A preparation binding to Acinetobacter baumannii AbaR protein and its application

Abstract

The present invention belongs to the field of pharmaceutical technology and relates to a preparation that binds to the AbaR protein of Acinetobacter baumannii and its application. The present invention utilizes sansinol O to effectively bind to the AbaR protein in Acinetobacter baumannii, thereby inhibiting its AHL quorum sensing system. It has been confirmed that sansinol O can significantly inhibit the biofilm formation ability of Acinetobacter baumannii ATCC 19606 strain, reduce bacterial motility, and reduce bacterial toxicity to cells, without significantly affecting bacterial growth and causing selective pressure to promote bacterial evolution of drug resistance.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology and relates to an Acinetobacter baumannii AbaR protein binding preparation and application thereof. Background Art

[0002] Acinetobacter baumannii is a common Gram-negative bacterium that can colonize multiple tissue sites in the human body and cause a variety of infections, including but not limited to bacteremia, pneumonia, meningitis, peritonitis, endocarditis, and urinary tract and wound skin infections. Currently, the control of Acinetobacter baumannii infections mainly relies on various antibiotics, but the widespread use of antibiotics has led to a serious problem of microbial resistance.

[0003] Over the past few decades, Acinetobacter baumannii has developed resistance to a wide range of antimicrobial agents due to its complex resistance mechanisms and ability to readily acquire resistance genes from external sources. The emergence and spread of carbapenem-resistant A. baumannii (CRAB), multidrug-resistant A. baumannii (MDR-AB), and exogenously drug-resistant A. baumannii (XDR-AB) strains have exacerbated the challenges of clinical infection control. Currently, clinical treatment for infections caused by multidrug-resistant A. baumannii often involves combination therapy, with commonly used drugs including sulbactam, polymyxins, and tigecycline. However, these drugs have significant side effects and may disrupt the healthy human microbiome. The evolution of resistance is closely linked to clinical drug use, and continued reliance on antibiotics may further induce A. baumannii to evolve even stronger resistance.

[0004] When bacteria grow to a certain density, they secrete quorum sensing signaling molecules (quorum sensing signals) for intra- and interspecies communication, coordinating the release of virulence factors, influencing the host microecology and physiological environment, and enhancing bacterial tolerance to antimicrobial drugs and extreme environments. Acinetobacter baumannii possesses a typical LuxI / LuxR quorum sensing signaling system network, consisting of the AHL synthase AbaI, the AHL receptor, and the transcriptional activator AbaR. After AbaR binds to the AHL signaling molecule, the complex binds to the promoter region of the target gene, controlling the expression of downstream genes and, in turn, regulating the biological functions of the A. baumannii population, including virulence factor expression, plasmid transformation, motility, secretion of antimicrobial compounds, bacterial adhesion, biofilm formation, and antibiotic tolerance. Therefore, AbaR is a potential antimicrobial target for the development of A. baumannii quorum sensing inhibitors.

[0005] Currently, clinical treatment for infections caused by multidrug-resistant Acinetobacter baumannii often involves combination therapy, with commonly used drugs including sulbactam, polymyxins, and tigecycline. However, these drugs have significant side effects and may disrupt the structure of healthy human microbiota. The evolution of drug resistance is closely related to clinical drug use, and continued reliance on antibiotic treatment may further induce Acinetobacter baumannii to evolve stronger drug resistance. Summary of the Invention

[0006] The purpose of the present invention is to address the above-mentioned problems existing in the prior art. The present invention provides an Acinetobacter baumannii AbaR protein binding preparation that can specifically inhibit bacterial pathogenicity, has high safety, and does not cause Acinetobacter baumannii to develop drug resistance.

[0007] The object of the present invention can be achieved by the following technical solutions: A preparation binding to AbaR protein of Acinetobacter baumannii, wherein the preparation is prepared from moracin O, and the structural formula of moracin O is shown below:

[0008]

[0009] The present invention also provides an application of the combined preparation in preparing a pharmaceutical composition against Acinetobacter baumannii.

[0010] In the above applications, the anti-Acinetobacter baumannii pharmaceutical composition includes drugs for preventing and / or treating Acinetobacter baumannii infection or drugs for preventing and / or treating infectious diseases caused by Acinetobacter baumannii.

[0011] In the above applications, the pharmaceutical composition further contains pharmaceutically acceptable excipients.

[0012] In the above application, the pharmaceutical excipient is selected from at least one of water, a surfactant, a diluent, an antioxidant, a stabilizer, and a solubilizer.

[0013] In the above application, the dosage form of the pharmaceutical composition is a solid preparation, a liquid preparation or a semisolid preparation.

[0014] In the above application, the pharmaceutical composition is at least one of a tablet, a capsule, and an injection.

[0015] In the above application, the effective concentration of the Sancin O against Acinetobacter baumannii is ≥50 μM.

[0016] In the above application, the effective concentration of the Sancin O against Acinetobacter baumannii is ≥100 μM.

[0017] In the above application, the effective concentration of the Sancin O against Acinetobacter baumannii is ≥200 μM.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. The present invention utilizes sansinol O to effectively bind to the AbaR protein in Acinetobacter baumannii, thereby inhibiting its AHL quorum sensing system. It has been confirmed that sansinol O can significantly inhibit the biofilm formation ability of Acinetobacter baumannii ATCC 19606 strain, reduce bacterial motility, and reduce bacterial toxicity to cells without significantly affecting bacterial growth, causing selective pressure that prompts the bacteria to evolve drug resistance.

[0020] 2. The present invention utilizes sansinol O to reduce the production of AHL signaling molecules and downregulate the transcription level of the AHL synthase encoding gene abaI. These effects indicate that sansinol O is a potential effective antibacterial drug candidate that can specifically inhibit the pathogenicity of Acinetobacter baumannii without causing bacterial resistance, thereby providing a safe and effective method for treating multidrug-resistant Acinetobacter baumannii infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the MST result diagram of the in vitro binding of Moracin O to AbaR protein in Example 1;

[0022] Figure 2 This is a graph showing the results of Example 1 showing the inhibition of motility, biofilm formation, and cytotoxicity of strain ATCC 19606 by sansin O; DMSO was used as the control group; the data are the average results of three biological experiments, and the error bars reflect the standard deviation;

[0023] Figure 3 This is a graph showing the effect of sansin O on the growth rate of strain ATCC 19606 in Example 1; DMSO was used as the control group; the data shown are the average results of three biological experiments, and the error bars reflect the standard deviation;

[0024] Figure 4 This is the effect of Sancin O on the AHL signal production of Acinetobacter baumannii strain ATCC 19606 in Example 1; an equal volume of DMSO was used as a control group; the data are the average results of three biological experiments, and the error bars reflect the standard deviation;

[0025] Figure 5 This is Example 1. The effect of sansinol O on the transcription level of the genes encoding AHL signal synthase and receptor in Acinetobacter baumannii strain ATCC 19606; DMSO was used as a control; the results shown are the average results of three biological experiments, and the error bars reflect the standard deviation. DETAILED DESCRIPTION

[0026] The following are specific embodiments of the present invention, which further describe the technical solutions of the present invention, but the present invention is not limited to these embodiments.

[0027] Example 1:

[0028] In vitro binding experiment of sansin O and AbaR protein.

[0029] The construction method of pET28a-AbaR expression vector is as follows:

[0030] The primer sequences designed to amplify the target gene fragment are:

[0031] pET28a-Aba-F:

[0032] CAGCAAATGGGTCGCGGATCCCAATTTGATAAAGTCGACACAGC;

[0033] pET28a-Aba-R:

[0034] TTGTCGACGGAGCTCGAATTCTTAAACTTCAATCAAGCATGCAAA;

[0035] The target gene was amplified using genomic DNA from Acinetobacter baumannii ATCC 19606 as a template, and the PCR product was recovered. pET-28a plasmid DNA was extracted and double-digested with BamHI and EcoRI. The digested plasmid DNA was recovered for later use. The recovered PCR product and the digested plasmid were ligated using Norwegian recombinase (C112), and the ligated product was transformed into BL21 (DE3) competent cells. Positive clones were screened on LB plates (containing 50 μg / mL kanamycin). Single clones were selected for PCR identification and sequenced to obtain positive clones.

[0036] The constructed pET28a-AbaR protein expression vector was transformed into the BL21 (DE3) expression strain and then plated on an LB plate containing 50 μg / mL kanamycin (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, and the solvent was ddH2O), and cultured in a 37°C constant temperature incubator overnight; after a single colony grew and was verified by PCR, a positive single colony was picked and inoculated into LB culture medium containing the corresponding resistance (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, and the solvent was ddH2O), and cultured at 37°C with shaking overnight; 10 mL of the overnight culture solution was taken and inoculated into 1 L LB culture medium (containing kanamycin), and the culture was continued with shaking at 37°C until the OD 600When the pH value was approximately 0.6-0.8, IPTG was added to the bacterial culture to a final concentration of 500 μM and the culture was shaken overnight at 16°C and 200 rpm. The cells were harvested by centrifugation at 4000 rpm for 30 minutes at 4°C, and 50 mL of 1× PBS buffer was added to the cells to thoroughly suspend them. The cells were disrupted using an ultrasonic cell disruptor. The supernatant was collected by centrifugation at 8000 rpm for 30 minutes at 4°C, and the 6хHis fusion protein was purified using a Ni Sepharose™ Excel affinity chromatography column. The fusion protein tag was cleaved using thrombin protease at 4°C. The cleaved fusion protein was eluted and separated, and analyzed by SDS-PAGE.

[0037] The MST binding experiment of Sancin O to AbaR protein was performed using the L001 Monolith NT.115 protein labeling kit and the Monolith NT.115 instrument instructions. The binding constant (K d )Evaluate the experimental results.

[0038] Example 2:

[0039] Antibacterial activity test of Sancin O:

[0040] S1. Culture conditions of Acinetobacter baumannii ATCC 19606 strain: growth temperature of 37°C, rotation speed of 220 rpm / min, and LB medium.

[0041] Effects of Sangsin O on the biofilm of Acinetobacter baumannii strain ATCC 19606: Acinetobacter baumannii activated overnight on LB plates was inoculated into the culture medium and cultured until the exponential growth phase; the initial OD value of the bacterial solution was measured. 600 Dilute the bacterial solution to OD 600 About 0.1; different concentrations (200mM, 100mM, 50mM) of Sancin O solution (dissolved in DMSO solvent, equal volume of DMSO as control) were added to the above bacterial solution at a volume ratio of 1:1000 and mixed. The above bacterial solution was transferred to a 96-well plate, 100μL per well; incubated at 37℃ for 24h and then the 96-well plate was taken out; after discarding the bacterial solution, 100μL of 0.1% crystal violet was added to each well and incubated at 37℃ for 0.5h; the crystal violet was discarded; and ddH2O was added to wash several times; after drying, each well was re-dissolved with 100μL of 95% ethanol. The optical density (OD) of the solution at 570nm was measured. 570 ) to quantify biofilm formation. Experiments were repeated at least three times.

[0042] S3. Determination of the effect of sansin O on the growth of Acinetobacter baumannii strain ATCC 19606: The glycerol strain was activated on LB plates, and then a single colony was picked and inoculated into LB medium and cultured overnight with shaking; the initial OD value of the bacterial solution was measured. 600 Dilute the bacterial solution to OD 600 =0.01 or OD 600 = 0.1; 50mM, 100mM, and 200mM sansin O solutions (dissolved in DMSO, with an equal volume of DMSO as a control) were added to the above bacterial suspension at a volume ratio of 1:1000 and mixed. 100μL of the above bacterial suspension was added to a 96-well growth curve assay plate. Growth curve data were measured using an automated growth curve analyzer and plotted. The experiment was repeated at least three times.

[0043] S4. Effect of Sancin O on the motility of Acinetobacter baumannii strain ATCC 19606: A single colony of Acinetobacter baumannii activated overnight on an LB plate was inoculated into liquid LB medium and cultured until the exponential growth phase. A motility semisolid medium (10% tryptone, 5% sodium chloride, 3% agar) containing 200 μM, 100 μM, or 50 μM Sancin O was prepared. 1 μL of the bacterial suspension was then inoculated into the center of the motility medium plate and incubated at 37°C for 8 h before observing motility patterns.

[0044] Effects of S5 and Sangsin O on the toxicity of Acinetobacter baumannii strain ATCC 19606 cells: The cell line selected was A549 cells, and the culture medium was DMEM (10% FBS). The culture was carried out in an incubator at 37°C and 5% CO2. The lactate dehydrogenase activity was measured by a microplate reader to evaluate the toxicity level of Acinetobacter baumannii infecting cells. This experiment used the cytoTOX96 kit from Promega. The following operations were performed according to the kit instructions: the Acinetobacter baumannii glycerol bacteria were activated on the LB plate, a single colony was picked and inoculated into 10 mL of fresh liquid LB, and cultured overnight; the bacterial solution was centrifuged at 4000 rpm, the supernatant was discarded, the bacteria were resuspended with DMEM (1% FBS) culture medium, and the bacterial solution OD was adjusted. 600 The concentration of sansin O solution (dissolved in DMSO solvent, with an equal volume of DMSO as control) was 0.1; the solution was added to the above bacterial solution at a volume ratio of 1:1000 to make the final concentrations of 200μM, 100μM, and 50μM. A549 cells were cultured in DMEM medium supplemented with 10% FBS at a rate of 1×10 5The cells were grown in a 96-well tissue culture plate at a density of 100 cells / well until adhered to the plate. The cell culture medium was aspirated and washed twice with sterile 1×PBS for later use. 100 μL of the above bacterial cells were added to each well of the 96-well plate containing A549 cells and incubated for 8 hours. At 7 hours and 15 minutes, 10 μL of lysis solution was added to the positive wells and cultured for another 45 minutes. At the end of the incubation, 50 μL of supernatant per well was added to another 96-well plate. After 50 μL of reaction solution was added to each well, the reaction was protected from light for 0.5 hours. 50 μL of stop solution was added to terminate the reaction. The OD value was detected using a multifunctional microplate reader. 490 The experiment was repeated at least three times.

[0045] Example 3:

[0046] Effects of sansin O on the AHL signaling system of Acinetobacter baumannii ATCC 19606 strain.

[0047] Effect of sansin O on the AHL signal production of Acinetobacter baumannii ATCC 19606 strain: The overnight activated Acinetobacter baumannii ATCC 19606 seed liquid was inoculated into a fresh 1L LB culture medium and cultured with shaking until OD 600 = about 3.0. Centrifuge the bacterial solution at 4000 rpm for 30 min, collect the supernatant; add an equal volume of ethyl acetate for extraction, and concentrate the extract. Remaining concentrate was reconstituted with 1 mL of methanol and filtered through a 0.22 μm microporous filter membrane. The sample was transferred to an HPLC sample vial and set aside. UHPLC-ESI-MS / MS was used for detection, using a Waters C 18 The chromatographic column (1.8 μm, 150×2.1 mm) was used for detection, 3-OH-C12-HSL was selected as the analytical reference, and the mass spectrometer was operated in the positive ion mode with the mobile phase consisting of 0.1% formic acid / water and acetonitrile.

[0048] Effect of sansin O on the transcription level of AHL signal synthase and receptor coding genes of Acinetobacter baumannii ATCC 19606 strain: The wild-type strain of Acinetobacter baumannii ATCC 19606 was inoculated into fresh liquid LB, and sansin O solutions prepared at different concentrations (200mM, 100mM, 50mM) were dissolved in DMSO solvent. An equal volume of DMSO was added to the above bacterial solution at a volume ratio of 1:1000 as a control to make the final concentrations of 200μM, 100μM, and 50μM. The culture was shaken until OD 600 =1.0. According to Shanghai Promega RNA was extracted using the Super Total RNA Extraction Kit. Reverse transcription of mRNA was performed according to the instructions of HiScript III RT SuperMix for qPCR (+gDNA wiper) from Nanjing Novozymes. The specific RT-qPCR protocol was based on the ChamQTM Universal Follow the instructions of qPCR Master Mix.

[0049] Table 1: Primer sequences

[0050] Sequence number Primers Sequence (5'-3') SEQ ID NO 1 abaI-F AAAACCCGCAGCACGTAATA SEQ ID NO 2 abaI-R ATCCGCCTTCCTCTAGCAGT SEQ ID NO 3 abaR-F ACCCTTATCTATTGCTGAACC SEQ ID NO 4 abaR-R TGACTGAGCCCAACCGACAT SEQ ID NO 5 ATCC 19606-16S-F CCTGTAAACCGTAATGCTCC SEQ ID NO 6 ATCC 19606-16S-R TGTCACTTAAACCACCCTCA

[0051] Statistical Analysis: Data are presented as mean ± standard deviation (SD) of three independent experiments. Statistical analysis was performed using Prism 8 software (GraphPad). Statistical significance is as follows: ns = no significant difference, *p < 0.05, **p < 0.01, ***p < 0.001

[0052] (One-way ANOVA or two-way ANOVA). Error bars are expressed as SD.

[0053] like Figure 1 As shown in the in vitro experiments, it was proved that sansin O has a binding effect with the AHL receptor protein AbaR of Acinetobacter baumannii. The results obtained by MST detection analysis are as follows Figure 1 As shown, the binding constant K of sansin O and AbaR protein was determined. d The concentration of sangsin O was 22.7±3.3μM, indicating that sangsin O has an in vitro binding effect with Acinetobacter baumannii AbaR protein.

[0054] Sancin O has an inhibitory effect on the motility of Acinetobacter baumannii strain ATCC 19606. Figure 2 As shown in the figure, with DMSO as the control, the motility of Acinetobacter baumannii strain ATCC19606 treated with 50μM, 100μM, and 200μM sansin O decreased by 21.42%, 38.09%, and 54.76%, respectively. This shows that sansin O has a good inhibitory effect on the motility of Acinetobacter baumannii strain ATCC 19606 ( Figure 2 Middle A).

[0055] Sancin O has an inhibitory effect on the biofilm of Acinetobacter baumannii strain ATCC 19606. Figure 2As shown in Figure B, with DMSO as the control, the biofilm formation ability of Acinetobacter baumannii strain ATCC19606 was reduced by 24.04%, 37.81%, and 54.26% after treatment with 50 μM, 100 μM, and 200 μM sansin O, respectively. This indicates that sansin O has a certain inhibitory effect on the biofilm formation ability of Acinetobacter baumannii strain ATCC19606.

[0056] Sancin O has an inhibitory effect on the cytotoxicity of Acinetobacter baumannii strain ATCC 19606. The cytotoxicity was detected by detecting the release of LDH. When detecting the effect of Sancin O on the cytotoxicity of Acinetobacter baumannii strain ATCC 19606 cells, the LDH release of the DMSO group added to the Acinetobacter baumannii strain ATCC 19606 was taken as 100%, and the LDH release ratio of different concentrations of Sancin O was standardized. When Acinetobacter baumannii ATCC 19606 was added, with DMSO as the control, when Sancin O was 50μM, 100μM, and 200μM, the toxicity of Acinetobacter baumannii ATCC 19606 to A549 cells was reduced to 18.79%, 27.47%, and 44.94% or less ( Figure 2 Middle C).

[0057] Sancin O has no inhibitory effect on the growth of Acinetobacter baumannii strain ATCC 19606 cells. Using DMSO as a control, the growth rate of Acinetobacter baumannii ATCC 19606 strains treated with Sancin O at final concentrations of 50μM, 100μM, and 200μM in LB medium was not significantly affected. This result shows that the therapeutic effect of Acinetobacter baumannii strain ATCC 19606 treated with Sancin O is not achieved by killing bacterial cells, and therefore it is not easy to develop drug resistance ( Figure 3 ).

[0058] Effect of sansin O on the 3-OH-C12-HSL signal production of Acinetobacter baumannii strain ATCC 19606. Quantitative analysis of 3-OH-C12-HSL signal by LC-MS / MS showed that compared with the wild-type strain, the 3-OH-C12-HSL signal production of Acinetobacter baumannii ATCC 19606 strain treated with sansin O at final concentrations of 50 μM, 100 μM, and 200 μM decreased by 23.42%, 38.80%, and 54.52%, respectively. Figure 4 ).

[0059] Effects of sansin O on the transcriptional levels of abaI, the gene encoding the synthase of the AHL signaling system, and abaR, the gene encoding the receptor protein, in Acinetobacter baumannii strain ATCC 19606. Figure 5It can be seen that the transcription levels of the AHL signaling system synthase encoding gene abaI and the receptor protein encoding gene abaR were detected by RT-qPCR and promoter fusion lacZ reporter system experiments. The results showed that 50μM, 100μM and 200μM of sansin O can significantly inhibit the transcription level of the AHL signaling system synthase encoding gene abaI, but have almost no effect on the transcription level of its receptor protein encoding gene abaI.

[0060] In summary, the compound Sangxinsu O provided by the present invention targets AbaR and can inhibit the AHL signal production, pathogenic phenotype and virulence of Acinetobacter baumannii by directly binding to the AbaR protein. When the concentration of Sangxinsu O reaches 50 μM, it can inhibit the transcription level of the AHL synthase encoding gene abaI and the signal production of AHL. Sangxinsu O has good pharmacological activity against Acinetobacter baumannii and does not inhibit the growth rate of the test strain ATCC 19606. When the concentration reaches 50 μM or above, it shows a significant inhibitory effect on the motility, biofilm formation ability and cytotoxicity of Acinetobacter baumannii. In summary, the compound Sangxinsu O has a good interference inhibitory effect on the AHL-type quorum sensing system of Acinetobacter baumannii and exhibits a significant antibacterial effect. Since the compound Sangxinsu O does not directly inhibit the growth of Acinetobacter baumannii and does not produce selective pressure on Acinetobacter baumannii, it will not lead to the production of drug-resistant pathogens. Therefore, Sangxinsu O has a good application prospect in the development of new antibacterial drugs, especially in the development of drugs for anti-Acinetobacter baumannii infections.

[0061] The parts of the embodiment herein that are not exhaustive of the midpoint values ​​of the technical scope claimed for protection by the present invention and the new technical solutions formed by equivalent replacement of single or multiple technical features in the technical solutions of the embodiments are also within the scope claimed for protection by the present invention; at the same time, in all the embodiments listed or not listed in the solutions of the present invention, each parameter in the same embodiment merely represents an example of its technical solution (i.e., a feasible solution), and there is no strict coordination and limitation relationship between the parameters, wherein the parameters can be replaced with each other without violating the axioms and the claims of the present invention, unless otherwise stated.

[0062] The technical means disclosed in the solutions of the present invention are not limited to the technical means disclosed in the above technical means, but also include technical solutions composed of any combination of the above technical features. The above is a specific embodiment of the present invention. It should be noted that for those skilled in the art, various improvements and modifications can be made without departing from the principles of the present invention, and such improvements and modifications are also considered to be within the scope of protection of the present invention.

[0063] The specific embodiments described herein are merely illustrative of the spirit of the present invention. Persons skilled in the art may make various modifications, additions, or substitutions to the described specific embodiments without departing from the spirit of the present invention or exceeding the scope of the appended claims.

Claims

1. An application of sansinsu O in the preparation of a pharmaceutical composition against Acinetobacter baumannii, wherein the structural formula of sansinsu O is as follows:

2. The use according to claim 1, characterized in that The pharmaceutical composition against Acinetobacter baumannii includes drugs for preventing and / or treating Acinetobacter baumannii infection or drugs for preventing and / or treating infectious diseases caused by Acinetobacter baumannii.

3. The use according to claim 2, characterized in that The pharmaceutical composition also contains pharmaceutically acceptable excipients.

4. The use according to claim 2, characterized in that The dosage form of the pharmaceutical composition is a solid preparation, a liquid preparation or a semisolid preparation.

5. The use according to claim 2, characterized in that The pharmaceutical composition is at least one of a tablet, a capsule, and an injection.

Images