 1:1000, Sigma) at room temperature for 10 minutes. The images were taken using a fluorescence microscope (DM4000, Leica, Germany). It can be seen that the red TUBA1-C protein overlaps with the green acetylated α-tubulin at the top of the primary cilium. Figure 4 .

[0047] 5. CCSAP protein is expressed in moderate amounts in bone tissue, and CCSAP protein is localized at the top and bottom of the primary cilia of osteoblasts. In order to further study the specific expression pattern of CCSAP, the applicant identified the expression of primary cilia CCSAP protein in 13 different tissues of SD rats. The results showed that primary cilia CCSAP protein was highly expressed in the lungs, heart and brain of rats; moderately expressed in bones, skin, eyes, testicles and intestinal tissues; lowly expressed in stomach, kidney and spleen tissues, and almost not expressed in liver and muscle. ( Figure 5 Middle A)

[0048] In order to determine the localization of CCSAP in the primary cilia of osteoblasts MC3T3-E1, the applicant performed cell immunofluorescence experiments. MC3T3-E1 cells were fixed with methanol and incubated with primary antibodies, acetylated α-tubulin antibody (1:1000, T6793), γ-tubulin antibody (1:1000, T3320), and CCSAP antibody (1:1000, YN3925, ImmunoWay, Plano, TX, USA), overnight at 4°C, washed three times with TTBS for 5 min each time, and then incubated with secondary antibodies for 1 h at room temperature, Alexa Fluor 568-conjugated anti-rabbit (1:1000, A-11011, Invitrogen) or Alexa Fluor 647-conjugated anti-mouse (1:1000, A21235, Invitrogen), washed three times with TTBS for 5 min each time, and then stained with DAPI (1:1000, Sigma) for 10 min at room temperature. Photographed under a fluorescence microscope (DM4000, Leica, Germany). It can be seen that the red CCSAP protein in the protocilia overlaps with the green acetylated α-tubulin at the top of the protocilia. It can also be seen that the red CCSAP protein in the protocilia overlaps with the green r-tubulin at the bottom of the protocilia. This indicates that CCSAP is specifically distributed at the top of the protocilia along the long axis of the protocilia, and also at the bottom of the protocilia. ( Figure 5 Middle B)

[0049] 6. High glucose inhibits the formation of osteoblastic cilia and reduces the expression of cilia CCSAP protein.

[0050] The morphology of primary cilia of MC3T3-E1 cells induced by high glucose was detected by cell immunofluorescence experiment.

[0051] MC3T3-E1 cells were cultured with 5.5mM and 25mM glucose for three days, fixed with methanol, and then added with primary antibodies, acetylated tubulin antibody (1:1000, T6793), CCSAP (1:1000, YN3925, ImmunoWay, Plano, TX, USA), overnight at 4°C, washed three times with TTBS, 5 minutes each time, and then incubated with secondary antibodies for 1 hour at room temperature, rabbit anti-568 (1:1000, A-11011, Invitrogen) or mouse anti-647 (1:1000, A21235, Invitrogen), washed three times with TTBS, 5 minutes each time, and then stained with DAPI (1:1000, Sigma) for 10 minutes at room temperature. Photographs were taken with a fluorescence microscope (DM4000, Leica, Germany). The results showed that compared with the control group, the length of the cilia in the high glucose group was shortened, and the expression of CCSAP on the cilia was also reduced accordingly. The above results indicate that diabetes may inhibit osteoblast differentiation and mineralization by affecting the biosynthesis of cilia.

[0052] ( Figure 6 )

[0053] 7. Overexpression of CCSAP reverses high glucose inhibition of osteoblast differentiation. MC3T3-E1 cells were treated with different glucose concentrations and divided into three groups (5.5mM, 25mM, 25mM+pcDNA3.1-CCSAP, mouse CCSAP full-length gene (GeneID: 126731) cDNA inserted into vector pcDNA3.1(+)). After three days of treatment, cell proteins were extracted and ALP (alkaline phosphatase activity) in cell proteins was measured (see Figure 7 A), western-blot experiments were performed using primary antibodies OPN (1:1000, 225952-1-AP, Proteintech, Rosemont, IL, USA), OCN (1:1000, ab133612), CCSAP (1:1000, YN3925, ImmunoWay, Plano, TX, USA) and GAPDH (see Figure 7 (B, C, D, E). The results showed that overexpression of CCSAP significantly reversed the inhibitory effect of high glucose on osteoblast differentiation.

[0054] 8. Successfully constructed the human CCSAP (NM_145257) prokaryotic expression vector PET32a-CCSAP. Designed primers: upstream primer 5'-3'ATGTCCCCGGGGAGCGGGGTGA (SEQ ID NO.3), downstream primer 5'-3'TTAAGCTCTTGCCGAATAGCACCT (SEQ ID NO.4). Using DNA ligase, the PCR product was connected and inserted into the PET32a prokaryotic expression vector (Changsha Youbao Biological. VT1216), transformed into DH5α Escherichia coli, extracted plasmid, and digested with restriction enzymes BamHI and HindIII. The gel electrophoresis results showed ( Figure 8 ), the plasmid without double enzyme digestion had only one band larger than 5000bp, but the plasmid with double enzyme digestion had two bands, one larger than 750bp, which matched the 813bp band of the theoretical CCSAP gene. The plasmid was transformed into BL-21 Escherichia coli (Changsha Youbao Bio, ST1006) to express the protociliary CCSAP protein, and the protein was purified.

[0055] 9. Shanghai Biotech CCSAP gene sequencing is correct. The bacteria were grown at 37℃ overnight, and the OD value was measured. The bacteria were in the logarithmic growth phase. The PET32a-CCSAP plasmid was extracted and sent to Shanghai Biotech for sequencing. The 813 bases were completely correct (see Fig. 9 ).

[0056] The study found that the expression of CCSAP protein in the femur of diabetic mice was lower than that in normal mice. The diabetic cell model also confirmed this result, and it was found that CCSAP protein was localized on the cilia of osteoblasts. Surprisingly, TUBA1-C protein was also localized on the cilia of osteoblasts, but high glucose did not change the expression of TUBA1-C protein in osteoblasts, which proved that high glucose specifically reduced the expression of CCSAP protein in the cilia of osteoblasts. The applicant's study further found that overexpression of CCSAP restored the differentiation effect of high glucose on osteoblasts. Then, the applicant studied the molecular mechanism by which CCSAP protein enhances the osteogenic differentiation of osteoblasts.

[0057] First, the applicant used three different cells (primary isolated mouse mesenchymal stem cells MSC Fig.10 Medium A, MC3T3-E1 Fig.10In B, primary isolated femoral osteoblasts (ROBs) of young mice were induced with osteogenic differentiation medium for 0 days, 7 days, 14 days and 21 days, and cell proteins were extracted. Western blot of the primary cilia CCSAP protein was performed. The results showed that the longer the induction time of osteogenic differentiation, the higher the expression of CCSAP in these three osteoblasts. The protein of MC3T3-E1 cells treated in the same way was used to perform western blot of the bone differentiation marker proteins ALP and OCN. It was also found that the expression of these two osteogenic differentiation marker proteins also gradually increased, and the ALP activity also had the same trend. Alizarin red staining also achieved the same results ( Fig.10 ).

[0058] Furthermore, overexpression of CCSAP was found to activate ALP activity, promote the expression of osteogenic differentiation marker proteins OCN and OPN protein, and promote the enhancement of Alizarin red staining. The results showed that overexpression of CCSAP promoted the differentiation of osteoblasts. Fig.11 )

[0059] The applicant also found that overexpression of CCSAP promoted the increase in the expression of cyclins CyclinD1 and CyclinE1 in osteoblasts, increased the G1 and S phases of the cell cycle, inhibited the G2 phase, and inhibited cell apoptosis. Fig.12 )

[0060] The applicant also found that MC3T3-E1 cells were induced in osteogenic differentiation medium for 0 days, 7 days, 14 days and 21 days, and cell proteins were extracted and western blot was performed for acetylated α-tubulin protein and r-tubulin protein. The results showed that as the osteoblast differentiation time increased, the expression of acetylated α-tubulin protein at the top of the cilium and r-tubulin protein at the bottom increased. Overexpression of CCSAP promoted the expression of acetylated α-tubulin and r-tubulin proteins in the cilium and extended the cilium. ( Fig.13 )

[0061] The applicant further found that overexpression of CCSAP increased the expression of calcium channel proteins CAMK2B and PLN, and also promoted the expression of hedgehog signaling pathway-related proteins SHH, SUFU, Gli1, and Gli2. Fig.14 )

[0062] Next, the applicant used the specific antagonist of calcium channel, amlodipine (Aml), to overexpress CCSAP, which could reverse the inhibitory effect of the specific antagonist of calcium channel, amlodipine (Aml), on calcium channel proteins CAMK2B and PLN, the inhibitory effect on Hedgehog signaling pathway related proteins SHH and SUFU, as well as the inhibitory effect on osteogenic differentiation marker proteins OCN and OPN proteins and the inhibitory effect on ALP activity. The applicant used the specific antagonist of Hedgehog signaling pathway, Cyclopamine (021M4704V), to overexpress CCSAP, which promoted the expression of calcium channel proteins CAMK2B and PLN proteins, the inhibitory effect on Hedgehog signaling pathway related proteins SHH and SUFU, as well as the inhibitory effect on osteogenic differentiation marker proteins OCN and OPN proteins and the inhibitory effect on ALP activity. ( Fig.15 )

[0063] The applicant also found that CCSAP protein interacts with SHH and Gli1 respectively, but not with Gli2 protein. Overexpression of CCSAP inhibits the ubiquitination and degradation of proteins, especially the ubiquitination and degradation of Gli1, a key transcription factor in the Hedgehog signaling pathway, thereby preserving more transcription factor Gli1 protein in cells, activating the transcription of OCN and OPN, key genes for osteogenic differentiation, and promoting osteogenic differentiation. Fig.16 )

[0064] Based on the above research, the applicant speculates that CCSAP promotes the growth of osteoblastic cilia, activates calcium channels and Hedgehog signaling pathways, inhibits the ubiquitination of Gli1 transcription factors, and more Gli1 proteins activate the transcription of OCN and OPN, key genes for osteogenic differentiation. OCN and OPN, marker proteins of osteogenic differentiation, are expressed more, promoting osteogenic differentiation. Fig.16 )

[0065] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. The use of protociliary CCSAP protein in the preparation of a drug for treating diabetic osteoporosis, characterized in that: The amino acid sequence of the protociliary CCSAP protein is shown in SEQ ID NO.

1.

2. Use of an agent for overexpressing protociliary CCSAP protein, a pharmaceutical composition or a preparation containing the agent in the preparation of a drug for treating diabetic osteoporosis, characterized in that: The amino acid sequence of CCSAP protein is shown in SEQ ID NO.

1.

3. Use of a gene encoding a protociliary CCSAP protein in the preparation of a drug for treating diabetic osteoporosis, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

4. Use of the agonist of the aforementioned gene, a pharmaceutical composition or a preparation containing the agonist in the preparation of a drug for treating diabetic osteoporosis, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

5. A drug for treating diabetic osteoporosis, characterized in that: The active ingredient is a reagent for overexpressing the primary ciliary CCSAP protein.

6. A drug for treating diabetic osteoporosis, characterized in that: Its active ingredient is an agonist of the gene encoding the protociliary CCSAP protein.

7. A high-yield preparation method of primary cilia CCSAP protein, characterized in that: The specific steps are as follows: (1) Design of primers: upstream primer 5'-3'ATGTCCCCGGGGAGCGGGGTGA, nucleotide sequence as shown in SEQ ID NO.3, downstream primer 5'-3'TTAAGCTCTTGCCGAATAGCACCT, nucleotide sequence as shown in SEQ ID NO.4; (2) Using DNA ligase, the PCR product was connected and inserted into the PET32a prokaryotic expression vector, transformed into DH5α Escherichia coli, and the plasmid was extracted; (3) The plasmid was transformed into BL-21 Escherichia coli to express the protociliary CCSAP protein and the protein was purified.

Images