Candida tropicalis engineering bacteria, preparation method thereof and method for treating sewage

By knocking out the ACS gene in Candida tropicalis and heterologously expressing α-amylase, the problem of producing acetic acid using starch as a carbon source was solved, and co-cultivation with heterotrophic nitrifying-aerobic denitrifying strains was achieved, thus improving wastewater treatment efficiency.

CN119120241BActive Publication Date: 2026-02-24SHANDONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411194015.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-28
Publication Date
2026-02-24
Estimated Expiration
2044-08-28

AI Technical Summary

Technical Problem

In existing technologies, commonly used external carbon sources such as methanol, sodium acetate, and glucose are not suitable for long-term use in denitrification processes. How can we use genetic engineering to modify microorganisms to efficiently produce acetic acid using starch as a carbon source for wastewater treatment?

Method used

By knocking out the ACS gene in engineered Candida tropicalis and heterologously expressing α-amylase using a strong promoter, it can produce acetic acid using starch as a carbon source. This is then combined with heterotrophic nitrifying-aerobic denitrifying bacteria for co-culture to achieve wastewater treatment.

Benefits of technology

This method enables the efficient production of acetic acid using starch as a carbon source, providing a carbon source for heterotrophic nitrification-aerobic denitrification strains, improving wastewater treatment efficiency, reducing the need for external carbon sources, and enhancing the stability and efficiency of the wastewater treatment system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119120241B_ABST
    Figure CN119120241B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of Candida tropicalis engineering bacteria and its preparation method and the method for treating sewage, belong to genetic engineering technical field.Candida tropicalis engineering bacteria with Candida tropicalis CBW-2 ΔURA3 (preservation number: CGMCC NO.31647) as chassis strain, knock out ACS gene and transfer into promoter heterologous expression alpha-amylase gene;The promoter is endogenous promoter.Candida tropicalis is a kind of unconventional yeast with industrial significance, with the characteristics of fast cell growth, strong environmental tolerance, has the potential of sewage treatment.The present application significantly reduces the activity of acetyl-coenzyme A synthetase by knocking out ACS gene, increases the acetic acid accumulation of strain.And by high-efficiency expression alpha-amylase, starch component can be efficiently converted into acetic acid, can provide acetic acid as carbon source for heterotrophic nitrification-aerobic denitrification strain, without adding exogenous carbon source.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an engineered strain of Candida tropicalis, its preparation method, and a wastewater treatment method. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Wastewater nitrogen removal methods can be mainly divided into physical, chemical, and biological methods. Physical nitrogen removal methods, such as ion exchange and adsorption, have high pollutant retention rates, are uneconomical, and easily cause secondary pollution. Chemical nitrogen removal methods, while having advantages such as simple operation, fast reaction speed, and high denitrification rate, are costly in terms of process and time. Biological nitrogen removal is a method that uses microorganisms to convert organic nitrogen and ammonia nitrogen in wastewater into nitrates and nitrites, and then converts them into nitrogen through ammonification, nitrification, and denitrification. It has significant advantages such as simple process, no secondary pollution, and high cost and efficiency, and has attracted widespread attention. Biological nitrogen removal requires a carbon source: on the one hand, the carbon source can provide nutrients for microbial growth during the nitrogen removal process, helping microorganisms synthesize cellular materials and other metabolites, promoting the growth of bacteria and denitrifying bacteria, and realizing the conversion and removal of ammonia nitrogen; on the other hand, the carbon source can improve microbial activity, accelerate the degradation rate of organic matter, and improve wastewater treatment efficiency. However, due to various technical problems and cost reasons, commonly used external carbon sources, such as methanol, sodium acetate, and glucose, are not suitable for long-term use as external carbon sources for denitrification.

[0004] *Candida tropicalis* is a common, unconventional yeast that can exist in either mycelial or yeast form depending on the environment. It lacks a sexual reproductive stage and exhibits diverse metabolism. Due to its unique metabolites, outstanding assimilation capacity for various carbon sources (glucose, xylose, galactose), and strong environmental tolerance, *Candida tropicalis* holds significant appeal in food (sweetener production), energy (biofuel production), biotechnology (enzyme and polysaccharide production), environmental (bioremediation applications), and medical fields. In yeast cells, acetyl-CoA biosynthesis primarily utilizes acetate as a substrate through the acetyl-CoA synthase (ACS) reaction. Even under glycolytic growth conditions, yeast cells convert pyruvate to acetate under the catalysis of pyruvate decarboxylase (PDC), aldehyde dehydrogenase, and acetyl-CoA synthase. Two known isoforms of acetyl-CoA synthase in yeast are encoded by the genes ACS1 and ACS2, exhibiting 57% sequence identity at the protein level. Both known acetyl-CoA synthases preferentially use acetate or propionate as their primary substrates. Although Candida tropicalis contains α-amylase, its starch utilization efficiency is low, limiting its application.

[0005] Therefore, how to use genetic engineering to modify microorganisms and utilize components in wastewater to generate the carbon source needed for the denitrification process is an urgent problem to be solved. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide an engineered strain of *Candida tropicalis*, its preparation method, and a method for treating wastewater. By knocking out the ACS gene, the engineered *Candida tropicalis* strain is enabled to produce acetic acid. Furthermore, by heterologously expressing α-amylase using a screened strong promoter, the engineered *Candida tropicalis* strain can efficiently produce acetic acid using starch as a carbon source. Co-culturing the engineered *Candida tropicalis* strain with heterotrophic nitrifying-aerobic denitrifying bacteria exhibits excellent wastewater treatment effects.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] Firstly, an engineered strain of Candida tropicalis, using Candida tropicalisCBW-2ΔURA3 as the chassis strain, knocked out the ACS gene and transferred to the promoter to heterologously express the α-amylase gene;

[0009] The starting strain of the chassis strain is Candida tropicalis; the promoter is an endogenous promoter;

[0010] The Candida tropicalis CBW-2ΔURA3 was deposited on August 9, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31647.

[0011] Among them, Candida tropicalisCBW-2ΔURA3 is a uracil-deficient mutant strain.

[0012] Optionally, the ACS genes include: the ACS1 gene and / or the ACS2 gene.

[0013] Secondly, the preparation method of the above-mentioned engineered Candida tropicalis includes the following steps:

[0014] S1. Using Candida tropicalis CBW-2ΔURA3 as the chassis strain, an engineered strain of Candida tropicalis with a single copy knockout of the ACS gene was constructed.

[0015] S2. Culture engineered Candida tropicalis strains under static and shaker culture conditions, and screen for promoters corresponding to proteins that are highly expressed under both static and shaker culture conditions, which are strong promoters for Candida tropicalis.

[0016] S3. Screening to obtain α-amylase gene sequences from fungi, and constructing transformation plasmids containing the promoter obtained in S2 and α-amylase gene sequences from fungi.

[0017] S4. Using the transformation plasmid obtained in S3, transform the single-copy knockout ACS gene engineered bacteria obtained in S1 to obtain Candida tropicalis engineered bacteria.

[0018] Optionally, in S2, the promoter sequence is as shown in SEQ ID No. 35, SEQ ID No. 36, or SEQ ID No. 37.

[0019] Optionally, in S2, samples are taken during the quiescent, logarithmic, and stationary phases of the strain for proteomics analysis.

[0020] Optionally, in S3, the α-amylase gene sequence is derived from Aspergillus salbicans, Aspergillus niger, Sulfolobus solfataricus, or Schwanniomycessoccidentalis.

[0021] Alternatively, the NCBI accession number for the α-amylase gene sequence is GAA83911.1, CAK48325.1, AAK41260.1 or AAB22383.2.

[0022] Optionally, in S4, after transformation, engineered bacteria with high α-amylase expression activity are screened.

[0023] Thirdly, a method for treating wastewater includes the following steps:

[0024] The above-mentioned engineered tropical Candida and heterotrophic nitrifying-aerobic denitrifying strains were co-cultured in wastewater.

[0025] Optionally, the wastewater includes: kitchen waste wastewater, including starch components.

[0026] Optionally, the heterotrophic nitrifying-aerobic denitrifying strain includes: P. stutzeriSDU10 strain.

[0027] Optionally, the co-culture method is as follows: first, inoculate the engineered strain of Candida tropicalis into the wastewater at an inoculation rate of 5-10%, and after 24-36 hours, inoculate the heterotrophic nitrification-aerobic denitrification strain into the wastewater at an inoculation rate of 5-10%.

[0028] The above one or more technical solutions have the following beneficial effects:

[0029] 1. This invention proposes an engineered strain of *Candida tropicalis*, an unconventional yeast with industrial significance, characterized by rapid cell growth, strong environmental tolerance, and potential for wastewater treatment. The *Candida tropicalis* CBW-2ΔURA3 strain used in this invention is a uracil-deficient mutant. By knocking out the ACS gene, the activity of acetyl-CoA synthase is significantly reduced, increasing the accumulation of acetic acid in the strain. Furthermore, through efficient expression of α-amylase, starch can be efficiently converted into acetic acid, providing a carbon source that can be utilized by heterotrophic nitrifying-aerobic denitrifying strains.

[0030] 2. When the engineered Candida tropicalis strain proposed in this invention is applied to the field of wastewater treatment, it can be co-cultured with heterotrophic nitrification-aerobic denitrification strains to provide acetic acid as a carbon source for the heterotrophic nitrification-aerobic denitrification strains without the need to add exogenous carbon sources, which is conducive to the efficient and stable operation of wastewater treatment systems.

[0031] Preservation Instructions

[0032] The *Candida tropicalis* CBW-2ΔURA3 provided by this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 31647 and deposit date of August 9, 2024. Attached Figure Description

[0033] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0034] Figure 1 This is a graph showing the electrophoresis verification results in Embodiment 1 of the present invention.

[0035] Figure 2 The diagram shows the results of mRNA expression level analysis in Embodiment 1 of the present invention, where (a) is the analysis result of the ACS1 gene and (b) is the analysis result of the ACS2 gene.

[0036] Figure 3 This is a graph showing the acetic acid content determination results in Example 1 of the present invention.

[0037] Figure 4 This is a diagram showing the results of fluorescence microscopy observation in Embodiment 1 of the present invention.

[0038] Figure 5 This is a graph showing the results of quantitative analysis of green fluorescent protein levels in Example 1 of the present invention.

[0039] Figure 6 This is a diagram showing the identification results of the transparent ring in Embodiment 1 of the present invention.

[0040] Figure 7 This is a diagram showing the SDS-PAGE protein gel identification results in Example 1 of the present invention.

[0041] Figure 8 This is a graph showing the acetic acid production results in Example 1 of the present invention.

[0042] Figure 9 This is a diagram showing the effect of total nitrogen purification in wastewater in Embodiment 1 of the present invention.

[0043] Figure 10 This is a diagram showing the COD purification effect of wastewater in Embodiment 1 of the present invention. Detailed Implementation

[0044] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.

[0045] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0046] Example 1

[0047] 1. Obtaining uracil-deficient mutant strains of Candida tropicalis

[0048] Using laboratory-preserved *Candida tropicalis* strains as the target strain, we conducted ambient pressure room temperature plasma (ARTP) mutagenesis and nitrosoguanidine chemical mutagenesis. After multiple rounds of screening, single colonies were inoculated onto supplementary and basic culture plates for mutant reversion mutation verification experiments. Finally, one uracil-deficient mutant strain was selected and named *Candida tropicalis* CBW-2ΔURA3 (deposited at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, accession number CGMCC No. 31647, deposited on August 9, 2024, hereinafter referred to as *C. tropicalis* C1).

[0049] After multiple passages of the C. tropicalis C1 strain, genomic DNA of the mutant strain was extracted, and the URA3 gene fragment was amplified by PCR and sequenced. The results showed that the URA3 gene consistently exhibited mutations and base deletions, with no reversion mutations.

[0050] The deletion of the URA3 gene led to the inactivation of orotidine 5-phosphate decarboxylase, thus identifying this mutant strain as a uracil-deficient type. In the C. tropicalalis C1 strain, orotidine 5-phosphate decarboxylase was inactivated, preventing normal growth in basal medium without uracil, but allowing normal growth in uracil-supplemented medium plates, laying an important foundation for subsequent modification of Candida tropicalis.

[0051] 2. Knockout of the ACS gene

[0052] Using the Candida tropicalis genome as a template, PCR amplification was performed using primers ACS1-UHA-F and ACS1-UHA-TrpB-R to obtain the upper homologous arm ACS1-UHA of the ACS1 gene. PCR amplification was performed using primers TrpB-ACS1-DHA-F and ACS1-DHA-R to obtain the lower homologous arm ACS1-DHA of the ACS1 gene.

[0053] Using the Bacillus subtilis genome as a template, PCR amplification was performed using ACS1-UHA-TrpB-F and TrpB-URA3-R primers to obtain the TrpB fragment. The ACS1-UHA fragment was ligated to the TrpB fragment to obtain the fusion fragment ACS1-UHA-TrpB. The PUC-URA3 plasmid was digested with Bgl II and EcoRI enzymes and then ligated to the fusion fragment ACS1-UHA-TrpB to obtain the recombinant plasmid PUC-ACS1-UHA-TrpB-URA3.

[0054] The ACS1-DHA fragment was ligated to the TrpB fragment to obtain the fusion fragment TrpB-ACS1-DHA; the PUC-ACS1-UHA-TrpB-URA3 plasmid was digested with Kpn I and Xba I enzymes and then ligated to the fusion fragment TrpB-ACS1-DHA to obtain the recombinant plasmid PUC-ACS1-UHA-TrpB-URA3-TrpB-ACS1-DHA.

[0055] The recombinant plasmid PUC-ACS2-UHA-TrpB-URA3-TrpB-ACS2-DHA was constructed using a similar method.

[0056] The primer sequences are shown in Table 1 below, as shown in SEQ ID No. 1 to 18.

[0057] Table 1

[0058]

[0059] Electroporation was performed using a pre-cooled 2mm electroporator. A suitable amount of the transformed bacterial culture was spread onto a basic plate and incubated at 30°C for 3 days. Colony growth was observed. If colonies grew on the SM-5-fluoroorotic acid plate, it was tentatively considered that the plasmid fragment matched the ACS1 gene on the chromosome and successfully ejected the URA3 gene. A suitable amount of bacterial culture was then used to extract yeast genomic DNA, which was verified by PCR using ACS1-YZ-F and ACS1-YZ-R primers. The strain was named *C. tropicalis* C1-1.

[0060] Using a similar method, the successful knockout of the ACS2 gene was verified, and the strain was named C. tropicalalis C1-2.

[0061] RNA was extracted from C. tropicalis C1, C. tropicalis C1-1, and C. tropicalis C1-2 strains for qRT-PCR. The extracted RNA fragments were then verified by electrophoresis. The results are as follows: Figure 1As shown. RNA samples of acceptable quality were selected as templates for cDNA synthesis and qRT-PCR analysis of the ACS1 gene. The log(2-ΔΔct) method was used, and the mRNA expression level of the URA3 gene was set to 100% for analysis. The results are shown below. Figure 2 As shown in (a) above; RNA of acceptable quality was selected as a template to synthesize cDNA for qRT-PCR analysis of the ACS2 gene. The log(2-ΔΔct) method was used, and the mRNA expression level of the URA3 gene was set to 100% for analysis. The analysis results are shown below. Figure 2 As shown in (b) of the diagram.

[0062] From the experimental results Figure 2 (a) It can be seen that knocking out one copy of the ACS1 gene in the C. tropicalis C1-1 strain resulted in a decrease in the transcriptional level of the ACS1 gene, with a relative expression level reduction of 30.13%; from the experimental results... Figure 2 As shown in (b), knocking out one copy of the ACS2 gene in the C. tropicalis C1-2 strain significantly reduced the transcriptional level of the ACS1 gene, with a relative expression decrease of 47.94%. This demonstrates at the transcriptional level that knocking out one copy of either ACS1 or ACS2 alone can reduce the relative expression of the ACS1 and ACS2 genes, potentially affecting their transcriptional levels in the acetic acid metabolic pathway.

[0063] The activated C. tropicalalis C1, C. tropicalalis C1-1, and C. tropicalalis C1-2 strains were inoculated at a rate of 5% into 20 ml of basic culture medium and cultured for 24 h. The supernatant was then analyzed using HPLC. The results are as follows: Figure 3 As shown.

[0064] Figure 3 In the study, the acetic acid production of C. tropicalalis C1 strain was 0.759 g / L; that of C. tropicalalis C1-1 strain was 1.458 g / L; and that of C. tropicalalis C1-2 strain was 2.082 g / L. Therefore, C. tropicalalis C1-2 strain was selected for further modification. The acetic acid measurement results showed that single-copy knockout of the ACS2 gene reduced the protein expression level of acetyl-CoA synthase, decreased acetic acid consumption, and thus promoted the accumulation of acetic acid in *C. tropicalalis*.

[0065] 3. Proteomics analysis of promoter strength and validation

[0066] After activation, *C. tropicalis* C1 strain was inoculated into 50 mL of YPD liquid medium at a 1% inoculum rate. Two groups were set up, with three replicates in each group. One group was placed in a 30℃ incubator for static incubation, and the other group was placed in a shaker at 30℃ and 180 rpm for shaking incubation. 1 mL samples were taken every 2 hours to detect OD. 600 Growth curves were plotted, and the results showed that the strain was in a static phase from 0 to 10 hours, with slow cell metabolism and growth; from 10 to 22 hours, the cell growth rate increased exponentially, and metabolism was vigorous; the cell number peaked from 24 to 38 hours. Therefore, 5 mL samples were taken at 8 hours of static phase, 14 hours of logarithmic growth phase, and 24 hours of stationary phase to obtain three groups of differentially upregulated protein samples for proteomics analysis. The qualitative and quantitative analysis of proteins was achieved by labeling proteins or peptides using iTRAQ (Isobaric Tags for Relative and Absolute Quantitation) technology.

[0067] Ten representative proteins that were significantly upregulated under different culture conditions were selected. Three more significantly upregulated proteins were randomly selected from these ten proteins. Gene information was obtained from the NCBI website. The promoters of the GADPH, PGK, and FBA1 genes were selected for subsequent experiments.

[0068] The sequence of promoters is as follows.

[0069] P GAPDH The promoter of the GADPH gene is shown in SEQ ID No. 35:

[0070]

[0071] P PGK The promoter for the PGK gene is shown in SEQ ID No. 36:

[0072]

[0073] P FBA1 The promoter of the FBA1 gene is shown in SEQ ID No. 37:

[0074]

[0075] Using *Candida tropicalis* CBW-2 (deposited at the China General Microbiological Culture Collection Center, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, accession number CGMCC No. 31646, deposited on August 9, 2024) as a template, and with P... GAPDH -F、P GADPH Using GFP-R as primers, PCR cloning yielded a band approximately 1000 bp in size, close to the theoretical value of 1000 bp. The target fragment was recovered in liquid form. GADPH Using GFP-F and GFP-TR as primers, PCR cloning yielded a band approximately 700 bp in size, close to the theoretical value of 714 bp. The target fragment was recovered in liquid form. Fusion PCR was then performed using P... GAPDH Using primers -F and GFP-TR, PCR cloning yielded a band approximately 1800 bp in size, close to the theoretical value of 1714 bp. The liquid sample was sent to a third-party sequencing facility, and the sequence alignment was consistent. Therefore, it is believed that P... GADPH -GFP fusion successful. P was obtained using a similar method. PGK -GFP, P FBA1 -GFP fragment.

[0076] The PYES2-URA3 plasmid was digested with Kpn I, and the liquid-recovered P GADPH - The GFP fragment was ligated into the PYES2-URA3 plasmid digested with KpnI to obtain PYES2-P GADPH -GFP-URA3 plasmid; the ligation product was transformed into E. coli DH5α, plated on LB agar plates containing Amp resistance and cultured overnight. Single colonies were picked and screened by colony PCR using the validation primers PYES2-YZ-F and PYES2-YZ-R on the vector. A band of approximately 2000 bp was obtained, close to the theoretical value of 1894 bp. Plasmids that were likely to be successfully ligated were inoculated into LB liquid medium, extracted, and sent to a third-party sequencing facility. The sequence alignment was correct, and the plasmids will be used for subsequent experiments. A similar method was used to obtain...

[0077] PYES2-P PGK -GFP-URA3 and PYES2-P FBA1 -GFP-URA3 plasmid.

[0078] Table 2

[0079]

[0080] 10 μL of PYES2-P concentrated using electroconversion method GADPHThe GFP-URA3 plasmid was introduced into competent *Candida tropicalis* cells, and the genomes of colonies grown on basic plates were verified by PCR using primers PYES2-YZ-F and PYES2-YZ-R. The successfully transformed strain was named *C. tropicalis* C1-4-1. PYES2-P... FBA1 -GFP-URA3, PYES2-P PGK The -GFP-URA3 plasmid was used to name the strains C. tropicalalis C1-4-2 and C. tropicalalis C1-4-3, respectively.

[0081] C. tropicalis C1, C. tropicalis C1-4-1, C. tropicalis C1-4-2, and C. tropicalis C1-4-3 strains were inoculated from plates into basic liquid culture medium and cultured until the bacterial OD600 reached 2.0. After washing 2-3 times with PBS buffer, the fluorescence of each strain was observed using a fluorescence microscope. The results are as follows: Figure 4 As shown in the figure, strain C1 (C. tropicalalis C1) did not produce green fluorescence under UV excitation; strain 4-1 (C. tropicalalis C1-4-1) produced strong and stable green fluorescence under UV excitation; strain 4-2 (C. tropicalalis C1-4-2) showed relatively strong green fluorescence with extended exposure time; and strain 4-3 (C. tropicalalis C1-4-3) showed weak and unstable green fluorescence with extended exposure time.

[0082] The levels of green fluorescent protein (GFP) in strains of *C. tropicalalis* C1, C. tropicalalis C1-4-1, C. tropicalalis C1-4-2, and C. tropicalalis C1-4-3 were quantitatively analyzed using cell imaging microplates. The results were largely consistent with those observed under fluorescence microscopy. Figure 5 As shown.

[0083] Qualitative analysis of green fluorescent protein using fluorescence microscopy and cellular fluorescence microplates, along with quantification by qRT-PCR of extracted total RNA, determined the expression intensities of three promoters, consistent with results obtained through proteomics analysis. Therefore, P was ultimately selected. GADPH The promoter was used for subsequent experiments.

[0084] 4. Heterologous expression of α-amylase in Candida tropicalis

[0085] Four α-amylase gene sequences from fungi were obtained through literature review and NCBI database screening: Aspergillus salbicans, Aspergillus niger, Sulfolobus sofataricus, and Schwanniomycessoccidentalis.

[0086] The NCBI accession numbers for the selected α-amylase gene sequences are GAA83911.1, CAK48325.1, AAK41260.1, or AAB22383.2. Plasmids constructed using a third-party company are shown in Table 3.

[0087] Table 3

[0088]

[0089] The PYES2-PGADPH-AL-URA3 plasmid was concentrated using the ethanol concentration method, and the concentration of the concentrated plasmid was determined using a nucleic acid micro-spectrophotometer. 10 μL of the concentrated plasmid was mixed with competent *Candida tropicalis* cells, electroporated twice at 1500 V for 5 ms, plated, and incubated overnight. Colony PCR was performed using primer pairs PYES2-YZ-2-F and PYES2-YZ-2-R ​​as shown in Table 4. The strain successfully electroporated with the plasmid was named *C. tropicalis*C1-2-1. Plasmid PYES2-P was electroporated using a similar method. GADPH- AN-URA3, PYES2-P GADPH -SS-URA3 and PYES2-P GADPH -SO-URA3, the strains that were successfully electroporated were named C. tropi-calis C1-2-2, C. tropicalis C1-2-3 and C. tropicalis C1-2-4.

[0090] Table 4

[0091] Sequence List Number name Base sequence (5'-3') SEQ ID No. 33 PYES2-YZ-2-F GCTTTTTGCTCTCTGACTCCTCCCAATCAG SEQ ID No. 34 PYES2-YZ-2-R CATAACTAATTACATGATGCGGCCCTCTAG

[0092] C. tropicalis C1-2-1, C. tropicalis C1-2-2, C. tropicalis C1-2-3, and C. tropicalis C1-2-4, verified by colony PCR, were transformed and activated, then plated. Single colonies were picked from each colony and spotted onto plates (the culture medium in the plates used soluble starch as the carbon source). The plates were incubated overnight at 30°C until colonies appeared. The plates were then removed, iodine solution was poured into them, and the plates were placed in a 4°C refrigerator for several hours to check for the formation and size of the clear zone. Results are as follows: Figure 6 As shown in the figure, the diameter of the transparent zone indirectly indicates the strength of α-amylase activity among strains; the larger the diameter, the stronger the α-amylase activity. It can be seen from the figure that strains C. tropicalis-2-1 and C. tropicalis-2-2 have relatively larger transparent zone diameters, indicating higher α-amylase activity in these strains.

[0093] C. tropicalalis C1-2, C. tropicalalis C1-2-1, C. tropicalalis C1-2-2, C. tropicalalis C1-2-3, and C. tropicalalis C1-2-4 strains were cultured until the OD600 reached approximately 2.0. 5 mL of the bacterial culture was then centrifuged at 10000 rpm for 5 min to collect the bacterial cells. Protein samples were prepared, and the total protein expression level of the bacterial cells was determined. The samples were then loaded as follows: Figure 7 As shown.

[0094] α-Amylase protein has a molecular weight of approximately 45 kDa, such as Figure 7 As shown in the green box in the figure, columns 1-4 are from *C. tropicalalis* C1-2-1; columns 5-7 are from *C. tropicalalis* C1-2-2; columns 8-10 are from *C. tropicalalis* C1-2-3; columns 11-13 are from *C. tropicalalis* C1-2-4; and column 14 is from *C. tropicalalis* C1-2. A clear and distinct band exists around 40-50 kDa, while the band in column 14 representing *C. tropicalalis* C1-2 is darker and less distinct. These results indicate successful heterologous expression of α-amylase in *C. tropicalalis*.

[0095] Using *C. tropicalalis* C1-2 as a control, *C. tropicalalis* C1-2-1, C. tropicalalis C1-2-2, C. tropicalalis C1-2-3, and C. tropicalalis C1-2-4 were inoculated at a rate of 5% and transferred to 50 mL of supplemented medium with soluble starch as the carbon source. The medium was cultured for 24 h, centrifuged at 12000 rpm for 5 min to collect the supernatant, boiled for 5 min, and centrifuged again at 12000 rpm for 5 min to collect the supernatant. The supernatant was filtered through a 0.22 μm organic filter, and the acetic acid content was determined by HPLC. The results are as follows: Figure 8 As shown in the figure, the control strain C. tropicalis C1-2, using starch as the carbon source, showed poor growth and an acetic acid content of only 0.721 g / L, which was significantly different from that when glucose was used as the carbon source. The four experimental strains, including C. tropicalis C1-2-1, showed better growth when starch was used as the carbon source, but their acetic acid production varied significantly. For example, the acetic acid production in the supernatant of C. tropicalis C1-2-1 after 24 h of culture reached 1.592 g / L, about twice that of C. tropicalis C1-2-2. The acetic acid production in the supernatant of C. tropicalis C1-2-3 after 24 h of culture reached 0.699 g / L, which was basically consistent with that of C. tropicalis C1-2-2. The acetic acid production in the supernatant of C. tropicalis C1-2-2 and C. tropicalis C1-2-4 after 24 h of culture was between that of C. tropicalis C1-2-1 and C. tropicalis C1-2-3. In summary, after culturing in a starch-supplemented medium for 24 hours, the *C. tropicalalis* C1-2-1 strain produced the highest acetic acid content, reaching 1.592 g / L, and exhibited excellent growth. Therefore, *C. tropicalalis* C1-2-1 strain was selected as the target strain for subsequent experiments.

[0096] 5. Co-culture with denitrifying strains for the treatment of total nitrogen in wastewater

[0097] The heterotrophic nitrifying-aerobic denitrifying strain *P. stutzeri* SDU10 exhibits strong environmental tolerance, overcoming the shortcomings of traditional biological nitrogen removal methods. Simultaneously, *P. stutzeri* SDU10 can perform both nitrification and denitrification, reducing treatment costs and cycle time, and providing a good candidate strain for reducing total nitrogen content in wastewater. When using sodium acetate as a carbon source, *P. stutzeri* SDU10 demonstrates excellent nitrogen removal efficiency, achieving a total nitrogen removal rate of 83.4%. The following study aims to utilize the high acetic acid production of *C. tropicalis* strain to provide a carbon source for *P. stutzeri* SDU10, and reduce the total nitrogen content in wastewater through co-cultivation.

[0098] Basic information on P. sttutzeri SDU10 strain can be found in the following paper: Chen Lifei. Analysis of microbial community structure in pig manure treatment by microbial nests and study on screening of denitrifying bacteria and bioaugmentation [D]. Shandong University, 2022.

[0099] With initial total nitrogen and COD concentrations of 100 mg / L and 1190 mg / L, respectively, two inoculation methods were employed. The first method involved simultaneously inoculating *C. tropicalis* C1-2-1 and *P. sttutzeri* SDU10 into the food waste wastewater at a 5% inoculation rate. The second method involved first inoculating *C. tropicalis* C1-2-1 into the food waste wastewater at a 5% inoculation rate and culturing for 24 hours, followed by inoculating *P. sttutzeri* SDU10 into the same food waste wastewater at a 5% inoculation rate. 5 mL samples were taken every 12 hours to measure the total nitrogen and COD concentrations.

[0100] After 48 hours, the total nitrogen content of the wastewater inoculated with both *C. tropicalalis* C1-2-1 and *P. sttutzeri* SDU10 was 29.14 mg / L (e.g., ...). Figure 9 As shown in (A), the COD concentration is 276 mg / L (as shown in Figure 1). Figure 10 (As shown in (A)), the removal rates were 70.86% and 76.81%, respectively; after adding C. tropicalis C1-2-1 and culturing for 24 h, 5% of P. sttutzeri SDU10 was added as an inoculum, and the total nitrogen content of the wastewater was 21.70 mg / L (as shown in (A)). Figure 9 (As shown in (B)), the COD concentration was 197.3 mg / L (as shown in (B)). Figure 10 (As shown in (B)), their removal rates were 78.3% and 83.42%, respectively. Figure 10 As shown in the figure. In contrast, the second inoculation method, which involves inoculation one after the other, significantly improves the removal rates of total nitrogen and COD.

[0101] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An engineered strain of Candida tropicalis, characterized in that, by Candida tropicalis CBW-2 ΔURA3 is a chassis strain with the ACS gene knocked out and an endogenous strong promoter of Candida tropicalis introduced, as well as a heterologous expression of α-amylase gene from fungi driven by the endogenous strong promoter. The starting strain of the chassis strain is Candida tropicalis; The Candida tropicalis CBW-2 ΔURA3 was deposited on August 9, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31647.

2. The engineered Candida tropicalis strain as described in claim 1, characterized in that, The ACS genes include: the ACS1 gene and / or the ACS2 gene.

3. A method for preparing engineered Candida tropicalis strains as described in any one of claims 1-2, comprising the steps of: S1, with Candida tropicalis CBW-2 ΔURA3 was used as the chassis strain to construct an engineered Candida tropicalis strain with a single copy of the ACS gene knocked out. S2. Culture engineered Candida tropicalis strains under static and shaker culture conditions, and screen for promoters corresponding to proteins that are highly expressed under both static and shaker culture conditions, which are strong promoters for Candida tropicalis. S3. Screening to obtain the α-amylase gene sequence from fungi, and constructing a transformation plasmid containing the promoter obtained in S2 and the α-amylase gene sequence from fungi. S4. Using the transformation plasmid obtained in S3, transform the single-copy knockout ACS gene engineered bacteria obtained in S1 to obtain the tropical Candida α-amylase engineered bacteria.

4. The method for preparing the engineered strain of *Candida tropicalis* α-amylase as described in claim 3, characterized in that, In S2, the promoter sequence is shown as SEQ ID No. 35, SEQ ID No. 36 or SEQ ID No.

37.

5. The method for preparing the engineered strain of *Candida tropicalis* α-amylase as described in claim 3, characterized in that, In S2, samples were taken during the quiescent, logarithmic, and stationary phases of the strain for proteomics analysis.

6. The method for preparing the engineered strain of *Candida tropicalis* α-amylase as described in claim 3, characterized in that, In S3, the α-amylase gene sequence is derived from Aspergillus white mold ( Aaspergillus albicans ), Aspergillus niger ( Aspergillus niger ), sulfur mineral sulfide leaf fungus ( Sulfolobus solfataricus Perhaps the yeast ( Schwanniomycess occidentalis ).

7. The method for preparing the engineered strain of *Candida tropicalis* α-amylase as described in claim 3, characterized in that, In S3, the NCBI accession numbers for the α-amylase gene sequence are GAA83911.1, CAK48325.1, AAK41260.1, or AAB22383.

2.

8. The method for preparing the engineered strain of *Candida tropicalis* α-amylase as described in claim 3, characterized in that, In S4, after transformation, engineered bacteria with high α-amylase expression activity are screened.

9. A wastewater treatment method, characterized in that, The engineered strain of Tropical Candida α-amylase as described in any one of claims 1-2 and the heterotrophic nitrifying-aerobic denitrifying strain are co-cultured in wastewater; The wastewater contains starch and includes wastewater from kitchen waste.

10. A wastewater treatment method as described in claim 9, characterized in that, The co-culture method is as follows: first, inoculate the engineered strain of Candida tropicalis into the wastewater at an inoculation rate of 5-10%, and after 24-36 hours, inoculate the heterotrophic nitrification-aerobic denitrification strain into the wastewater at an inoculation rate of 5-10%.

11. A wastewater treatment method as described in claim 10, characterized in that, The heterotrophic nitrifying-aerobic denitrifying strain is: P. sttutzeri SDU10 strain.

Citation Information

Patent Citations

  • Candida tropicalis capable of treating high-salinity organic chemical wastewater, and application of candida tropicalis

    CN104560746A

  • Glycerol and acetic acid converting yeast cells with improved acetic acid conversion

    WO2015028582A2