Tcr targeting flt3 d835h mutation-derived neoantigen and application

Abstract

The present application provides a TCR targeting a FLT3D835H mutation-derived neoantigen, a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or a complementary sequence thereof, a vector containing the nucleic acid molecule, a cell transduced with the nucleic acid molecule or the vector, a pharmaceutical composition comprising the TCR, the nucleic acid molecule, the vector or the cell as an active ingredient, and use of the TCR, the nucleic acid molecule, the vector, the cell or the pharmaceutical composition in detection, prevention and / or treatment of a cancer related to a FLT3D835H gene mutation-derived neoantigen.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of polypeptide drugs and polypeptide vaccines, and particularly relates to specific TCRs targeting FLT3 D835H derived neoantigens and application thereof in tumor immunotherapy. BACKGROUND

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous and aggressive malignancy derived from myeloid precursor cells, accounting for 70% of adult leukemia. The overall clinical treatment effect of AML is poor, with a 5-year survival rate of 35%-50%, and even lower to 5%-10% for elderly patients. The continuous accumulation of gene mutations endows leukemia cells with extremely complex survival ability, leading to persistent clonal proliferation, which is the key to poor prognosis of AML. Specific elimination of leukemia cell clones targeting gene mutations and promoting immune balance have important scientific significance for prolonging the disease-free survival period of AML patients and reducing the relapse rate.

[0003] FMS-like tyrosine kinase 3 (FLT3) gene is located on chromosome 13q12, encoding a protein containing 993 amino acids. Among them, the transmembrane region is located between the 542nd and 564th amino acids, and the kinase domain is located between the 610th and 944th amino acids, including a kinase insertion segment of about 50 amino acids. FLT3 mutation is the most common genetic abnormality in acute myeloid leukemia (AML), occurring in about 30% of patients. FLT3 mutation leads to enhanced FLT3 kinase activity, thereby promoting leukemia cell proliferation and growth, and is closely related to poor prognosis of AML patients.

[0004] FLT3 gene mutations mainly occur in internal tandem duplication (ITD) of the juxtamembrane domain and single nucleotide mutation of the tyrosine kinase domain (TKD). Studies have found that AML cell clones with FLT3 mutations have a survival advantage during standard treatment such as chemotherapy, and will expand to drive relapse unless effectively eradicated. However, most of the current tyrosine kinase inhibitors target FLT3-ITD mutations, and have limited effect on FLT3-TKD. Moreover, FLT3-TKD mutation is an important factor for primary or secondary resistance to first-generation and second-generation tyrosine kinase inhibitors. Therefore, the development of therapeutic means targeting FLT3-TKD mutations to eliminate leukemia subclones is crucial for overcoming resistance to targeted inhibitors and prolonging the disease-free survival period of AML patients.

[0005] T cells play a crucial role in anti-leukemia immunity, and T cell-based immunotherapy strategies are the focus and emphasis in the field of anti-tumor immunotherapy in recent years. The initiation of T cell immune response depends on the recognition of TCR to antigen. The engineered TCR-T cells constructed by artificially transducing antigen-specific TCR to T cells target and kill tumor cells, change the body's immune suppression state, induce specific immune response, and promote the benign cycle of the body's immune protection. At present, TCR-T cells targeting WT1, HA-1, PRAME and other tumor-associated antigens have achieved encouraging anti-tumor effects in clinical trials. However, such antigens are also expressed in normal cells, and the treatment of TCR-T cells targeting them has the risk of damaging normal tissues and increasing side effects. Therefore, selecting appropriate targets is a key point for optimizing TCR-T cell therapy.

[0006] New antigens are derived from somatic gene mutations, specifically expressed in cancer cells, and do not cause central immune tolerance, with the advantages of strong immunogenicity and good safety, making them ideal targets for immune cell therapy. Among the many FLT3-TKD mutations, the most common is the mutation of aspartic acid (D835), which leads to the constitutive activation of FLT3 and induces malignant transformation of cells. Currently, D835 point mutations have been identified in AML patients, including alanine (A), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), aspartic acid (N), valine (V), and tyrosine (Y), among which D835F, D835H, D835I, D835V and D835Y are the most common. In our previous study, we found that the new antigen derived from FLT3 D835H mutation (polypeptide sequence: HIMSDSNYV) has high immunogenicity, and after being presented to the cell surface by HLA-A*02:01 molecules to form pHLA complexes, it is recognized by T cells, inducing T cell activation and having a significant anti-leukemia effect (national invention patent application number: CN202210968824.2), which is an important target for anti-leukemia immunotherapy.

[0007] Based on the recognition of T cells to FLT3 D835H mutation, alternative methods targeting FLT3 D835H mutation-derived new antigens include using TCR for T cell-mediated immunotherapy to specifically recognize and eliminate leukemia cells. Since wild-type TCR usually has low affinity for its peptide / HLA (pHLA) ligand, it is necessary to develop TCR mutants with enhanced affinity. SUMMARY

[0008] The present application aims to overcome the shortcomings of the prior art, and provides a specific TCR targeting FLT3 D835H mutation-derived new antigens and its application in tumor immunotherapy.

[0009] According to the first aspect of the object of the present application, a specific TCR targeting FLT3 D835H mutation-derived neoantigen is provided,

[0010] The FLT3 D835 mutation-derived neoantigen (polypeptide sequence: HIMSDSNYV, national invention patent application number: CN202210968824.2) is combined with HLA-A*02:01 molecules and presented to the target cell surface to form a HIMSDSNYV-HLA-A*02:01 complex.

[0011] The HIMSDSNYV-HLA-A*02:01 complex is recognized by the T cell surface specific TCR, inducing and initiating a specific immune response.

[0012] The TCR has the property of binding to the HIMSDSNYV-HLA-A*02:01 complex, and the TCR comprises a TCR alpha chain variable region and a TCR beta chain variable region.

[0013] The CDR3 amino acid sequence of the TCR alpha chain variable region is CAASAGGDNTDKLIF (SEQ ID NO: 7).

[0014] And / or the CDR3 amino acid sequence of the TCR beta chain variable region is CASSLSPTTYNEQFF (SEQ ID NO: 10).

[0015] Preferably, the three complementarity determining region amino acid sequences of the TCR alpha chain variable region are:

[0016] αCDR1: SEQ ID NO: 5.

[0017] αCDR2: SEQ ID NO: 6.

[0018] αCDR3: SEQ ID NO: 7.

[0019] Preferably, the three complementarity determining region amino acid sequences of the TCR beta chain variable region are:

[0020] βCDR1: SEQ ID NO: 8.

[0021] βCDR2: SEQ ID NO: 9.

[0022] βCDR3: SEQ ID NO: 10.

[0023] Preferably, the TCR targeting the FLT3 D835H mutation-derived neoantigen has an amino acid sequence of the TCR alpha chain variable region that is at least 90% identical to SEQ ID NO. 1; and / or the TCR beta chain variable region is at least 90% identical to SEQ ID NO. 2.

[0024] Preferably, the TCR comprises an alpha chain amino acid sequence of SEQ ID NO: 17.

[0025] Preferably, the TCR comprises a beta chain amino acid sequence of SEQ ID NO: 18.

[0026] Preferably, the TCR is an alpha beta heterodimer.

[0027] Preferably, the TCR comprises an artificial interchain disulfide bond between the alpha chain and the beta chain.

[0028] Preferably, the TCR has an amino acid sequence of SEQ ID NO: 21.

[0029] In a second aspect of the application, there is provided a nucleic acid molecule comprising a nucleic acid sequence encoding the TCR molecule of the first aspect of the application, or a complement thereof.

[0030] Preferably, the nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO: 3 encoding the TCR alpha chain variable region.

[0031] Preferably, the nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO: 4 encoding the TCR beta chain variable region.

[0032] Preferably, the nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO: 19 encoding the TCR alpha chain.

[0033] Preferably, the nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO: 20 encoding the TCR beta chain.

[0034] Preferably, the nucleic acid molecule comprises a nucleotide sequence of SEQ ID NO: 22.

[0035] In a third aspect of the application, there is provided a vector comprising the nucleic acid molecule of the second aspect of the application.

[0036] Preferably, the vector is a viral vector.

[0037] More preferably, the viral vector is a lentiviral vector or a retroviral vector.

[0038] In a fourth aspect of the present application, there is provided an isolated host cell comprising the vector or genome of the third aspect of the present application integrated therein.

[0039] In a fifth aspect of the present application, there is provided a cell expressing the TCR or antigen-binding fragment thereof of the first aspect of the present application targeting FLT3 D835H mutation-derived neoantigen, or carrying the polynucleotide of the second aspect of the present application, or comprising the vector of the third aspect of the present application.

[0040] Preferably, the cell is a T cell, a peripheral blood mononuclear cell (PBMC) or a stem cell.

[0041] In a sixth aspect of the present application, there is further provided a preparation method of the TCR or antigen-binding fragment thereof of the first aspect of the present application targeting FLT3 D835H mutation-derived neoantigen, the preparation method comprising culturing the cell of the fifth aspect of the present application.

[0042] In a seventh aspect of the present application, there is further provided use of the TCR or antigen-binding fragment thereof of the first aspect of the present application targeting FLT3 D835H mutation-derived neoantigen, or the polynucleotide of the second aspect of the present application, or the vector of the third aspect of the present application, or the cell of the fourth aspect of the present application, or the cell of the fifth aspect of the present application, or the preparation method of the sixth aspect of the present application in the preparation of a medicament for treating leukemia.

[0043] In an eighth aspect of the present application, there is further provided a medicament for treating leukemia, the medicament comprising the TCR or antigen-binding fragment thereof of the first aspect of the present application targeting FLT3 D835H mutation-derived neoantigen, or the polynucleotide of the second aspect of the present application, or the vector of the third aspect of the present application, or the cell of the fourth aspect of the present application, or the cell of the fifth aspect of the present application.

[0044] It should be understood that all the technical features of the present application described above and the technical features specifically described hereinafter (e.g. in the examples) can be combined with each other to form new or preferred technical solutions within the scope of the present application. Due to the limited space, they will not be listed one by one here.

[0045] Compared with the prior art, the present application has the following beneficial effects:

[0046] The present application obtains a high-affinity TCR or antigen-binding fragment thereof targeting FLT3 D835H mutation-derived neoantigen, a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or a complementary sequence thereof, a vector containing the nucleic acid molecule, a cell transduced with the nucleic acid molecule or the vector, a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient, and the use of the TCR, nucleic acid molecule, vector, cell or pharmaceutical composition in the preparation of a drug for detecting, preventing / treating leukemia.

[0047] Compared with the prior art, the present application has the following beneficial effects:

[0048] (1) The TCR of the present application can directly eliminate leukemia cells by precisely targeting FLT3 D835H mutation;

[0049] (2) The TCR of the present application has high in vivo protein expression and no mismatch with endogenous TCR chains;

[0050] (3) The TCR-T cells expressing the TCR of the present application have strong killing ability and strong specificity, and can be effectively used for the treatment of leukemia or other cancers containing FLT3 D835H mutation. BRIEF DESCRIPTION OF DRAWINGS

[0051] Figure 1 Detection and isolation of FLT3 D835H mutation-derived neoantigen-specific T cells

[0052] Figure 2 Schematic diagram of FLT3 D835H mutation-derived neoantigen-specific TCR sequence

[0053] Figure 3 Transduction efficiency of FLT3 D835H mutation-derived neoantigen-specific TCR gene modified T cells

[0054] Figure 4 In vitro activation verification of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells

[0055] Figure 5 In vitro killing activity of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells

[0056] Figure 6 In vitro identification of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells on AML cell lines

[0057] Figure 7 In vitro killing of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells on AML cell lines

[0058] Figure 8 In vitro recognition of AML blast cells by FLT3 D835H mutation-derived neoantigen-specific TCR-T cells

[0059] Figure 9 In vitro killing of AML blast cells by FLT3 D835H mutation-derived neoantigen-specific TCR-T cells DETAILED DESCRIPTION

[0060] For a more complete understanding of the technology content of the present application, specific embodiments are described in detail with the following drawings. The technical solutions of the present application are described in the following embodiments with reference to the accompanying drawings.

[0061] Aspects of the present application are described in the following disclosure with reference to the accompanying drawings, in which a number of illustrative embodiments are shown. The embodiments of the present disclosure are not necessarily intended to encompass all aspects of the present application. It should be appreciated that the various concepts and embodiments introduced above and those described in greater detail below can be implemented in any of numerous ways, as the disclosed concepts are not limited to any particular manner of implementation.

[0062] Example 1. In vitro induction of FLT3 D835H mutation-derived neoantigen-specific T cells

[0063] Healthy volunteers with HLA-A * 02:01 positive were selected. PBMCs were isolated and purified from the venous blood of healthy volunteers by Ficoll density gradient centrifugation. CD8 + cells and CD14 + cells were sorted by Dynabeads magnetic beads, respectively. CD14 + cells were resuspended in RPMI-1640 medium containing 10% FBS, 1000 U / mL IL-4 and 1000 U / mL GM-CSF, and incubated in an incubator for 3 days to induce dendritic cells (DCs). The DCs were resorted with fresh medium containing 800 IU / mL GM-CSF, 1000 IU / mL IL-4, 10 ng / mL TNF-α, 10 ng / mL IL-1β, 1000 IU / mL IL-6 and 1 μg / mL PGE2 to induce DCs maturation. The mature DCs were collected, resuspended in serum-free RPMI-1640 medium, and added with FLT3 D835H mutation-derived neoantigen peptide (HIMSDSNYV; 10 μg / mL) for 2-4 hours of incubation at 37°C. The neoantigen peptide-pulsed DCs were collected, inactivated with 30 μg / mL mitomycin C for 30 min at 37°C, and resuspended in RPMI-1640 medium containing 10% FBS (containing IL-2 50 U / mL, IL-7 5 ng / mL, IL-15 5 ng / mL) to stimulate CD8 +Cell co-incubation, half-volume medium change every 2-3 days, culture for 10-20 days. Collect cells, label with PE-labeled neoantigen peptide-HLA-A * 02:01-Tetramer and APC-labeled CD8 antibody staining, flow cytometry detection.

[0064] Results: After stimulation by FLT3 D835H mutation-derived neoantigen-loaded cells, the CD8 + / Tetramer + T cell proportion increased from 0.088% to 0.37%( Figure 1 ), indicating that FLT3 D835H mutation-derived neoantigens induced T cell specific expansion in vitro.

[0065] Example 2. TCR sequencing to obtain HLA-A*02:01 restricted FLT3 D835H mutation-derived neoantigen specific TCR

[0066] Flow cytometry sorting of Tetramer + CD8 + cells, total RNA was extracted by RNeasy Plus Mini Kit (Qiagen), TCR analysis system synthesized cDNA with 5' Race adapter from total RNA, introduced unique molecular identifier UMI to control the bottleneck effect and eliminate PCR and sequencing errors. Sequencing was performed on the Illumina system in PE150 mode. TCR alpha and TCR beta chain sequences of Tetramer + CD8 + cells were obtained respectively. Sequencing result analysis was performed by our self-established method (national invention patent application number: CN202210939709.2), and the TCR alpha and TCR beta sequences with the highest frequency were considered as the main clonal sequences of T cells, i.e. specific TCR sequences. Among them,

[0067] The TCR alpha chain variable region amino acid sequence is SEQ ID NO: 1.

[0068] The amino acid sequences of the 3 complementarity determining regions of the TCR alpha chain variable region are:

[0069] αCDR1: NSMFDY (SEQ ID NO: 5),

[0070] αCDR2: ISSIKDK (SEQ ID NO: 6),

[0071] αCDR3: CAASAGGDNTDKLIF (SEQ ID NO: 7).

[0072] The TCR alpha chain variable region nucleotide sequence is SEQ ID NO. 3.

[0073] The three complementarity determining region nucleotide sequences of the TCR alpha chain variable region are:

[0074] Alpha CDR1: AACAGCATGTTTGATTAT (SEQ ID NO: 11),

[0075] Alpha CDR2: ATAAGTTCCATTAAGGATAAA (SEQ ID NO: 12),

[0076] Alpha CDR3: TGTGCAGCAAGCGCAGGAGGGGATAACACCGACAAGCTCATCTTT (SEQ ID NO: 13).

[0077] The TCR beta chain variable region amino acid sequence is SEQ ID NO: 2.

[0078] The three complementarity determining region amino acid sequences of the TCR beta chain variable region are:

[0079] Beta CDR1: MNHEY (SEQ ID NO: 8),

[0080] Beta CDR2: SMNVEV (SEQ ID NO: 9),

[0081] Beta CDR3: CASSLSPTTYNEQFF (SEQ ID NO: 10).

[0082] The TCR beta chain variable region nucleotide sequence is SEQ ID NO: 4.

[0083] The three complementarity determining region nucleotide sequences of the TCR beta chain variable region are:

[0084] Beta CDR1: ATGAACCATGAGTAT (SEQ ID NO: 14),

[0085] Beta CDR2: TCAATGAATGTTGAGGTG (SEQ ID NO: 15),

[0086] Beta CDR3: TGTGCCAGCAGTTTAAGCCCGACCACCTACAATGAGCAGTTCTTC (SEQ ID NO: 16).

[0087] The TCR sequences obtained by sequencing are subjected to sequence optimization, the constant regions of the TCR alpha and TCR beta sequences with the highest frequency of occurrence are modified, and the optimized murine constant regions are replaced to avoid mismatch between the exogenous TCR and the endogenous TCR of the T cells; the expression sequences are subjected to codon optimization to improve the protein expression amount; and P2A and Furin-cleavage are used to enable TCR alpha and TCR beta to be simultaneously expressed in one expression vector.

[0088] A lentiviral expression vector is constructed, and the above TCR alpha and TCR beta sequences are inserted into the same lentiviral expression vector, and the TCR sequence element is as shown in Figure 2 The 293T cells are used for virus packaging to produce FLT3 D835H mutation-derived neoantigen-specific TCR-specific lentiviral particles.

[0089] Example 3. Construction of specific TCR-T cells targeting FLT3 D835H mutation

[0090] The peripheral blood of a healthy volunteer is collected, the PBMCs are separated and purified by Ficoll density gradient centrifugation, resuspended in AIM-V medium containing 5% FBS, and then anti-CD3 antibody (OTK3, 50 ng / mL), IL-2 (300 IU / mL), IL-7 (30 ng / mL), IL-12 (15 ng / mL) and TGF-β (5 ng / mL) are added, and the mixture is activated at 37°C for 48 h. The activated T cells are infected with TCR lentiviral particles, and IL-2 (300 IU / mL), protamine sulfate (8 μg / mL) are added, and the mixture is centrifuged at 800 x g for 90 min. The TCR-transfected T cells are further cultured in AIM-V medium containing 10% FBS, IL-7 (5 ng / mL), IL-15 (5 ng / mL) and IL-2 (1000 IU / mL) for 72 h.

[0091] The TCR-T cells are collected, washed twice with FACS buffer, and then stained with PE-mTCR beta flow cytometry antibody, PE neoantigen peptide-HLA-A * 02:01-Tetramer and APC-CD3 flow cytometry antibody, respectively, and detected by flow cytometry.

[0092] The results are shown in Figure 3 The transduction efficiency of the TCR (CD3 + / mTCR beta + ) is 23.4%, and the efficiency of expressing heterodimeric TCR (CD3 + / Tetramer + ) is 15.4%, indicating that the TCR-T cells are successfully constructed.

[0093] Example 4. Verification of FLT3 D835H mutation-derived neoantigen-specific TCR-T cell activation function in vitro

[0094] To detect the ability of TCR-T cells to target FLT3 D835H mutation, the activation level of TCR-T cells was determined by enzyme-linked immunosorbent assay (ELISA) of IFN-γ and Granzyme B. The specific steps are as follows:

[0095] The lentivirus-transfected TCR-T cells were inoculated in a 24-well plate at a density of 1 x 10 6 / mL, and IL-7

[0096] (10 ng / mL), IL-15 (10 ng / mL) were added on Day 1; on Day 2, T2 cells loaded with neoantigen peptides were co-incubated with TCR-T cells at a ratio of 1:10 to achieve secondary antigen stimulation, and IL-21 (30 ng / mL) was added; on Day 3, IL-7

[0097] (10 ng / mL), IL-15 (10 ng / mL) were added for continued culture. TCR-T cells were collected as effector cells.

[0098] T2 cells loaded with different concentrations (10 1 , 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 μM) of FLT3 D835H mutation-derived neoantigen peptides were used as experimental group target cells, and T2 cells loaded with corresponding concentrations of FLT3 wild-type antigen peptides were used as control group target cells, which were inoculated in a 96-well plate at a density of 1 x 10 5 / 100 μl / well, and TCR-T cells (2 x 10 5 / 100 μl / well) were added, and co-cultured at 37°C for 18-24 h. The plate was centrifuged, and 100 μl of supernatant was taken from each well and added to an ELISA plate strip pre-coated with IFN-γ or Granzyme B antibody, and color development was performed according to the instructions, and the plate was read by a microplate reader. The standard curve was calculated according to the absorbance value of the standard, and the IFN-γ or Granzyme B secretion level of each sample well was calculated accordingly. Each concentration of each group was set up with at least 3 replicate wells, and each experiment was repeated 3 times.

[0099] The results are shown in Table 1: Figure 4 Under the stimulation of T2 cells loaded with FLT3 D835H mutation-derived neoantigen, TCR-T cells significantly secreted IFN-γ and Granzyme B, while they had no effect on T2 cells loaded with wild-type antigen peptides. This indicates that the activation of TCR-T cells is specific to FLT3 D835H.

[0100] Example 5. Verification of FLT3 D835H mutation-derived neoantigen-specific TCR-T cell in vitro killing function

[0101] To verify the ability of TCR-T cells to target FLT3 D835H mutation, the killing ability of TCR-T cells was evaluated by quantitatively detecting lactate dehydrogenase (LDH) released during cell lysis. The specific steps are as follows:

[0102] The transfected and expanded TCR-T cells in Example 4 were collected as effector cells; T2 cells loaded with FLT3 D835 mutation-derived neoantigen peptide (10 μg / mL) were used as experimental group target cells, and T2 cells loaded with corresponding concentration of FLT3 wild type antigen peptide (10 μg / mL) were used as control group target cells. TCR-T cells and target cells were inoculated in 96-well plates at effector-to-target ratios of 40:1, 20:1, 10:1 and 5:1, respectively. The CytoTox 96® Non-Radioactive Cytotoxicity Assay kit was used to detect the release of LDH, and the % cytotoxicity was calculated to evaluate the ability of TCR-T cells to specifically kill T2 cells loaded with FLT3 D835H mutation-derived neoantigen. Each well had 3 replicate holes, and the experiment was repeated 3 times. The 96-well plate was incubated at 37°C for 4 h, the plate was centrifuged, 50 μl of supernatant was taken from each well and added to a new 96-well plate, the color was developed according to the instructions, the plate was read by a microplate reader, and the % cytotoxicity at different effector-to-target ratios was calculated to evaluate the ability of TCR-T cells to specifically kill T2 cells loaded with FLT3 D835H mutation-derived neoantigen. Each well had 3 replicate holes, and the experiment was repeated 3 times.

[0103] The results are shown in Table 1: Figure 5 TCR-T cells significantly killed T2 cells loaded with FLT3 D835H mutation-derived neoantigen, but had no effect on T2 cells loaded with FLT3 wild type antigen peptide, indicating that TCR-T cells had targeting killing function.

[0104] Example 6. FLT3 D835H mutation-derived neoantigen-specific TCR-T cells in vitro recognition of AML cell lines

[0105] To verify the function of TCR-T cells to recognize AML cell lines endogenously presenting FLT3 D835H mutation-derived neoantigen, the activation ability of TCR-T cells was determined by IFN-γ- and Granzyme B-ELISA. The specific steps are as follows:

[0106] The transfected and expanded TCR-T cells in Example 4 were collected as effector cells; OCI-AML3 cells positive for HLA-A * 02:01 and transfected with FLT3 D835H mutation were used as experimental group target cells, and OCI-AML3 cells positive for HLA-A D835HCells as target cells, with original OCI-AML3 cells as control target cells. Target cells were inoculated in 96-well plates at 2 x 10 4 / 100 μl / well, and TCR-T cells were added at effector-to-target ratios of 20:1, 10:1, 5:1, and 2.5:1. Incubation was performed at 37°C for 18-24 h. The detection of IFN-γ and Granzyme B secretion levels was performed as in Example 4 to evaluate the function of TCR-T cells in specifically recognizing AML cell lines. At least 3 replicate wells were set for each concentration in each group, and each experiment was repeated 3 times.

[0107] The results are shown in Table 6: Figure 6 TCR-T cells significantly secreted IFN-γ and Granzyme B under the stimulation of OCI-AML3 D835H cells, but had no effect on OCI-AML3 cells. This indicates that TCR-T specifically recognizes HLA-A * 02:01 + AML cell lines endogenously presenting FLT3 D835H mutation-derived neoantigens.

[0108] Example 7: In vitro killing of AML cell lines by FLT3 D835H mutation-derived neoantigen-specific TCR-T cells

[0109] To verify the ability of TCR-T cells to target AML cell lines endogenously presenting FLT3 D835H mutation-derived neoantigens, the killing ability of TCR-T cells was determined by the LDH release method. The specific steps are as follows:

[0110] TCR-T cells transfected and expanded in Example 4 were collected as effector cells; OCI-AML3 D835H and OCI-AML3 cells in Example 6 were collected as experimental and control target cells, respectively. TCR-T cells and target cells in each group were added at effector-to-target ratios of 40:1, 20:1, 10:1, and 5:1, respectively, and incubated at 37°C for 4 h. The supernatant was collected, developed, and read according to the instructions. The cell lysis rate was calculated according to the formula to evaluate the ability of TCR-T cells to specifically kill AML cell lines. At least 3 replicate wells were set for each concentration in each group, and each experiment was repeated 3 times.

[0111] The results are shown in Table 6: Figure 7 TCR-T cells significantly killed OCI-AML3 D835H cells, but had no effect on OCI-AML3 cells expressing wild-type FLT3. This indicates that TCR-T cells specifically kill HLA-A * 02:01 + AML cell lines endogenously presenting FLT3 D835H mutation-derived neoantigens.

[0112] Example 8: FLT3 D835H mutation-derived neoantigen-specific TCR-T cells recognize AML blast cells in vitro

[0113] To verify the function of TCR-T cells recognizing AML blast cells endogenously presenting FLT3 D835H mutation-derived neoantigens, the activation ability of TCR-T cells was determined by IFN-γ- and Granzyme B-ELISA. The specific steps are as follows:

[0114] The transfected expanded TCR-T cells in Example 4 were collected as effector cells; HLA-A * 02:01 + / FLT3 D385H+ AML patient bone marrow blast cells as experimental group target cells, collection of HLA-A * 02:01 – / FLT3 D385H+ , HLA-A * 02:01 + / FLT3 D385H– and HLA-A * 02:01 – / FLT3 D385H– AML patient bone marrow blast cells as control group target cells. Target cells were inoculated in 96-well plates at 2x10 4 / 100 μl / well, and TCR-T cells were added at effector-to-target ratios of 20:1, 10:1, 5:1 and 2.5:1. Incubate at 37°C for 18-24h. The detection of IFN-γ and Granzyme B secretion levels is as described in Example 4, and the function of TCR-T specific recognition of AML blast cells is evaluated. Each concentration of each group is set up at least 3 replicates, and each experiment is repeated 3 times.

[0115] The results are shown in Figure 8 : Under the stimulation of HLA-A * 02:01 + / FLT3 D385H+ AML blast cells, TCR-T cells significantly secreted IFN-γ and Granzyme B. It is shown that TCR-T cells specifically recognize AML blast cells endogenously presenting FLT3 D835H.

[0116] Example 9: FLT3 D835H mutation-derived neoantigen-specific TCR-T cells kill AML blast cells in vitro

[0117] To verify the function of TCR-T cells targeting AML blast cells endogenously presenting FLT3 D835H mutation-derived neoantigens, the killing ability of TCR-T cells was determined by LDH release method. The specific steps are as follows:

[0118] The TCR-T cells transfected and expanded in Example 4 were collected as effector cells; HLA-A cells were collected. * 02:01 + / FLT3 D385H+ Bone marrow blast cells from AML patients were used as target cells in the experimental group to collect HLA-A. * 02:01 – / FLT3 D385H+ HLA-A * 02:01 + / FLT3 D385H– and HLA-A * 02:01 – / FLT3 D385H– Bone marrow blast cells from AML patients served as target cells in the control group. TCR-T cells and target cells were added at effector-to-target ratios of 20:1, 10:1, and 5:1, respectively, and co-incubated at 37°C for 4 hours. Supernatant was collected, staining was performed, and the plates were read according to the manufacturer's instructions. Cell lysis rate was calculated using the formula to assess the ability of TCR-T cells to specifically kill AML blast cells. Each concentration in each group was set up in at least three replicates, and each experiment was repeated three times.

[0119] The results are as follows Figure 9 As shown: TCR-T cells significantly kill HLA-A*02:01 + / FLT3 D385H+ AML blast cells, demonstrating the targeting effect of TCR-T cells on FLT3 D835H mutation-positive AML blast cells.

[0120] While the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the invention. Those skilled in the art can make various modifications and refinements without departing from the spirit and scope of the invention. Therefore, the scope of protection of the present invention shall be determined by the claims.

Claims

1. A TCR targeting a neoantigen derived from the FLT3 D835H mutation, characterized in that, The TCR is capable of recognizing the HIMSDSNYV−HLA-A*02:01 complex, wherein the TCR comprises a TCR α chain variable region and a TCR β chain variable region. The CDR3 amino acid sequence of the variable region of the TCRα chain is as follows: CAASAGGDNTDKLIF (SEQ ID NO:7) The CDR3 amino acid sequence of the variable region of the TCRβ chain is as follows: CASSLSPTTYNEQFF(SEQ ID NO:10); The variable region of the TCRα chain also includes αCDR1 and αCDR2 complementarity-determining regions, whose amino acid sequences are as follows: αCDR1: NSMFDY (SEQ ID NO:5), αCDR2: ISSIKDK (SEQ ID NO:6); The TCRβ chain variable region also includes βCDR1 and βCDR2 complementarity-determining regions, whose amino acid sequences are as follows: βCDR1: MNHEY (SEQ ID NO:8), βCDR2: SMNVEV (SEQ ID NO:9).

2. The TCR targeting the FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the variable region of the TCRα chain is an amino acid sequence that has at least 90% sequence identity with SEQ ID NO:1; the amino acid sequence of the variable region of the TCRβ chain is an amino acid sequence that has at least 90% sequence identity with SEQ ID NO:

2.

3. The TCR targeting the FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The TCR contains the α-chain amino acid sequence SEQ ID NO:

17.

4. The TCR targeting the FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The TCR contains the β-chain amino acid sequence SEQ ID NO:

18.

5. The TCR targeting the FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: TCR is an αβ heterodimer, with artificial interchain disulfide bonds between the α and β chains.

6. The TCR targeting the FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCR is shown in SEQ ID NO:

21.

7. A nucleic acid molecule, characterized in that: The nucleic acid molecule comprises a nucleic acid sequence encoding the TCR molecule of any one of claims 1 to 6, or its complementary sequence.

8. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence containing the variable region of the TCRα chain is SEQ ID NO:

3.

9. The nucleic acid molecule according to claim 7, characterized in that: The nucleic acid molecule contains a nucleotide sequence encoding the TCRα chain, SEQ ID NO:

19.

10. The nucleic acid molecule according to claim 7, characterized in that: The nucleic acid molecule contains a nucleotide sequence SEQ ID NO:4 encoding the variable region of the TCRβ chain.

11. The nucleic acid molecule according to claim 7, characterized in that: The nucleic acid molecule contains a nucleotide sequence encoding the TCRβ chain, SEQ ID NO:

20.

12. The nucleic acid molecule according to claim 7, characterized in that: The nucleic acid molecule contains the nucleotide sequence SEQ ID NO:

22.

13. A carrier, characterized in that: The carrier contains the nucleic acid molecule as described in any one of claims 7 to 12.

14. The carrier according to claim 13, characterized in that: The vector is a lentiviral vector or a retroviral vector.

15. An isolated host cell, characterized in that: The host cell contains a vector or genome according to any one of claims 13 and 14 that integrates an exogenous nucleic acid molecule according to any one of claims 7 to 12.

16. A cell, characterized in that: The cell expresses a TCR targeting the FLT3D835H mutation-derived neoantigen as described in any one of claims 1 to 6, or carries the nucleic acid molecule as described in claims 7 to 12, or contains the vector as described in claim 13 or 14; the cell is a T cell or a peripheral blood mononuclear cell.

17. A medicament for treating tumors, the medicament comprising a TCR targeting the FLT3D835H mutation-derived neoantigen as described in any one of claims 1 to 6, or a nucleic acid molecule as described in any one of claims 7 to 12, or a vector as described in claim 13 or 14, or an isolated host cell as described in claim 15, or a cell as described in any one of claims 16.

18. The use of the TCR according to any one of claims 1 to 6, or the nucleic acid molecule according to any one of claims 7 to 12, or the vector according to claim 13 or 14, or the isolated host cell according to claim 15, or the cell according to claim 16, characterized in that: The intended use is for preparing a drug to treat acute myeloid leukemia.

Images