CRISPR-Cas12i system

Abstract

The present disclosure provides a Cas12i protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identity with the amino acid sequence represented by any one of SEQ ID NO: 1-10 (preferably, SEQ ID NO: 1-3 and 6, more preferably, SEQ ID NO: 1). The present disclosure also provides an engineered, non-naturally occurring CRISPR-Cas system comprising: (1) the Cas12i protein or a polynucleotide encoding the Cas12i protein, and (2) a Cas12i protein or a polynucleotide encoding the Cas12i protein; and (2) a CRISPR RNA (crRNA) or a polynucleotide encoding the crRNA, the crRNA comprising: (i) a spacer sequence capable of hybridizing to a target sequence of a target DNA, and (ii) a direct repeat (DR) sequence linked to the spacer sequence capable of directing the binding of the Cas12i protein to the crRNA to form a CRISPR-Cas complex that targets the target sequence.

Description

[0001] This application is a divisional application of the patent application with application number 202111290670.8 and invention name “A CRISPR-Cas12i system”. Technical Field

[0002] The present invention relates to a novel CRISPR-Cas12i system. Background Art

[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes, collectively referred to as CRISPR-Cas or CRISPR / Cas systems, are now understood to provide immunity to bacteria and archaea against phage infection. The CRISPR-Cas system of prokaryotic adaptive immunity is an extremely diverse set of effectors, noncoding elements, and locus structures that can be engineered and used for applications such as gene editing, target detection, and disease treatment. Zhang Feng et al. discovered the Cas12a protein (formerly known as the Cpf1 protein), which can be used for gene editing and genetic diagnosis. Later, more Cas12 proteins were discovered, including Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10 / Cas14), and Cas12k (C2c5), but each has its own advantages and disadvantages.

[0004] Despite the existing technologies, the art still needs new Cas proteins and CRISPR-Cas systems to meet diverse application requirements. Summary of the invention

[0005] The present invention meets the above needs by providing new Cas12i proteins and CRISPR-Cas systems.

[0006] In one aspect, the present invention provides a Cas12i protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identity to the amino acid sequence shown in any one of SEQ ID NOs: 1-10 (preferably, SEQ ID NOs: 1-3 and 6, more preferably, SEQ ID NO: 1).

[0007] In one embodiment, the Cas12i protein is substantially lacking (e.g., retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or less) the corresponding wild-type Cas12i protein for the target sequence of the target DNA complementary to the guide sequence. Spacer specific endonuclease cleavage activity. In another embodiment, the Cas12i protein is connected to one or more functional domains.

[0008] In one aspect, the present invention provides a polynucleotide encoding the Cas12i protein. In another aspect, the present invention provides a vector comprising the polynucleotide. In another aspect, the present invention provides a delivery system comprising (1) a delivery medium; and (2) the Cas12i protein, polynucleotide or vector.

[0009] In one aspect, the invention provides an engineered, non-naturally occurring CRISPR-Cas system comprising:

[0010] (1) the Cas12i protein or a polynucleotide encoding the Cas12i protein; and

[0011] (2) CRISPR RNA (crRNA) or a polynucleotide encoding the crRNA, wherein the crRNA comprises:

[0012] (i) a spacer sequence capable of hybridizing with a target sequence of a target DNA, and

[0013] (ii) a direct repeat (DR) sequence connected to the spacer sequence that can guide the Cas12i protein to bind to the crRNA to form a CRISPR-Cas complex targeting the target sequence.

[0014] In another aspect, the present invention provides a CRISPR-Cas system comprising one or more vectors, wherein the one or more vectors comprise:

[0015] (1) a first regulatory element, which is operably linked to a nucleotide sequence encoding the Cas12i protein; and

[0016] (2) a second regulatory element, the second regulatory element being operably linked to a polynucleotide encoding a CRISPR RNA (crRNA), the crRNA comprising:

[0017] (i) a spacer sequence capable of hybridizing with a target sequence of a target DNA, and

[0018] (ii) a direct repeat (DR) sequence connected to the spacer sequence that can guide the Cas12i protein to bind to the crRNA to form a CRISPR-Cas complex targeting the target sequence;

[0019] Wherein the first regulatory element and the second regulatory element are located on the same or different vectors of the CRISPR-Cas vector system.

[0020] In another aspect, the present invention provides an engineered, non-naturally occurring CRISPR-Cas complex comprising:

[0021] (1) the Cas12i protein; and

[0022] (2) CRISPR RNA (crRNA), wherein the crRNA comprises:

[0023] (i) a spacer sequence capable of hybridizing with a target sequence of a target DNA, and

[0024] (ii) a direct repeat (DR) sequence connected to the spacer sequence; the DR sequence guides the Cas12i protein to bind to the crRNA.

[0025] In one aspect, the present invention provides a method for modifying a target DNA, comprising contacting the target DNA with the CRISPR-Cas system or complex, wherein the contact results in modification of the target DNA by the Cas12i protein.

[0026] In one aspect, the present invention provides a cell or its progeny, comprising the Cas12i protein, polynucleotide, vector, delivery system, CRISPR-Cas system or complex, preferably, the cell is selected from prokaryotic cells, eukaryotic cells, animal cells, plant cells, fungal cells, vertebrate cells, invertebrate cells, rodent cells, mammalian cells, primate cells, non-human primate cells, and human cells.

[0027] In another aspect, the present invention provides a non-human multicellular organism comprising the cell or its progeny; preferably, the non-human multicellular organism is an animal (eg, rodent or non-human primate) model for human gene-related diseases.

[0028] In one aspect, the present invention provides a method for modifying a target DNA, comprising contacting the target DNA with the CRISPR-Cas system or complex, wherein the contact results in modification of the target DNA by the Cas12i protein.

[0029] In another aspect, the invention provides a cell or its progeny from the method, comprising the modification not present in a cell not subjected to the method. In another aspect, the invention provides a cell product from the cell or its progeny, wherein the product is modified in a property or amount relative to a cell product from a cell not subjected to the method.

[0030] In one aspect, the present invention provides a method for non-specific cleavage of non-target DNA, the method comprising contacting the target DNA with the CRISPR-Cas system or complex, whereby the spacer sequence hybridizes with the target sequence of the target DNA and the cleavage of the target sequence by the Cas12i protein results in the Cas12i protein cleaving the non-target DNA by the spacer sequence non-specific nuclease side cutting activity.

[0031] In another aspect, the present invention provides a method for detecting a target DNA in a sample, the method comprising:

[0032] (1) contacting the sample with the CRISPR-Cas system or complex and a reporter nucleic acid that releases a detectable signal after being cut, whereby hybridization of the spacer sequence with the target sequence of the target DNA and cleavage of the target sequence by the Cas12i protein results in cleavage of the reporter nucleic acid by the Cas12i protein through the non-specific nuclease activity of the spacer sequence; and

[0033] (2) Measuring a detectable signal generated by cleavage of the reporter nucleic acid, thereby detecting the presence of the target DNA in the sample.

[0034] In another aspect, the present invention provides a method of treating a disorder or disease in a subject in need thereof, the method comprising administering the CRISPR-Cas system to the subject.

[0035] In one aspect, the present invention provides a kit comprising the CRISPR-Cas system; preferably, the components of the system are in the same container or in separate containers. In another aspect, the present invention provides a sterile container comprising the CRISPR-Cas system; preferably, the sterile container is a syringe. In another aspect, the present invention provides an implantable device comprising the CRISPR-Cas system; preferably, the CRISPR-Cas system is stored in a reservoir. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 : Schematic diagram of BFP-P2A-GFxFP fluorescence reporter system.

[0037] Figure 2 : Results of cells transfected with SiCas12i-crRNA under a fluorescence microscope.

[0038] Figure 3 : Comparison of cutting activity between 10 new Cas12i and SpCas9, LbCas12i, and Cas12i.3.

[0039] Figure 4 :Testing of PAM applicability of SiCas12i.

[0040] Figure 5 :Test of the applicable spacer length of SiCas12i.

[0041] Figure 6 : Comparison of the cleavage activity of SiCas12i with SpCas9, LbCas12i, and Cas12i.3 on the TTR gene.

[0042] Figure 7 : Comparison of the cleavage activity of SiCas12i and Cas12i.3 on different sites of the TTR gene.

[0043] Figure 8 : Comparison of the cleavage activity of SiCas12i and Cas12i.3 at different sites of the PCSK9 gene.

[0044] Fig. 9 : Comparison of cleavage activity of SiCas12i mutants with four different point mutations, namely D700A, D650A, E875A and D1049A single mutation variant versions of WT SiCas12.i, which reduce or eliminate cleavage activity.

[0045] Fig.10 :Single base editing (A->I) activity test of dSiCas12i-TadA8e.

[0046] Fig.11 : Comparison of cleavage activity of SiCas12i under different DR variants. DETAILED DESCRIPTION

[0047] Novel Cas12i protein

[0048] The present invention discovers new Cas12i proteins, such as SiCas12i, Si2Cas12i, WiCas12i, Wi2Cas12i, Wi3Cas12i, SaCas12i, Sa2Cas12i, Sa3Cas12i, WaCas12i and Wa2Cas12i, which have single-stranded or double-stranded DNA cleavage activity, and the sequence identity with other known Cas12i is less than about 50%. Compared with other Cas such as Cas9 or Cas12, the molecule is smaller and has better delivery efficiency.

[0049] Cas12i proteins, such as SiCas12i, Si2Cas12i, WiCas12i and SaCas12i, have excellent cleavage activity for exogenous genes or endogenous genes in vitro or at the cellular level, which is comparable to or even better than the cleavage activity of SpCas9, LbCas12a, and Cas12i.3. Cas12i proteins, such as SiCas12i, Si2Cas12i, WiCas12i and SaCas12i, have cleavage activity for specific target sequences of exogenous genes or endogenous genes at the cellular level that can reach greater than about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or even greater than 99%. In general, their cleavage activity for specific target sequences of exogenous genes or endogenous genes at the cellular level is better than Cas12i.3.

[0050] SiCas12i is comparable to SpCas9 or LbCas12a in cutting activity of exogenous genes or endogenous genes in vitro or at the cellular level, or even better, and significantly better than Cas12i.3. Its cutting activity for specific target sequences of exogenous genes or endogenous genes at the cellular level can reach greater than about 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or even greater than 99%. In general, SiCas12i is significantly better than Cas12i.3 in cutting activity for specific target sequences of exogenous genes or endogenous genes at the cellular level.

[0051] The above novel Cas12i protein may also contain amino acid mutations that have no substantial effect on the catalytic activity (endonuclease cleavage activity) or nucleic acid binding function of the Cas12i.

[0052] Cas12i protein substantially lacking catalytic activity (dCas12i)

[0053] The present invention also provides a dCas12i protein lacking catalytic activity, for example, retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or less) of the corresponding wild-type Cas12i protein for the target sequence of the target DNA complementary to the guide sequence. Spacer specific nuclease cleavage activity. It comprises one or more amino acid substitutions of the RuvC domain, and the one or more amino acid substitutions result in a substantial lack of catalytic activity, such as a substitution at one or more positions corresponding to the 700th, 650th, 875th or 1049th position of the sequence shown in SEQ ID NO: 1, and the substitution is D700A, V; D650A, V; E875A, V; or D1049A, V. In one embodiment, dCas12i has an amino acid sequence shown in SEQ ID NO: 79-82. In addition, dCas12i may also include other mutations other than the aforementioned mutations, and the other mutations have no substantial effect on the catalytic activity or nucleic acid binding function of the dCas12i protein. The dCas12i protein substantially lacking catalytic activity can be used as a DNA binding protein.

[0054] As described above, dCas12i can be associated with adenosine deaminase or cytidine deaminase or their catalytic domains to achieve single base editing, and the efficiency of base conversion is higher than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

[0055] The number of full-length amino acids of Cas12i or dCas12i described above in the present invention is significantly less than that of other types of Cas12 proteins, and the small molecule facilitates the assembly and delivery of the subsequent Cas system.

[0056] The present invention provides the following embodiments:

[0057] 1. A Cas12i protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identity to the amino acid sequence shown in any one of SEQ ID NO: 1-10 (preferably, SEQ ID NO: 1-3 and 6, more preferably, SEQ ID NO: 1).

[0058] The Cas12i protein may also contain amino acid mutations that have no substantial effect on the catalytic activity (endonuclease cleavage activity) or nucleic acid binding function of Cas12i.

[0059] 2. The Cas12i protein of any one of the aforementioned embodiments, wherein the Cas12i protein substantially lacks (e.g., retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or less) the corresponding wild-type Cas12i protein for a target sequence of a target DNA complementary to a guide sequence. Spacer) specific endonuclease cleavage activity.

[0060] In one embodiment, the Cas12i substantially lacks (e.g., retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or less) the spacer-specific endonuclease cleavage activity or the spacer-nonspecific side-cutting activity of the corresponding wild-type Cas12i protein.

[0061] 3. The Cas12i protein of any one of the aforementioned embodiments, wherein the Cas12i protein is included in one or more amino acid changes in its RuvC domain so that the Cas12i protein is substantially lacking (e.g., retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or less) of the corresponding wild-type Cas12i protein for a target sequence of a target DNA complementary to a guide sequence. Spacer) specific endonuclease cleavage activity.

[0062] 4. The Cas12i protein according to any one of the preceding embodiments, wherein the amino acid change is selected from amino acid addition, insertion, deletion and substitution;

[0063] 5. The Cas12i protein of any one of the foregoing embodiments, wherein the Cas12i protein is included in an amino acid replacement at one or more positions corresponding to the 700th (D700), the 650th (D650), the 875th (E875) or the 1049th (D1049) of the sequence shown in SEQ ID NO: 1.

[0064] The amino acid at the above amino acid position (D700, D650, E875 or D1049) may be mutated to another amino acid different from the corresponding amino acid in the wild-type sequence to substantially lose the endonuclease cleavage activity.

[0065] The Cas12i protein may also contain other mutations, which have no substantial effect on the catalytic activity or nucleic acid binding function of the Cas12i.

[0066] 6. The Cas12i protein according to any one of the aforementioned embodiments, wherein the amino acid substitution is selected from D700A / V, D650A / V, E875A / V and D1049A / V.

[0067] 7. The Cas12i protein according to any one of the aforementioned embodiments, wherein the amino acid substitution is selected from D700A, D650A, E875A and D1049A.

[0068] 8. the Cas12i protein according to any one of the aforementioned embodiments, wherein the amino acid replacement is selected from D700A, D650A, E875A, D1049A, D700A+D650A, D700A+E875A, D700A+D1049A, D650A+E875A, D650A+D1049A, E875A+D1049A, D700A+D650A+E875A, D700A+D650A+D1049A, D650A+E875A+D1049A, and D700A+D650A+E875A+D1049A.

[0069] 9. The Cas12i protein according to any one of the foregoing embodiments, wherein the Cas12i protein comprises the amino acid sequence shown in any one of SEQ ID NO:79-82.

[0070] 10. The Cas12i protein of any one of the preceding embodiments, which is connected to one or more functional domains.

[0071] 11. The Cas12i protein according to any one of the foregoing embodiments, wherein the functional domain is connected to the N-terminus and / or the C-terminus of the Cas12i protein.

[0072] The connection may be direct or indirect via a linker.

[0073] 12. The Cas12i protein of any one of the foregoing embodiments, wherein the functional domain is selected from a nuclear localization signal (NLS), a nuclear export signal (NES), a deaminase (e.g., adenosine deaminase or cytidine deaminase) catalytic domain, a DNA methylation catalytic domain, a histone residue modification domain, a nuclease catalytic domain, a fluorescent protein, a transcription modifier, a light-gated factor, a chemically inducible factor, a chromatin visualization factor, a targeting polypeptide for providing a binding to a cell surface portion on a target cell or a target cell type.

[0074] 13. The Cas12i protein of any one of the aforementioned embodiments, wherein the functional domain exhibits an activity of modifying target DNA, selected from: nuclease activity, methylation activity, demethylation activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitinating activity, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosylation activity, deribosylation activity, myristoylation activity, demyristoylation activity, glycosylation activity (e.g., from O-GlcNAc transferase), deglycosylation activity, transcription inhibition activity, transcription activation activity.

[0075] 14. The Cas12i protein of any one of the foregoing embodiments, wherein the functional domain is selected from an adenosine deaminase catalytic domain or a cytidine deaminase catalytic domain.

[0076] 15. The Cas12i protein of any one of the aforementioned embodiments, wherein the functional domain is the full length or functional fragment of TadA8e.

[0077] 16. The Cas12i protein according to any one of the aforementioned embodiments, wherein the Cas12i protein comprises the amino acid sequence shown in SEQ ID NO:85.

[0078] 17. The Cas12i protein of any one of the aforementioned embodiments, which is modified to reduce or eliminate the non-specific endonuclease lateral cutting activity of the spacer sequence.

[0079] 18. A polynucleotide encoding the Cas12i protein of any one of the preceding embodiments.

[0080] 19. The polynucleotide of any of the preceding embodiments, which is codon-optimized for expression in eukaryotic cells.

[0081] 20. The polynucleotide of any of the preceding embodiments, comprising a nucleotide sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical to the nucleotide sequence shown in any one of SEQ ID NOs: 11-20 and SEQ ID NOs: 37-46.

[0082] 21. A vector comprising the polynucleotide according to any one of the preceding embodiments.

[0083] 22. The vector of any of the preceding embodiments, wherein the polynucleotide is operably linked to a promoter.

[0084] 23. The vector of any one of the preceding embodiments, wherein the promoter is a constitutive promoter, an inducible promoter, a ubiquitous promoter, a cell type-specific promoter, or a tissue-specific promoter.

[0085] 24. The vector of any one of the preceding embodiments, which is a plasmid.

[0086] 25. The vector of any one of the preceding embodiments, which is a retroviral vector, a phage vector, an adenoviral vector, a herpes simplex virus (HSV) vector, an adeno-associated virus (AAV) vector, or a lentiviral vector.

[0087] 26. The vector of any of the preceding embodiments, wherein the AAV vector is selected from recombinant AAV vectors of serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13.

[0088] 27. A delivery system comprising (1) a delivery medium; and (2) the Cas12i protein, polynucleotide or vector according to any one of the preceding embodiments.

[0089] 28. The delivery system of any one of the preceding embodiments, wherein the delivery vehicle is a nanoparticle, a liposome, an exosome, a microvesicle, or a gene gun.

[0090] 29. An engineered, non-naturally occurring CRISPR-Cas system comprising:

[0091] (1) the Cas12i protein or a polynucleotide encoding the Cas12i protein described in any of the aforementioned embodiments; and

[0092] (2) CRISPR RNA (crRNA) or a polynucleotide encoding the crRNA, wherein the crRNA comprises:

[0093] (i) a spacer sequence capable of hybridizing with a target sequence of a target DNA, and

[0094] (ii) a direct repeat (DR) sequence connected to the spacer sequence that can guide the Cas12i protein to bind to the crRNA to form a CRISPR-Cas complex targeting the target sequence.

[0095] The Cas12i protein can bind to the crRNA and target the target sequence, wherein the target sequence is single-stranded or double-stranded DNA or RNA.

[0096] 30. A CRISPR-Cas system comprising one or more vectors, wherein the one or more vectors comprise:

[0097] (1) a first regulatory element, which is operably linked to a nucleotide sequence encoding the Cas12i protein of any one of the preceding embodiments; and

[0098] (2) a second regulatory element, the second regulatory element being operably linked to a polynucleotide encoding a CRISPR RNA (crRNA), the crRNA comprising:

[0099] (i) a spacer sequence capable of hybridizing with a target sequence of a target DNA, and

[0100] (ii) a direct repeat (DR) sequence connected to the spacer sequence that can guide the Cas12i protein to bind to the crRNA to form a CRISPR-Cas complex targeting the target sequence;

[0101] Wherein the first regulatory element and the second regulatory element are located on the same or different vectors of the CRISPR-Cas vector system.

[0102] 31. An engineered, non-naturally occurring CRISPR-Cas complex comprising:

[0103] (1) the Cas12i protein described in any one of the preceding embodiments; and

[0104] (2) CRISPR RNA (crRNA), wherein the crRNA comprises:

[0105] (i) a spacer sequence capable of hybridizing with a target sequence of a target DNA, and

[0106] (ii) a direct repeat (DR) sequence connected to the spacer sequence; the DR sequence guides the Cas12i protein to bind to the crRNA.

[0107] 32. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the length of the spacer sequence is greater than 16 nucleotides, preferably 16 to 100 nucleotides, more preferably 16 to 50 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides), more preferably 16 to 27 nucleotides, more preferably 17 to 24 nucleotides, more preferably 18 to 24 nucleotides, and most preferably 18 to 22 nucleotides.

[0108] 33. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the DR sequence has a secondary structure substantially the same as the secondary structure of the DR sequence shown in any one of SEQ ID NOs: 21-30.

[0109] 34. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the DR sequence has nucleotide additions, insertions, deletions or substitutions that do not result in substantial differences in the secondary structure compared to the DR sequence shown in any one of SEQ ID NOs: 21-30.

[0110] 35. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the DR sequence comprises a stem-loop structure proximal to the 3' end of the DR sequence,

[0111] The stem-loop structure comprises 5'-X1X2X3X4X5NNNnNNNX6X7X8X9X 10 -3'(X1,X 2， X3, X4, X5, X6, X7, X8, X9, X 10 is any base, n is any nucleobase or missing, N is any nucleobase); wherein X1X2X3X4X5 and X6X7X8X9X 10 Can hybridize with each other.

[0112] 36. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the DR sequence comprises a stem-loop structure of any of the following:

[0113] 5′-CUCCCNNNNNNUGGGAG-3′ near the 3′ end of the DR sequence, where N is any nucleobase;

[0114] 5′-CUCCUNNNNNNUGGGAG-3′ near the 3′ end of the DR sequence, where N is any nucleobase;

[0115] 5′-GUCCCNNNNNNUGGGAC-3′ near the 3′ end of the DR sequence, where N is any nucleobase;

[0116] 5′-GUGUCNNNNNNUGACAC-3′ near the 3′ end of the DR sequence, where N is any nucleobase;

[0117] 5′-GUGCCNNNNNNUGGCAC-3′ near the 3′ end of the DR sequence, where N is any nucleobase;

[0118] 5'-UGUGUNNNNNNUCACAC-3' near the 3' end of the DR sequence, wherein N is any nucleobase; and

[0119] 5'-CCGUCNNNNNNUGACGG-3' near the 3' end of the DR sequence, wherein N is any nucleobase.

[0120] 5'-GUUUCNNNNNNUGAAAC-3' near the 3' end of the DR sequence, wherein N is any nucleobase.

[0121] 5'-GUGUUNNNNNNUAACAC-3' near the 3' end of the DR sequence, wherein N is any nucleobase.

[0122] 5'-UUGUCNNNNNNUGACAA-3' near the 3' end of the DR sequence, wherein N is any nucleobase.

[0123] 37. The CRISPR-Cas system or complex of any of the preceding embodiments, further comprising a target DNA capable of hybridizing to the spacer sequence.

[0124] 38. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the target DNA is eukaryotic DNA.

[0125] 39. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the target DNA is in a cell; preferably, the cell is selected from prokaryotic cells, eukaryotic cells, animal cells, plant cells, fungal cells, vertebrate cells, invertebrate cells, rodent cells, mammalian cells, primate cells, non-human primate cells, and human cells.

[0126] 40. The CRISPR-Cas system or complex of any one of the preceding embodiments, wherein the crRNA hybridizes with a target sequence of the target DNA and forms a complex, causing the Cas12i protein to cut the target sequence.

[0127] 41. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the target sequence is at the 3' end of the protospacer adjacent motif (PAM).

[0128] 42. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the PAM comprises a 5'-T rich motif.

[0129] 43. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the PAM is 5'-TTA, 5'-TTT, 5'-TTG, 5'-TTC, 5'-ATA or 5'-ATG.

[0130] 44. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the one or more vectors comprise one or more retroviral vectors, bacteriophage vectors, adenoviral vectors, herpes simplex virus (HSV) vectors, adeno-associated virus (AAV) vectors, or lentiviral vectors.

[0131] 45. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the AAV vector is selected from a recombinant AAV vector of serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13.

[0132] 46. ​​The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the regulatory element comprises a promoter.

[0133] 47. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the promoter is selected from a constitutive promoter, an inducible promoter, a ubiquitous promoter, a cell type-specific promoter, or a tissue-specific promoter.

[0134] 48. The CRISPR-Cas system or complex of any of the preceding embodiments, wherein the promoter is functional in a eukaryotic cell.

[0135] 49. The CRISPR-Cas system or complex of any of the foregoing embodiments, wherein the eukaryotic cells include animal cells, plant cells, fungal cells, vertebrate cells, invertebrate cells, rodent cells, mammalian cells, primate cells, non-human primate cells, and human cells.

[0136] 50. The CRISPR-Cas system or complex of any of the preceding embodiments, further comprising a DNA donor template, optionally wherein the DNA donor template is inserted into the locus of interest by homology directed repair (HDR).

[0137] 51. A cell or its progeny, comprising the Cas12i protein, polynucleotide, vector, delivery system, CRISPR-Cas system or complex described in any one of the aforementioned embodiments, preferably, the cell is selected from prokaryotic cells, eukaryotic cells, animal cells, plant cells, fungal cells, vertebrate cells, invertebrate cells, rodent cells, mammalian cells, primate cells, non-human primate cells and human cells.

[0138] 52. A non-human multicellular organism comprising the cell or its progeny described in any one of the preceding embodiments; preferably, the non-human multicellular organism is an animal (e.g., a rodent or non-human primate) model for human gene-related diseases.

[0139] 53. A method for modifying a target DNA, comprising contacting the target DNA with the CRISPR-Cas system or complex described in any one of the preceding embodiments, wherein the contact results in modification of the target DNA by the Cas12i protein.

[0140] 54. The method of any of the preceding embodiments, wherein the modification occurs in vitro outside the cell.

[0141] 55. The method of any of the preceding embodiments, wherein the modification occurs inside a cell in vitro.

[0142] 56. The method of any of the preceding embodiments, wherein the modification occurs in vivo inside a cell.

[0143] 57. The method of any of the preceding embodiments, wherein the cell is a eukaryotic cell.

[0144] 58. The method of any of the foregoing embodiments, wherein the eukaryotic cell is selected from animal cells, plant cells, fungal cells, vertebrate cells, invertebrate cells, rodent cells, mammalian cells, primate cells, non-human primate cells, and human cells.

[0145] 59. The method of any of the preceding embodiments, wherein the modification is cleavage of the target DNA.

[0146] Optionally, in a manner that cleaves single-stranded DNA, or optionally, in a manner that sequentially cleaves the same site or different sites of double-stranded DNA.

[0147] 60. The method of any one of the preceding embodiments, wherein the cleavage results in a deletion of a nucleotide sequence and / or an insertion of a nucleotide sequence.

[0148] 61. The method of any of the preceding embodiments, wherein the cutting comprises cutting the target nucleic acid at two sites, thereby resulting in a deletion or inversion of the sequence between the two sites.

[0149] 62. The method of any one of the preceding embodiments, wherein the modification is a base change, preferably an A→G or C→T base change.

[0150] 63. A cell or progeny thereof derived from the method of any one of the preceding embodiments, comprising said modification not present in a cell not subjected to said method.

[0151] 64. The cell or progeny thereof of any of the preceding embodiments, wherein the cell not subjected to the method comprises an abnormality and the abnormality in the cell from the method has been resolved or corrected.

[0152] 65. A cell product from the cell or progeny thereof of any of the preceding embodiments, wherein the product is modified in quality or quantity relative to a cell product from a cell not subjected to the method.

[0153] 66. The cell product of any of the preceding embodiments, wherein cells not subjected to the method comprise an abnormality and the cell product reflects that the abnormality has been resolved or corrected by the method.

[0154] 67. A method for non-specific cleavage of non-target DNA, the method comprising contacting the target DNA with the CRISPR-Cas system or complex described in any one of the preceding embodiments, whereby hybridization of the spacer sequence with the target sequence of the target DNA and cleavage of the target sequence by the Cas12i protein results in cleavage of the non-target DNA by the spacer sequence non-specific endonuclease lateral cleavage activity.

[0155] 68. A method for detecting a target DNA in a sample, the method comprising:

[0156] (1) contacting the sample with the CRISPR-Cas system or complex described in any one of the preceding embodiments and a reporter nucleic acid that releases a detectable signal after being cut, whereby hybridization of the spacer sequence with the target sequence of the target DNA and cutting of the target sequence by the Cas12i protein result in the Cas12i protein cutting the reporter nucleic acid by the non-specific nuclease activity of the spacer sequence; and

[0157] (2) Measuring a detectable signal generated by cleavage of the reporter nucleic acid, thereby detecting the presence of the target DNA in the sample.

[0158] 69. The method of any of the preceding embodiments, further comprising comparing the level of the detectable signal with a reference signal level, and determining the amount of the target DNA in the sample based on the level of the detectable signal.

[0159] 70. The method of any of the preceding embodiments, wherein the measuring is performed using gold nanoparticle detection, fluorescence polarization, colloidal phase transition / dispersion, electrochemical detection, or semiconductor-based sensing.

[0160] 71. The method of any one of the foregoing embodiments, wherein the reporter nucleic acid includes a fluorescent emission dye pair, a fluorescence resonance energy transfer (FRET) pair, or a quencher / fluorophore pair, and the cleavage of the reporter nucleic acid by the Cas12i protein causes an increase or decrease in the amount of the detectable signal produced by the cleavage of the reporter nucleic acid.

[0161] 72. A method of treating a condition or disease in a subject in need thereof, the method comprising administering to the subject the CRISPR-Cas system of any of the preceding embodiments.

[0162] 73. The method of any one of the preceding embodiments, wherein the condition or disease is cancer or an infectious disease or a neurological disease,

[0163] Optionally, the cancer is selected from the group consisting of:

[0164] Wilms' tumor, Ewing's sarcoma, neuroendocrine tumor, glioblastoma, neuroblastoma, melanoma, skin cancer, breast cancer, colon cancer, rectal cancer, prostate cancer, liver cancer, kidney cancer, pancreatic cancer, lung cancer, bile duct cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, medullary thyroid cancer, ovarian cancer, glioma, lymphoma, leukemia, myeloma, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, and urinary bladder cancer;

[0165] Optionally, the infectious disease is caused by:

[0166] human immunodeficiency virus (HIV), herpes simplex virus-1 (HSV1), and herpes simplex virus-2 (HSV2);

[0167] Optionally, the neurological disease is selected from the following:

[0168] Glaucoma, age-related RGC loss, optic nerve damage, retinal ischemia, Leber's hereditary optic neuropathy, neurological diseases associated with RGC neuronal degeneration, neurological diseases associated with functional neuronal degeneration in the striatum of a subject in need, Parkinson's disease, Alzheimer's disease, Huntington's disease, schizophrenia, depression, drug addiction, movement disorders such as chorea, choreoathetosis and dyskinesia, bipolar disorder, autism spectrum disorder (ASD), or functional impairment.

[0169] 74. The method of any of the preceding embodiments, wherein the disorder or disease is selected from the group consisting of cystic fibrosis, pseudohypertrophic muscular dystrophy, Becker muscular dystrophy, alpha-1-antitrypsin deficiency, Pompe disease, myotonic dystrophy, Huntington disease, fragile X syndrome, Friedreich's ataxia, amyotrophic lateral sclerosis, frontotemporal dementia, hereditary chronic kidney disease, hyperlipidemia, hypercholesterolemia, Leber's congenital amaurosis, sickle cell disease, and beta thalassemia.

[0170] 75. The method of any of the preceding embodiments, wherein the disorder or disease is a disease caused by a pathogenic point mutation.

[0171] 76. A kit comprising the CRISPR-Cas system of any one of the preceding embodiments; preferably the components of the system are in the same container or in separate containers.

[0172] 77. A sterile container comprising the CRISPR-Cas system of any one of the preceding embodiments; preferably, the sterile container is a syringe.

[0173] 78. An implantable device comprising the CRISPR-Cas system of any one of the preceding embodiments; preferably, the CRISPR-Cas system is stored in a reservoir.

[0174] General Definition

[0175] Unless otherwise specifically indicated, the practice of the present invention will employ conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology, cell biology, stem cell protocols, cell culture, and transgenic biology within the skill of the art, many of which are described below for illustrative purposes. Such techniques are fully described in the literature. See, for example, Sambrook, et al, Molecular Cloning: A Laboratory Manual (3 rdEdition,2001);Sambrook,et al.,Molecular Cloning:A Laboratory Manual(2 ndEdition,1989);Maniatis et al,Molecular Cloning:A Laboratory Manual(1982);Ausubel et al.,Current Protocols in Molecular Biology(John Wiley and Sons,updated July 2008);Short Protocols in Molecular Biology:A Compendium ofMethods from Current Protocols in Molecular Biology,Greene Pub.Associates andWiley-Interscience;Glover,DNA Cloning:A Practical Approach,vol.I&II(IRLPress,Oxford,1985);Anand,Techniques for the Analysis of Complex Genomes,(Academic Press,New York,1992);Guthrie and Fink,Guide to Yeast Genetics andMolecular Biology(Academic Press,New York,1991);Oligonucleotide Synthesis(N.Gait,Ed.,1984);Nucleic Acid Hybridization(B.Hames&S.Higgins,Eds.,1985);Transcription and Translation(B.Hames&S.Higgins,Eds.,1984);Animal CellCulture(R.Freshney,Ed.,1986);Perbal,A Practical Guide to Molecular Cloning(1984);Fire et al.,RNA Interference Technology:From Basic Science to DrugDevelopment(Cambridge University Press,Cambridge,2005);Schepers,RNAInterference in Practice(Wiley-VCH,2005);Engelke,RNA Interference(RNAi):TheNuts&Bolts of siRNA Technology(DNA Press,2003);Gott,RNA Interference,Editing,andModification:Methods and Protocols(Methods in Molecular Biology;HumanPress,Totowa,NJ,2004);Sohail,Gene Silencing by RNAInterference:Technology andApplication(CRC,2004);Clarke andSanseau,microRNA:Biology,Function&Expression(Nuts&Boltsseries;DNA Press,2006);Immobilized Cells And Enzymes(IRL Press,1986);the treatise,Methods In Enzymology(Academic Press,Inc.,N.Y.);GeneTransfer Vectors For Mammalian Cells(J.H.Miller andM.P.Calos eds.,1987,ColdSpring Harbor Laboratory);Harlow andLane,Antibodies,(Cold Spring HarborLaboratory Press,Cold SpringHarbor,N.Y.,1998);Immunochemical Methods In CellAnd MolecularBiology(Mayer and Walker,eds.,Academic Press,London,1987);Handbook Of Experimental Immunology,Volumes I-IV(D.M.Weirand C.Blackwell,eds.,1986);Riott,Essential Immunology,6th Edition,(Blackwell ScientificPublications,Oxford,1988);Embryonic StemCells:Methods and Protocols(Methodsin Molecular Biology)(Kurstad Turksen,Ed.,2002);Embryonic Stem CellProtocols:Volume I:Isolation and Characterization(Methods inMolecularBiology)(Kurstad Turksen,Ed.,2006);Embryonic Stem CellProtocols:Volume II:Differentiation Models(Methods in MolecularBiology)(KurstadTurksen,Ed.,2006);Human Embryonic Stem CellProtocols(Methods in MolecularBiology)(Kursad Turksen Ed.,2006);Mesenchymal Stem Cells:Methods andProtocols(Methods inMolecular Biology)(Darwin J.Prockop,Donald G.Phinney,andBruce A.Bunnell Eds.,2008);Hematopoietic Stem Cell Protocols(Methods inMolecular Medicine)(Christopher A.Klug,and Craig T.Jordan Eds.,2001);Hematopoietic Stem Cell Protocols(Methods in Molecular Biology)(KevinD.Bunting Ed.,2008)Neural Stem Cells:Methods and Protocols(Methods inMolecular Biology)(Leslie P.Weiner Ed., 2008); Hogan et ah, Methods ofManipulating the Mouse Embyro (2nd Edition, 1994); Nagy et al, Methods ofManipulating the Mouse Embryo (3. rd Edition, 2002), and The Zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio), 4th Ed., (Univ. of Oregon Press, Eugene, OR, 2000).

[0176] All publications, patents, and patent applications cited herein are incorporated by reference in their entirety.

[0177] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which the invention belongs. For the purpose of the present invention, the following terms are defined to be consistent with the meanings commonly understood in the art.

[0178] The articles "a / an" and "the" are used herein to refer to one or more than one (i.e., at least one) of the grammatical objects of the article. For example, "element" means one element or more than one element.

[0179] The use of alternatives (eg, "or") should be understood to mean either, both, or any combination of the alternatives.

[0180] The term "and / or" should be understood to mean either or both of the alternatives.

[0181] As used herein, the term "about" or "approximately" refers to a quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length that varies by up to 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% compared to a reference quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length. In one embodiment, the term "about" or "approximately" refers to a quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length range of ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% around a reference quantity, level, value, quantity, frequency, percentage, dimension, size, amount, weight, or length.

[0182] As used herein, the terms "substantially" or "essentially" refer to a degree, amount, level, value, quantity, frequency, percentage, dimension, size, amount, weight or length of about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more compared to a degree, reference amount, level, value, quantity, frequency, percentage, dimension, size, amount, weight or length.

[0183] A numerical range includes the endpoints of the range and each specific value in the range, for example, "between 16 and 100 nucleotides" includes 16 and 100, and every specific value between 16 and 100.

[0184] Throughout this specification, unless the context requires otherwise, the terms "comprise", "include", "contain" and "have" should be understood to imply the inclusion of the stated steps or elements or groups of steps or elements, but not the exclusion of any other steps or elements or groups of steps or elements. In specific embodiments, the terms "comprise", "include", "contain" and "have" are used synonymously.

[0185] “Consisting of means including but not limited to whatever follows the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and no other elements may be present.

[0186] "Consisting essentially of is meant to include any elements listed after the phrase "consisting essentially of" and is limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure of the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but no other elements are optional and may or may not be present depending on whether they affect the activity or action of the listed elements.

[0187] Throughout this specification, reference to "one embodiment," "an embodiment," "a particular embodiment," "a related embodiment," "an embodiment," "an additional embodiment," or "a further embodiment," or combinations thereof, means that a particular feature, structure, or characteristic described in conjunction with the embodiment is included in at least one embodiment of the invention. Thus, the appearances of the aforementioned phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0188] "Sequence identity" between two polypeptides or nucleic acid sequences means the percentage of the number of identical residues between the sequences to the total number of residues, and the calculation of the total number of residues is determined based on the mutation type. Mutation types include insertions (extensions) at either or both ends of the sequence, deletions (truncations) at either or both ends of the sequence, substitutions / alternations of one or more amino acids / nucleotides, insertions within the sequence, and deletions within the sequence. Taking polypeptides as an example (similar to nucleotides), if the mutation type is one or more of the following: substitutions / alternations of one or more amino acids / nucleotides, insertions within the sequence, and deletions within the sequence, the total number of residues is calculated as the larger of the molecules being compared. If the mutation type also includes insertions (extensions) at either or both ends of the sequence or deletions (truncations) at either or both ends of the sequence, the number of amino acids inserted or deleted at either or both ends (e.g., the number of insertions or deletions at both ends is less than 20) is not counted in the total number of residues. When calculating the percentage of identity, the sequences being compared are aligned in a manner that produces the maximum match between the sequences, and the gaps (if any) in the alignment are resolved by a specific algorithm.

[0189] Non-critical amino acids can be conservatively replaced without affecting the normal function of the protein. Conservative replacement means replacing an amino acid with an amino acid that is chemically or functionally similar. Providing conservative replacement tables for similar amino acids is well known in the art. For example, in some embodiments, the amino acid groups provided below are considered to be mutually conservative replacements.

[0190] In certain embodiments, a selected group of amino acids that are considered to be conservative substitutions for each other

[0191] Acidic residue D and E Basic residues K, R and H Hydrophilic uncharged residues S, T, N and Q Aliphatic uncharged residue G, A, V, L, and I Nonpolar uncharged residues C, M and P Aromatic residues F, Y and W

[0192] In certain embodiments, other selected groups of amino acids that are considered to be conservative substitutions for each other are

[0193]

[0194]

[0195] In certain embodiments, other selected groups of amino acids that are considered to be conservative substitutions for each other are

[0196] Group A A and G Group B D and E Group C N and Q Group D R, K and H Group E I, L, M, V Group F F, Y and W Group G S and T Group H C and M

[0197] The term "amino acid" means the twenty common naturally occurring amino acids. Naturally occurring amino acids include alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine ​​(Cys; C); glutamic acid (Glu; E), glutamine (Gln; Q), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y) and valine (Val; V).

[0198] Herein, the term "Cas12i protein" is taken in its broadest sense, including wild-type Cas12i protein, its derivatives or variants, and functional fragments thereof such as oligonucleotide binding fragments.

[0199] As used herein, the term "crRNA" is used interchangeably with guide molecule, gRNA, and guide RNA, and refers to nucleic acid-based molecules, including but not limited to RNA-based molecules (e.g., direct repeat sequences) that are capable of forming a complex with a CRISPR-Cas protein and comprising a sequence (e.g., a spacer sequence) that is sufficiently complementary to a target nucleic acid sequence to hybridize with the target nucleic acid sequence and guide sequence-specific binding of the complex to the target nucleic acid sequence.

[0200] Herein, the term "CRISPR array" refers to a nucleic acid (e.g., DNA) fragment comprising CRISPR repeats and spacer sequences, which starts from the first nucleotide of the first CRISPR repeat and ends with the last nucleotide of the last (terminal) CRISPR repeat. Typically, each spacer in the CRISPR array is located between two repeats. The terms "CRISPR repeats" or "CRISPR direct repeats" or "direct repeats" used herein refer to multiple short direct repeat sequences that show very little or no sequence variation in the CRISPR array. Suitably, type VI direct repeats can form a stem-loop structure.

[0201] "Stem-loop structure" refers to a nucleic acid with a secondary structure, wherein the secondary structure includes a nucleotide region known or predicted to form a double strand (stem portion), which is connected on one side by a region (loop portion) that is mainly single-stranded nucleotides. The terms "hairpin" and "fold-back" structures are also used to refer to stem-loop structures in this article. Such structures are well known in the art, and these terms are used consistently with their well-known meanings in the art. As known in the art, stem-loop structures do not require accurate base pairing. Therefore, the stem can include one or more base mispairings. Alternatively, base pairing can be accurate, i.e., does not include any mispairing.

[0202] Herein, target nucleic acid is used interchangeably with target sequence or target nucleic acid sequence, and refers to a specific nucleic acid comprising a nucleic acid sequence that is complementary to all or part of the spacer sequence in crRNA. In some instances, the target nucleic acid comprises a sequence within a gene or gene. In some instances, the target nucleic acid comprises a non-coding region (e.g., a promoter). In some instances, the target nucleic acid is single-stranded. In some instances, the target nucleic acid is double-stranded.

[0203] As used herein, "donor template nucleic acid" or "donor template" are used interchangeably and refer to a nucleic acid molecule that one or more cellular proteins can use to change the structure of a target nucleic acid after the CRISPR enzyme described herein has changed the target nucleic acid. In some instances, the donor template nucleic acid is a double-stranded nucleic acid. In some instances, the donor template nucleic acid is a single-stranded nucleic acid. In some instances, the donor template nucleic acid is linear. In some instances, the donor template nucleic acid is circular (e.g., a plasmid). In some instances, the donor template nucleic acid is an exogenous nucleic acid molecule. In some instances, the donor template nucleic acid is an endogenous nucleic acid molecule (e.g., a chromosome).

[0204] The target nucleic acid should be associated with PAM (protospacer adjacent motif). That is, a short sequence recognized by the CRISPR complex. Depending on the nature of the CRISPR-Cas protein, the target sequence should be selected so that its complementary sequence in the DNA duplex (the complementary sequence of the target sequence) is upstream or downstream of the PAM. In an embodiment of the present invention, the complementary sequence of the target sequence is downstream or 3' of the PAM. The precise sequence and length requirements of PAM vary depending on the Cas12i protein used.

[0205] As used herein, the term "cleavage" refers to a DNA break in a target nucleic acid produced by a nuclease of a CRISPR system as described herein. In some instances, the cleavage is a double-stranded DNA break. In some instances, the cleavage is a single-stranded DNA break.

[0206] Herein, the meanings of "cleaving a target nucleic acid" or "modifying a target nucleic acid" may overlap. Modifying a target nucleic acid includes not only modification of a single nucleotide, but also insertion or deletion of a nucleic acid fragment.

[0207] Parasitic activity

[0208] Cas12i protein may have incidental activity, that is, in certain environments, the activated Cas12i protein remains active after binding to the target sequence, and continues to non-specifically cut non-target oligonucleotides. This side-cutting activity can detect the presence of specific target oligonucleotides using the Cas12i system. In one embodiment, the Cas12i system is engineered to non-specifically cut ssDNA or transcripts. In certain embodiments, Cas12i is transiently or stably provided or expressed in an in vitro system or cell, and targeted or triggered to non-specifically cut cellular nucleic acids, such as ssDNA, such as viral ssDNA.

[0209] Parasite activity has recently been used in a highly sensitive and specific nucleic acid detection platform called SHERLOCK, which can be used in many clinical diagnostics (Gootenberg, JS et al., Nucleic acid detection with CRISPR-Cas13a / C2c2. Science 356, 438-442 (2017)).

[0210] Reporter nucleic acid

[0211] "Reporter nucleic acid" refers to a molecule that can be cut or otherwise deactivated by an activated CRISPR system protein as described herein. The reporter nucleic acid comprises a nucleic acid element that can be cut by a CRISPR protein. The cutting of the nucleic acid element releases an agent or produces a conformational change, thereby allowing a detectable signal to be generated. Before cutting, or when the reporter nucleic acid is in an "active" state, the reporter nucleic acid prevents the generation or detection of a positive detectable signal. It will be understood that in certain example embodiments, a minimal background signal can be generated in the presence of an active reporter nucleic acid. A positive detectable signal can be any signal that can be detected using optical, fluorescent, chemiluminescent, electrochemical or other detection methods known in the art. For example, in certain embodiments, when a reporter nucleic acid is present, a first signal (i.e., a negative detectable signal) can be detected, which is then converted to a second signal (e.g., a positive detectable signal) after the target molecule is detected and cut or deactivated by an activated CRISPR protein.

[0212] Herein, the Cas12i protein (dCas12i) substantially lacking endonuclease cleavage activity refers to retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or lower endonuclease cleavage activity compared to the wild-type enzyme. An example can be when the DNA cleavage activity of the mutant form is zero or negligible compared to the non-mutated form. In an example, the Cas12i protein is a catalytically inactive Cas12i protein, which includes mutations in the RuvC domain, allowing the formation of a CRISPR complex and successfully binding to the target nucleic acid without allowing successful nuclease activity (catalysis / cleavage activity).

[0213] Functional domain

[0214] Functional domain is taken in its broadest sense, including proteins such as enzymes or factors themselves or specific functional fragments (domains) thereof.

[0215] The Cas12i protein (e.g., dCas12i) is associated with one or more functional domains, which are selected from a deaminase (e.g., an adenosine deaminase or a cytidine deaminase) catalytic domain, a DNA methylation catalytic domain, a histone residue modification domain, a nuclease catalytic domain, a fluorescent protein, a transcriptional modifier, a light-gated factor, a chemically inducible factor, or a chromatin visualization factor; preferably, the functional domain is selected from an adenosine deaminase or a cytidine deaminase catalytic domain.

[0216] In some embodiments, the functional domain can be a transcriptional activation domain. In some embodiments, the functional domain is a transcriptional repression domain. In some embodiments, the functional domain is an epigenetic modification domain, so that an epigenetic modification enzyme is provided. In some embodiments, the functional domain is an activation domain. In some embodiments, the Cas12i protein is associated with one or more functional domains; and the Cas12i protein contains one or more mutations in the RuvC domain, and the CRISPR complex thus formed can deliver epigenetic modifiers or transcriptional or translational activation or repression signals.

[0217] The functional domain can be, for example, one or more domains from the group consisting of: methylase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, RNA cleavage activity, DNA cleavage activity, nucleic acid binding activity, and molecular switch (e.g., light inducible). When more than one functional domain is included, the functional domains can be the same or different.

[0218] Base editing

[0219] In certain example embodiments, Cas12i (e.g., dCas12i) can be fused to an adenosine deaminase or a cytidine deaminase for base editing purposes.

[0220] Adenosine deaminase

[0221] As used herein, the term "adenosine deaminase" or "adenosine deaminase protein" refers to a protein, a polypeptide, or one or more functional domains of a protein or polypeptide that is capable of catalyzing a hydrolytic deamination reaction that converts adenine (or the adenine portion of a molecule) to hypoxanthine (or the hypoxanthine portion of a molecule), as shown below. In some embodiments, the adenine-containing molecule is adenosine (A), and the hypoxanthine-containing molecule is inosine (I). The adenine-containing molecule can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).

[0222] According to the present disclosure, adenosine deaminases that can be used in conjunction with the present disclosure include, but are not limited to, enzyme family members (ADARs) called adenosine deaminases acting on RNA, enzyme family members (ADATs) called adenosine deaminases acting on tRNA, and other family members containing adenosine deaminase domains (ADADs). According to the present disclosure, adenosine deaminase can target adenine in RNA / DNA and RNA duplexes. In fact, Zheng et al., (Nucleic Acids Res. 2017, 45 (6): 3369-3377) confirmed that ADAR can edit adenosine to inosine in RNA / DNA and RNA / RNA duplexes. In a specific embodiment, adenosine deaminase has been modified to increase its ability to edit DNA in RNA / DNA heteroduplexes of RNA duplexes, as described in detail below.

[0223] In some embodiments, the adenosine deaminase is derived from one or more metazoan species, including but not limited to mammals, birds, frogs, squid, fish, flies, and worms. In some embodiments, the adenosine deaminase is human, squid, or fruit fly adenosine deaminase.

[0224] In some embodiments, the adenosine deaminase is a human ADAR, including hADAR1, hADAR2, and hADAR3. In some embodiments, the adenosine deaminase is a Caenorhabditis elegans ADAR protein, including ADR-1 and ADR-2. In some embodiments, the adenosine deaminase is a Drosophila ADAR protein, including dAdar. In some embodiments, the adenosine deaminase is a squid (Loligo pealeii) ADAR protein, including sqADAR2a and sqADAR2b. In some embodiments, the adenosine deaminase is a human ADAT protein. In some embodiments, the adenosine deaminase is a Drosophila ADAT protein. In some embodiments, the adenosine deaminase is a human ADAD protein, including TENR (hADAD1) and TENRL (hADAD2).

[0225] In some embodiments, the adenosine deaminase is a TadA protein, such as E. coli TadA. See Kim et al., Biochemistry 45:6407-6416 (2006); Wolf et al., EMBO J. 21:3841-3851 (2002). In some embodiments, the adenosine deaminase is mouse ADA. See Grunebaum et al., Curr. Opin. Allergy Clin. Immunol. 13:630-638 (2013). In some embodiments, the adenosine deaminase is human ADAT2. See Fukui et al., J. Nucleic Acids 2010:260512 (2010). In some embodiments, the deaminase (e.g., an adenosine or cytidine deaminase) is one or more of those described in Cox et al., Science. 2017 Nov 24;358(6366):1019-1027; Komore et al., Nature. 2016 May 19;533(7603):420-4; and Gaudelli et al., Nature. 2017 Nov 23;551(7681):464-471.

[0226] In some embodiments, the adenosine deaminase protein recognizes one or more target adenosine residues in a double-stranded nucleic acid substrate and converts them into inosine residues. In some embodiments, the double-stranded nucleic acid substrate is an RNA-DNA hybrid duplex. In some embodiments, the adenosine deaminase protein recognizes a binding window on a double-stranded substrate. In some embodiments, the binding window comprises at least one target adenosine residue. In some embodiments, the binding window is in the range of about 3bp to about 100bp. In some embodiments, the binding window is in the range of about 5bp to about 50bp. In some embodiments, the binding window is in the range of about 10bp to about 30bp. In some embodiments, the binding window is about 1bp, 2bp, 3bp, 5bp, 7bp, 10bp, 15bp, 20bp, 25bp, 30bp, 40bp, 45bp, 50bp, 55bp, 60bp, 65bp, 70bp, 75bp, 80bp, 85bp, 90bp, 95bp or 100bp.

[0227] In some embodiments, the adenosine deaminase protein comprises one or more deaminase domains. Without wishing to be bound by a particular theory, it is expected that the deaminase domain is used to recognize one or more target adenosine (A) residues contained in a double-stranded nucleic acid substrate and convert them into inosine (I) residues. In some embodiments, the deaminase domain comprises an active center. In some embodiments, the active center comprises a zinc ion. In some embodiments, during the AI ​​editing process, the base pairing at the target adenosine residue is destroyed, and the target adenosine residue is "flipped" out of the double helix to become accessible to the adenosine deaminase. In some embodiments, the amino acid residues in or near the active center interact with one or more nucleotides of the 5' of the target adenosine residue. In some embodiments, the amino acid residues in or near the active center interact with one or more nucleotides of the 3' of the target adenosine residue. In some embodiments, the amino acid residues in or near the active center further interact with nucleotides complementary to the target adenosine residue on the opposite chain. In some embodiments, the amino acid residues form hydrogen bonds with the 2' hydroxyl of the nucleotide.

[0228] In some embodiments, the adenosine deaminase comprises a human ADAR2 full protein (hADAR2) or a deaminase domain thereof (hADAR2-D). In some embodiments, the adenosine deaminase is an ADAR family member homologous to hADAR2 or hADAR2-D.

[0229] In particular, in some embodiments, the homologous ADAR protein is human ADAR1 (hADAR1) or its deaminase domain (hADAR1-D). In some embodiments, glycine 1007 of hADAR1-D corresponds to glycine 487 hADAR2-D, and glutamate 1008 of hADAR1-D corresponds to glutamate 488 of hADAR2-D.

[0230] In some embodiments, the adenosine deaminase comprises the wild-type amino acid sequence of hADAR2-D. In some embodiments, the adenosine deaminase comprises one or more mutations in the hADAR2-D sequence, such that the editing efficiency and / or substrate editing preference of hADAR2-D is changed according to specific needs.

[0231] Cytidine deaminase

[0232] In some embodiments, the deaminase is a cytidine deaminase. As used herein, the term "cytidine deaminase" or "cytidine deaminase protein" refers to a protein, a polypeptide, or one or more functional domains of a protein or polypeptide that can catalyze the hydrolytic deamination reaction of cytosine (or the cytosine portion of a molecule) into uracil (or the uracil portion of a molecule), as shown below. In some embodiments, the molecule containing cytosine is cytidine (C), and the molecule containing uracil is uridine (U). The molecule containing cytosine can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).

[0233] According to the present disclosure, cytidine deaminases that can be used in conjunction with the present disclosure include, but are not limited to, members of the enzyme family known as apolipoprotein B mRNA editing complex (APOBEC) family deaminases, activation-induced deaminases (AID), or cytidine deaminase 1 (CDA1). In specific embodiments, the deaminase is APOBEC1 deaminase, APOBEC2 deaminase, APOBEC3A deaminase, APOBEC3B deaminase, APOBEC3C deaminase, and APOBEC3D deaminase, APOBEC3E deaminase, APOBEC3F deaminase, APOBEC3G deaminase, APOBEC3H deaminase, or APOBEC4 deaminase.

[0234] In the methods and systems of the present invention, cytidine deaminase can target cytosine in a single strand of DNA. In certain example embodiments, cytidine deaminase can be edited on a single strand present outside a binding component, such as in conjunction with Cas13. In other example embodiments, cytidine deaminase can be edited in a localized bubble, such as a localized bubble formed by a target editing site but a guide sequence mismatch. In certain example embodiments, cytidine deaminase may include mutations that contribute to focused activity, such as those described in Kim et al., Nature Biotechnology (2017) 35 (4): 371-377 (doi: 10.1038 / nbt.3803.

[0235] In some embodiments, the cytidine deaminase is derived from one or more metazoan species, including but not limited to mammals, birds, frogs, squids, fish, flies, and worms. In some embodiments, the cytidine deaminase is a human, primate, cow, dog, rat, or mouse cytidine deaminase.

[0236] In some embodiments, the cytidine deaminase is human APOBEC, including hAPOBEC1 or hAPOBEC3. In some embodiments, the cytidine deaminase is human AID.

[0237] In some embodiments, the cytidine deaminase protein recognizes one or more target cytosine residues in the single-stranded bubble of the RNA duplex and converts them into uracil residues. In some embodiments, the cytidine deaminase protein recognizes the binding window on the single-stranded bubble of the RNA duplex. In some embodiments, the binding window comprises at least one target cytosine residue. In some embodiments, the binding window is in the range of about 3bp to about 100bp. In some embodiments, the binding window is in the range of about 5bp to about 50bp. In some embodiments, the binding window is in the range of about 10bp to about 30bp. In some embodiments, the binding window is about 1bp, 2bp, 3bp, 5bp, 7bp, 10bp, 15bp, 20bp, 25bp, 30bp, 40bp, 45bp, 50bp, 55bp, 60bp, 65bp, 70bp, 75bp, 80bp, 85bp, 90bp, 95bp or 100bp.

[0238] In some embodiments, the cytidine deaminase protein comprises one or more deaminase domains. Without wishing to be bound by theory, it is contemplated that the deaminase domain is used to recognize one or more target cytosine (C) residues contained in the single-stranded bubble of the RNA duplex and convert it into uracil (U) residues. In some embodiments, the deaminase domain comprises an active center. In some embodiments, the active center comprises a zinc ion. In some embodiments, the amino acid residues in or near the active center interact with one or more nucleotides at 5' of the target cytosine residue. In some embodiments, the amino acid residues in or near the active center interact with one or more nucleotides at 3' of the target cytosine residue.

[0239] In some embodiments, the cytidine deaminase comprises a human APOBEC1 full protein (hAPOBEC1) or a deaminase domain thereof (hAPOBEC1-D) or a C-terminal truncated form thereof (hAPOBEC-T). In some embodiments, the cytidine deaminase is an APOBEC family member homologous to hAPOBEC1, hAPOBEC-D or hAPOBEC-T. In some embodiments, the cytidine deaminase comprises a human AID1 full protein (hAID) or a deaminase domain thereof (hAID-D) or a C-terminal truncated form thereof (hAID-T). In some embodiments, the cytidine deaminase is an AID family member homologous to hAID, hAID-D or hAID-T. In some embodiments, hAID-T is a hAID with a C-terminal truncation of about 20 amino acids.

[0240] In some embodiments, the cytidine deaminase comprises a wild-type amino acid sequence of a cytidine deaminase. In some embodiments, the cytidine deaminase comprises one or more mutations in the cytidine deaminase sequence such that the editing efficiency and / or substrate editing preference of the cytidine deaminase is changed according to specific needs.

[0241] Herein, "association" is taken in its broadest sense, covering the situation where two functional modules directly or indirectly (through a linker) form a fusion protein, and also covering the situation where two functional modules are independent and bonded together by covalent bonds (such as disulfide bonds, etc.) or non-covalent bonds.

[0242] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. It is a replicon, such as a plasmid, phage or cosmid, into which another DNA segment can be inserted to achieve replication of the inserted segment. Typically, a vector is capable of replication when combined with appropriate control elements.

[0243] In some cases, the vector system comprises a single vector. Alternatively, the vector system comprises multiple vectors. The vector can be a viral vector.

[0244] Vectors include, but are not limited to, single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules comprising one or more free ends, no free ends (e.g., circular); nucleic acid molecules comprising DNA, RNA or both; and other polynucleotide variants known in the art. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop, in which other DNA segments can be inserted, for example, by standard molecular cloning techniques. Another type of vector is a viral vector, in which there is a DNA or RNA sequence of viral origin in the vector for packaging into a virus (e.g., a retrovirus, a replication-defective retrovirus, an adenovirus, a replication-defective adenovirus, and an adeno-associated virus). Viral vectors also include polynucleotides carried by viruses for transfection into host cells. Certain vectors are capable of autonomous replication in host cells into which they are introduced (e.g., bacterial vectors and free mammalian vectors with a bacterial origin of replication). After being introduced into the host cell, other vectors (e.g., non-free mammalian vectors) are integrated into the genome of the host cell, thereby replicating together with the host genome. In addition, certain vectors are capable of directing the expression of genes operably connected thereto. Such vectors are referred to herein as "expression vectors". Vectors expressed in eukaryotic cells and vectors that cause expression in eukaryotic cells may be referred to herein as "eukaryotic expression vectors." Common expression vectors useful in recombinant DNA techniques are often in the form of plasmids.

[0245] The recombinant expression vector can be suitable for the form of expressing nucleic acid in host cells to include the nucleic acid of the present invention, which means that the recombinant expression vector includes one or more regulatory elements, which can be selected according to the host cell to be used for expression, and the nucleic acid is operably connected to the nucleic acid sequence to be expressed. In the recombinant expression vector, "operably connected" is intended to refer to the target nucleotide sequence to be connected to the regulatory element in a manner that allows the nucleotide sequence to be expressed (for example, in an in vitro transcription / translation system or in a host cell when the vector is introduced into a host cell). Advantageous vectors include slow viruses and adeno-associated viruses, and the types of these vectors can also be selected to target specific types of cells.

[0246] The term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES) and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described in, for example, Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of nucleotide sequences in many types of host cells and those that direct expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can direct expression mainly in target desired tissues such as muscle, neuron, bone, skin, blood, specific organs (e.g., liver, pancreas) or specific cell types (e.g., lymphocytes). Regulatory elements can also direct expression in a time-dependent manner, such as in a cell cycle-dependent or developmental stage-dependent manner, which may or may not be tissue or cell type specific.

[0247] In some embodiments, the vector encodes a Cas12i protein, and the Cas12i protein includes one or more nuclear localization sequences (NLS), such as about or greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS. More particularly, the vector includes one or more NLSs that are not naturally present in the Cas12i protein. Most particularly, the NLS is present in the vector 5' and / or 3' of the Cas12i protein sequence. In some embodiments, the protein of the targeting RNA comprises about or greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the amino terminus, and comprises about or greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLSs at or near the carboxyl terminus, or a combination of these (e.g., 0 or at least one or more NLSs at the amino terminus and 0 or one or more NLSs at the carboxyl terminus). When more than one NLS is present, each may be selected independently of the other, such that a single NLS may be present in more than one copy and / or in combination with one or more other NLSs in one or more copies. In some embodiments, an NLS is considered to be near the N-terminus or C-terminus when the closest amino acid of the NLS is within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or more amino acids along the polypeptide chain from the N-terminus or C-terminus.

[0248] "Codon optimization" refers to a method of modifying a nucleic acid sequence in a target host cell to enhance expression by replacing at least one codon (e.g., about or greater than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) of a native sequence with a more frequent or most frequently used codon in the genes of the host cell while maintaining the native amino acid sequence. Various species exhibit specific biases for certain codons of specific amino acids. Codon bias (differences in codon usage between organisms) is generally associated with the translation efficiency of messenger RNA (mRNA), which in turn is believed to depend, inter alia, on the properties of the codons translated and the availability of specific transfer RNA (tRNA) molecules. The predominance of the selected tRNA in the cell generally reflects the most frequently used codons in peptide synthesis. Therefore, genes can be customized based on codon optimization for optimal gene expression in a given organism. Codon usage tables are readily available, for example, in the "Codon Usage Database" at www.kazusa.orjp / codon / , and these tables can be modified in a variety of ways. See Nakamura, Y. et al., "Codon usage tabulated from the international DNA Sequence databases: status for the year 2000" Nucl. Acids Res. 28: 292 (2000). Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, such as Gene Forge (Aptagen; Jacobus, PA). In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more or all codons) in the sequence encoding the Cas protein targeting DNA / RNA correspond to the most commonly used codons for a specific amino acid. For codon usage in yeast, reference is made to the online yeast genome database available at www.yeastgenome.org / community / codon_usage.shtml, or Codon selection in yeast, Bennetzen and Hall, J Biol Chem. 1982 Mar 25; 257(6): 3026-31.For codon usage in plants including algae, see Codon usage in higher plants, green algae, and cyanobacteria, Campbell and Gowri, Plant Physiol. 1990 Jan;92(1):1-11.; and Codon usage in plant genes, Murray et al., Nucleic Acids Res. 1989 Jan 25;17(2):477-98; or Selection on the codon bias of chloroplast and cyanelle genes in different plant and algallineages, Morton BR, J Mol Evol. 1998 Apr;46(4):449-59.

[0249] Delivery System

[0250] In some embodiments, the components of the CRISPR-Cas system can be delivered in various forms, such as a combination of DNA / RNA or RNA / RNA or protein RNA. For example, the Cas12i protein can be delivered as a polynucleotide encoding DNA or a polynucleotide encoding RNA or as a protein. The guide can be delivered as a DNA encoding polynucleotide or RNA. All possible combinations are envisioned, including mixed delivery forms.

[0251] In some aspects, the invention provides methods comprising delivering one or more polynucleotides, such as one or more vectors as described herein, one or more transcripts thereof, and / or one or more proteins transcribed therefrom, to a host cell.

[0252] In some embodiments, one or more vectors that drive the expression of one or more elements of the nucleic acid targeting system are introduced into a host cell so that the expression of the elements of the nucleic acid targeting system directs the formation of a nucleic acid targeting complex at one or more target sites. For example, a nucleic acid targeting effector enzyme and a nucleic acid targeting guide RNA can each be operably linked to separate regulatory elements on separate vectors. The RNA of the nucleic acid targeting system can be delivered to a transgenic nucleic acid targeting effector protein animal or mammal, for example, an animal or mammal that constitutively or inducibly or conditionally expresses the nucleic acid targeting effector protein; or an animal or mammal that otherwise expresses the nucleic acid targeting effector protein or has cells containing the nucleic acid targeting effector protein, for example, by previously administering thereto one or more vectors encoding and expressing the nucleic acid targeting effector protein in vivo. Alternatively, two or more elements expressed by the same or different regulatory elements can be combined in a single vector, and one or more additional vectors provide any components of the nucleic acid targeting system not contained in the first vector. The nucleic acid targeting system elements combined in a single vector can be arranged in any suitable direction, for example, one element is located 5' ("upstream") relative to the second element or 3' ("downstream") relative to the second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of the second element and oriented in the same or opposite direction. In some embodiments, a single promoter drives the expression of transcripts encoding nucleic acid targeting effector proteins and nucleic acid targeting guide RNAs, and the transcripts are embedded in one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, nucleic acid targeting effector proteins and nucleic acid targeting guide RNAs can be operably linked to and expressed from the same promoter. Delivery vehicles, vectors, particles, nanoparticles, formulations, and components thereof for expressing one or more elements of a nucleic acid targeting system are used as described in the aforementioned documents, such as WO 2014 / 093622 (PCT / US2013 / 074667). In some embodiments, the vector comprises one or more insertion sites, such as restriction endonuclease recognition sequences (also referred to as "cloning sites"). In some embodiments, one or more insertion sites (e.g., about or greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more insertion sites) are located upstream and / or downstream of one or more sequence elements of one or more vectors. When multiple different guide sequences are used, a single expression construct can be used to target the nucleic acid targeting activity to multiple different corresponding target sequences within a cell. For example, a single vector can contain about or greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more guide sequences. In some embodiments, about or greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more such guide sequence-containing vectors can be provided and optionally delivered to a cell.In some embodiments, the vector comprises a regulatory element operably linked to an enzyme coding sequence encoding a nucleic acid targeting effector protein. The nucleic acid targeting effector protein or one or more nucleic acid targeting guide RNAs may be delivered separately; and advantageously, at least one of these is delivered via a particle complex. The nucleic acid targeting effector protein mRNA may be delivered before the nucleic acid targeting guide RNA to allow time for the expression of the nucleic acid targeting effector protein. The nucleic acid targeting effector protein mRNA may be administered 1-12 hours (preferably about 2-6 hours) before the administration of the nucleic acid targeting guide RNA. Alternatively, the nucleic acid targeting effector protein mRNA and the nucleic acid targeting guide RNA may be administered together. Advantageously, a second booster dose of the guide RNA may be administered 1-12 hours (preferably about 2-6 hours) after the initial administration of the nucleic acid targeting effector protein mRNA + guide RNA. Other administrations of nucleic acid targeting effector protein mRNA and / or guide RNA may be useful for achieving the most effective level of genome modification.

[0253] Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids into mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding nucleic acid targeting system components to cells in culture or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (transcripts of vectors such as those described herein), naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes. Viral vector delivery systems include DNA and RNA viruses that have free or integrated genomes after delivery to cells. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel and Felgner, TIBTECH 11:211-217 (1993); Mitani and Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer and Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., Current Topics in Molecular Biology, 25(4):114-115 (1996); Microbiology andImmunology,Doerfler and (eds.) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0254] Non-viral delivery methods for nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations or lipid: nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced DNA uptake. Lipofection is described in, for example, U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355 and lipofection reagents are sold commercially (e.g., Transfectam TM Lipofectin TM ). Cationic lipids and neutral lipids suitable for efficient receptor recognition lipid transfection of polynucleotides include those of Felgner, WO 91 / 17424; WO 91 / 16024. Delivery to cells (eg, in vitro or ex vivo administration) or target tissues (eg, in vivo administration).

[0255] Plasmid delivery involves cloning the guide RNA into a plasmid expressing the CRISPR-Cas protein and transfecting the DNA in cell culture. Plasmid backbones are commercially available and do not require specific equipment. They have the advantage of modularity, being able to carry CRISPR-Cas coding sequences of different sizes (including sequences encoding larger-sized proteins) and selection markers. At the same time, the advantage of plasmids is that they ensure instantaneous but sustained expression. However, the delivery of plasmids is not direct, making the in vivo efficiency generally low. Sustained expression may also be disadvantageous because it can increase off-target editing. In addition, excessive accumulation of CRISPR-Cas proteins may be toxic to cells. Finally, plasmids always have the risk of random integration of dsDNA in the host genome, more particularly considering the risk of producing double-strand breaks (on-target and off-target).

[0256] Preparation of lipid:nucleic acid complexes (including targeted liposomes, such as immunolipid complexes) is well known to those skilled in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad ... Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787). This will be discussed in more detail below.

[0257] The use of RNA or DNA virus-based systems to deliver nucleic acids utilizes a highly evolved process of targeting specific cells in the virus body and transporting the viral payload to the nucleus. Viral vectors can be directly applied to patients (in vivo), or they can be used for in vitro therapeutic cells, and modified cells can be optionally applied to patients (ex vivo). Conventional viral-based systems can include retrovirus, slow virus, adenovirus, adeno-associated virus and herpes simplex virus vectors for gene transfer. Retrovirus, slow virus and adeno-associated virus gene transfer methods can be integrated into the host genome, which usually results in the long-term expression of the inserted transgene. In addition, high transduction efficiency has been observed in many different cell types and target tissues.

[0258] The tropism of retroviruses can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Therefore, the choice of retroviral gene transfer system will depend on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats with the ability to package up to 6-10 kb of foreign sequence. The minimal cis-acting LTRs are sufficient for replication and packaging of the vector, which is then used to integrate the therapeutic gene into the target cells to provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700).

[0259] In the application of preferred transient expression, adenovirus-based systems can be used. Adenovirus-based vectors can achieve very high transduction efficiency in many cell types and do not require cell division. Using such vectors, high titer and expression level have been obtained. The vector can be produced in large quantities in a relatively simple system. Adeno-associated virus ("AAV") vectors can also be used to transduce cells with target nucleic acids, for example, in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, for example, West et al., Virology 160: 38-47 (1987); U.S. Patent No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5: 793-801 (1994); Muzyczka, J. Clin. Invest. 94: 1351 (1994)). The construction of recombinant AAV vectors is described in many publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat and Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).

[0260] The present invention provides an AAV comprising or consisting essentially of an exogenous nucleic acid molecule encoding a CRISPR system, for example, a plurality of cassettes comprising or consisting of a first cassette, the first cassette comprising or consisting essentially of a promoter, a nucleic acid molecule encoding a CRISPR-associated (Cas) protein (a putative nuclease or helicase protein), for example, Cas12i, and a terminator, and one or more, advantageously up to the packaging size limit of the vector, for example, a total of five cassettes (including the first cassette), the cassette comprising or consisting essentially of a promoter, a nucleic acid molecule encoding a guide RNA (gRNA), and a terminator (for example, each cassette is schematically represented as promoter-gRNA1-terminator, promoter-gRNA2-terminator...promoter-gRNA(N)-terminator, which N is the number of the upper limit of the packaging size limit of the vector that can be inserted), or two or more separate rAAVs, each rAAV containing one or more boxes of the CRISPR system, for example, a first rAAV containing a first box, the first box comprising or consisting essentially of: a promoter, a nucleic acid molecule encoding Cas, such as Cas (Cas12i) and a terminator, and a second rAAV containing one or more boxes, each box comprising or consisting essentially of: a promoter, a nucleic acid molecule encoding a guide RNA (gRNA) and a terminator (for example, each box is schematically represented as promoter-gRNA1-terminator, promoter-gRNA2-terminator...promoter-gRNA (N)-terminator, where N is the number of the upper limit of the packaging size limit of the vector that can be inserted). Alternatively, since Cas12i can process its own crRNA / gRNA, a single crRNA / gRNA array can be used for multiple gene editing. Thus, instead of comprising multiple boxes to deliver gRNA, rAAV may contain a single box comprising or consisting essentially of: a promoter, multiple crRNA / gRNAs, and a terminator (e.g., schematically represented as promoter-gRNA1-gRNA2 ... gRNA (N)-terminator, where N is the number of the upper limit of the packaging size limit of the vector that can be inserted). See Zetsche et al., Nature Biotechnology 35, 31-34 (2017), which is incorporated herein by reference in its entirety. Since rAAV is a DNA virus, the nucleic acid molecules discussed herein about AAV or rAAV are advantageously DNA. In some embodiments, the promoter is advantageously a human synaptic protein I promoter (hSyn). Other methods for delivering nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, which is incorporated herein by reference.

[0261] In another embodiment, Cocal vesiculovirus envelope pseudotyped retroviral vector particles are contemplated (see, e.g., U.S. Patent Publication No. 20120164118 assigned to Fred Hutchinson Cancer Research Center). Cocal virus belongs to the genus Vesiculovirus and is the pathogen of vesicular stomatitis in mammals. Cocal virus was originally isolated from mites in Trinidad (Jonkers et al., Am. J. Vet. Res. 25: 236-242 (1964)), and infections have been identified in Trinidad, Brazil and Argentina from insects, cattle and horses. Many vesiculoviruses that infect mammals have been isolated from naturally infected arthropods, indicating that they are vector-borne. In rural areas where endemic and laboratory-acquired viruses are present, people generally acquire antibodies to vesiculoviruses; human infection typically results in flu-like symptoms. The Cocal virus envelope glycoprotein shares 71.5% identity with VSV-G Indiana at the amino acid level, and phylogenetic comparison of the vesiculovirus envelope genes shows that Cocal virus is serologically distinct from, but most closely related to, the VSV-G Indiana strain of vesiculovirus. Jonkers et al., Am. J. Vet. Res. 25:236-242 (1964) and Travassos da Rosa et al., Am. J. Tropical Med. & Hygiene 33:999-1006 (1984). Cocal vesiculovirus envelope pseudotyped retroviral vector particles may include, for example, lentiviral, alpha retroviral, beta retroviral, gamma retroviral, delta retroviral, and epsilon retroviral vector particles, which may contain retroviral Gag, Pol, and / or one or more accessory proteins and Cocal vesiculovirus envelope proteins. In certain aspects of these embodiments, Gag, Pol, and accessory proteins are lentiviral and / or gamma retroviral.

[0262] In some embodiments, host cells are transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, cells are transfected when they are naturally present in a subject, and optionally reintroduced therein. In some embodiments, the transfected cells are taken from a subject. In some embodiments, the cells are derived from cells taken from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLa-S3, Huh1, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panc1, PC-3, TF1, CTLL-2, C1R, Rat6, CV1, RPTE, A10, T24, J82, A375, ARH-77, Calu1, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelium, BALB / 3T3 mouse embryonic fibroblasts, 3T3 Swiss, 3T3-L1, 132-d5 human fetal fibroblasts; 10.1 mouse fibroblasts, 293-T, 3T3, 721, 9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431, A-549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21, BR 293, BxPC3, C3H-10T1 / 2, C6 / 36, Cal-27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CHO Dhfr- / -, COR-L23, COR-L23 / CPR, COR-L23 / 5010, COR-L23 / R23, COS-7, COV-434, CML T1, CMT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3, EMT6 / AR1, EMT6 / AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa, Hepa1c1c7, HL-60, HMEC, HT-29, Jurkat, JY cells, K562 cells, Ku812, KCL22, KG1, KYO1, LNCap, Ma-Mel 1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435, MDCK II, MDCK II, MOR / 0.2R, MONO-MAC 6, MTD-1A, MyEnd, NCI-H69 / CPR, NCI-H69 / LX10, NCI-H69 / LX20, NCI-H69 / LX4, NIH-3T3, NALM-1, NW-145, OPCN / OPCT cell lines, Peer, PNT-1A / PNT 2, RenCa, RIN-5F, RMA / RMAS, Saos-2 cells, Sf-9, SkBr3, T2, T-47D, T84, THP1 cell lines, U373, U87, U937, VCaP, Vero cells, WM39, WT-49, X63, YAC-1, YAR and transgenic varieties thereof. Cell lines can be obtained from a variety of sources known to those skilled in the art (see, for example, the American Type Culture Collection (ATCC) (Manassus, Va.)). .

[0263] In a specific embodiment, the transient expression and / or presence of one or more components of the AD-functionalized CRISPR system can be of interest, for example, to reduce off-target effects. In some embodiments, cells transfected with one or more vectors described herein are used to establish new cell lines comprising one or more vector-derived sequences. In some embodiments, cells transiently transfected with components of the AD-functionalized CRISPR system as described herein (e.g., by transient transfection of one or more vectors, or transfected with RNA) and modified by the activity of the CRISPR complex are used to establish new cell lines comprising cells containing modifications but lacking any other exogenous sequences. In some embodiments, cells transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells, are used to evaluate one or more test compounds.

[0264] In some embodiments, it is contemplated that RNA and / or protein may be introduced directly into a host cell. For example, a CRISPR-Cas protein may be delivered as an encoding mRNA together with an in vitro transcribed guide RNA. Such methods may reduce the time required to ensure that the CRISPR-Cas protein is active and further prevent long-term expression of CRISPR system components.

[0265] In some embodiments, the RNA molecules of the present invention are delivered in the form of liposomes or lipofectin formulations, and can be prepared by methods well known to those skilled in the art. Such methods are described in, for example, U.S. Patents Nos. 5,593,972, 5,589,466, and 5,580,859, which are incorporated herein by reference. Delivery systems specifically directed to enhancing and improving the delivery of siRNA into mammalian cells have been developed (see, e.g., Shen et al., FEBS Let. 2003, 539: 111-114; Xia et al., Nat. Biotech. 2002, 20: 1006-1010; Reich et al., Mol. Vision. 2003, 9: 210-216; Sorensen et al., J. Mol. Biol. 2003, 327: 761-766; Lewis et al., Nat. Gen. 2002, 32: 107-108; and Simeoni et al., NAR 2003, 31, 11: 2717-2724), and can be applied to the present invention. siRNA has recently been successfully used to inhibit gene expression in primates (see, e.g., Tolentino et al., Retina 24(4): 660), which can also be applied to the present invention.

[0266] In fact, RNA delivery is a useful method for in vivo delivery. Cas12i, adenosine deaminase and guide RNA can be delivered to cells using liposomes or particles. Therefore, the delivery of CRISPR-Cas proteins (such as Cas12i), the delivery of adenosine deaminase (which can be fused with CRISPR-Cas proteins or adapter proteins) and / or the delivery of the RNA of the present invention can be in RNA form and via microvesicles, liposomes or particles or nanoparticles. For example, Cas12i mRNA, adenosine deaminase mRNA and guide RNA can be packaged into liposome particles for in vivo delivery. Liposome transfection reagents, such as lipofectamine from Life Technologies and other reagents on the market, can effectively deliver RNA molecules to the liver.

[0267] The delivery method of RNA also preferably includes delivery of RNA via particles (Cho, S., Goldberg, M., Son, S., Xu, Q., Yang, F., Mei, Y., Bogatyrev, S., Langer, R. and Anderson, D., Lipid-like nanoparticles for small interfering RNA delivery to endothelial cells, Advanced Functional Materials, 19: 3112-3118, 2010) or exosomes (Schroeder, A., Levins, C., Cortez, C., Langer, R. and Anderson, D., Lipid-based nanotherapeutics for siRNA delivery, Journal of Internal Medicine, 267: 9-21, 2010, PMID: 20059641). In fact, exosomes have been shown to be particularly useful in delivering siRNA, which is a system somewhat similar to the CRISPR system. For example, El-Andaloussi S et al., ("Exosome-mediated delivery of siRNA in vitro and in vivo." Nat Protoc. 2012 Dec; 7(12): 2112-26. doi: 10.1038 / nprot.2012.131. Electronic publication Nov. 15, 2012) describe how exosomes are a promising tool for drug delivery across different biological barriers and can be used for delivery of siRNA in vitro and in vivo. Their method is to generate targeted exosomes by transfecting an expression vector containing an exosomal protein fused to a peptide ligand. The exosomes are then purified and characterized from the transfected cell supernatant, and RNA is then loaded into the exosomes. Delivery or administration according to the present invention can be performed with exosomes, particularly but not limited to the brain. Vitamin E (α-tocopherol) can be conjugated to CRISPR Cas and delivered to the brain with high-density lipoprotein (HDL), for example, in a manner similar to that of Uno et al. (HUMAN GENE THERAPY 22:711-719 (June 2011)) for delivery of short interfering RNA (siRNA) to the brain. Mice were infused via an Osmotic minipump (Model 1007D; Alzet, Cupertino, CA) filled with phosphate-buffered saline (PBS) or free TocsiBACE or Toc-siBACE / HDL and connected to the Brain Infusion Kit 3 (Alzet).The brain infusion cannula was placed at the midline approximately 0.5 mm behind the anterior bregma for infusion into the dorsal third ventricle. Uno et al. found that as little as 3 nmol of Toc-siRNA containing HDL could induce a considerable reduction in the target by the same ICV infusion method. In the present invention, for humans, similar doses of CRISPR Cas conjugated to α-tocopherol and co-administered with brain-targeted HDL may be considered, for example, about 3 nmol to about 3 μmol of brain-targeted CRISPR Cas may be considered. Zou et al. (HUMAN GENETHERAPY 22:465-475 (April 2011)) described a lentiviral-mediated delivery method of short hairpin RNA targeting PKCγ for in vivo gene silencing in the spinal cord of rats. Zou et al. administered approximately 10 μl of recombinant lentivirus at a titer of 1×10 via an intrathecal catheter. 9 Transduction units (TU) / ml. In the present invention, similar doses of CRISPR Cas expressed in brain-targeted lentiviral vectors can be considered for humans, for example, at a titer of 1×10 9 Approximately 10-50 ml of brain-targeted CRISPR Cas in transduction units (TU) / ml of lentivirus.

[0268] Other suitable modifications and variations of the methods of the invention described herein will be apparent to those skilled in the art and suitable equivalents may be employed without departing from the scope of the invention or embodiments disclosed herein.

[0269] Example

[0270] Hereinafter, the present invention will be described in detail by way of examples. However, the examples provided herein are only for illustrative purposes and are not intended to limit the present invention.

[0271] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0272] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0273] Example 1: Identification of novel Cas12i proteins

[0274] Download the metagenomic database of the Joint Genome Institute (JGI) (https: / / jgi.doe.gov / ), and a total of 16TB of high-quality data was obtained. More than 6,000 metagenomic data were locally aligned using TBLASTN (https: / / blast.ncbi.nlm.nih.gov / ). Among them, 10 new Cas12i proteins were found in 4 groups of samples from different sources, and they were named SiCas12i, Si2Cas12i, WiCas12i, Wi2Cas12i, Wi3Cas12i, SaCas12i, Sa2Cas12i, Sa3Cas12i, WaCas12i and Wa2Cas12i according to the different sources of the samples (Singapore, Wisconsin, San Francisco, Washington). SiCas12i is 287 and 193 amino acids smaller than SpCas9 and LbCas12a, respectively.

[0275] The amino acid sequences of SiCas12i, Si2Cas12i, WiCas12i, Wi2Cas12i, Wi3Cas12i, SaCas12i, Sa2Cas12i, Sa3Cas12i, WaCas12i and Wa2Cas12i are SEQ ID NOs: 1-10, and the nucleotide coding sequences are SEQ ID NOs: 11-20, respectively. The CRISPR seat was annotated for 4 samples containing Cas12i using PILERCR, and the DR sequences corresponding to Cas12i were obtained, which were SEQ ID NOs: 21-30, respectively.

[0276] Example 2: Comparison of the cleavage activity of Cas12i with three control SpCas9s, LbCas12a, and Cas12i.3 using a fluorescent reporter system

[0277] In order to sensitively detect the cleavage activity of the CRISPR / Cas system, a reporter vector for transcribing BFP-P2A-GFxFP mRNA was constructed (BFP-P2A-GFxFP reporter vector, SEQ ID NO: 31, Figure 1 ). BFP expresses the coding sequence of blue fluorescent protein, and the blue fluorescence indicates that the reporter vector is successfully transfected into the host cell. The GF and FP sequences in GFxFP are respectively the 561nt sequence at the N-terminus and the 609nt sequence at the C-terminus encoding the green fluorescent protein gene EGFP, and the two sequences overlap by 450nt. In the middle of GFxFP is an insert fragment (SEQ ID NO: 32), which contains the target sequence targeted by the CRISPR / Cas system (SEQ ID NO: 33).

[0278] Most of the currently known Cas12 proteins recognize 5'-T enriched PAMs of double-stranded DNA, while Cas9 recognizes 3'-G enriched PAMs of double-stranded DNA. In order to simultaneously compare the cutting activity of SpCas9 (SEQ ID NO: 34), LbCas12a (SEQ ID NO: 35), Cas12i.3 (SEQ ID NO: 36) and the 10 Cas12i described above, a PAM with a sequence of TTC was designed at the external 5' end of the target sequence, and a PAM with a sequence of GGG was designed at the external 3' end of the target sequence. The PAM domains with 5'-TTC and 3'-GGG at both ends of the external target sequence make it suitable for both the CRISPR / Cas12 system and the CRISPR / Cas9 system.

[0279] There is a TAG early terminator in the middle of the target sequence. When it is cut, GFxFP uses the recombination mechanism to produce the correct GFP coding frame and express GFP, which changes the cell from no green fluorescence to green fluorescence ( Figure 2 ).

[0280] The nucleotide coding sequences of 10 new Cas12i proteins were optimized for mammalian codons, namely SEQ ID NOs: 37-46, and constructed on an expression vector expressing mCherry red fluorescent protein. The CAG promoter was used to drive Cas expression, and the red fluorescence indicated that the expression vector was successfully transfected into the host cells.

[0281] The crRNAs targeting the BFP-P2A-GFxFP target sequences of the Cas12i proteins were designed separately (SEQ ID NOs: 47-56), containing a DR+Spacer structure in which the Spacer length was 20 nt, and were constructed together with the U6 promoter for driving crRNA transcription on the BFP-P2A-GFxFP reporter vector, and the blue fluorescence indicated that the reporter vector was successfully transfected into the host cells.

[0282] Similarly, the mammalian codon-optimized nucleotide coding sequences of SpCas9 (SEQ ID NO: 57), LbCas12a (SEQ ID NO: 58) and Cas12i.3 (SEQ ID NO: 59) were inserted into an expression vector expressing mCherry red fluorescent protein, and Cas expression was driven by CAG promoter, and the expression vector was successfully transfected into the host cell by red fluorescence indication. Similarly, the corresponding reporter vectors transcribing the respective crRNA / sgRNA (SEQ ID NO: 60-62) and BFP-P2A-GFxFP mRNA were constructed, and the reporter vector was successfully transfected into the host cell by blue fluorescence indication.

[0283] The expression vector (red fluorescence) expressing Cas12i / LbCas12a / SpCas9 and the reporter vector (blue fluorescence) transcribing BFP-P2A-GFxFP mRNA and crRNA / sgRNA were co-transfected into the HEK293 cell line by PEI transfection method. After 48 hours of culture, cells with double positive transfection (both red and blue fluorescence) were sorted by flow cytometry.

[0284] Through analysis, it was found that SiCas12i, Si2Cas12i, WiCas12i and SaCas12i had significant cleavage activity (characterized by green fluorescence intensity), among which SiCas12i had the highest cleavage activity (highest green fluorescence intensity), which was even significantly stronger than SpCas9, LbCas12a and Cas12i.3 ( Figure 3 ).

[0285] Example 3: PAM recognition of SiCas12i and testing of effective target sequence length

[0286] In order to test the PAM recognition of SiCas12i, target sequences (SEQ ID NO: 33) with 5'-TTN or 5'-NTN (wherein N is A, T, G or C) were designed and inserted into the aforementioned BFP-P2A-GFxFP reporter vector. The reporter vector also carries the aforementioned corresponding crRNA (SEQ ID NO: 47) of SiCas12i and a U6 promoter for driving crRNA transcription.

[0287] The aforementioned SiCas12i expression vector and the BFP-P2A-GFxFP reporter vector with different PAMs were co-transfected into the HEK293 cell line by PEI transfection method. After 48 hours of culture, cells transfected with double positive (both red and blue fluorescence) were sorted by flow cytometry. Through analysis, it was found that SiCas12i had a high degree of cleavage activity when PAM was 5'-TTN (wherein N was A, T, G or C), and had a lower but still significant cleavage activity when PAM was 5'-ATA or ATG ( Figure 4 ).

[0288] In order to test the effective Spacer length on the crRNA corresponding to SiCas12i, spacer sequences of different lengths of 10 to 50nt were designed respectively (corresponding to the target sequences of different lengths in Table 1), and the coding sequence of the crRNA containing the Spacer sequence and the U6 promoter for driving crRNA transcription were constructed together on the BFP-P2A-GFxFP reporter vector. The DNA coding sequence of the spacer of 20-nt length is the aforementioned SEQ ID NO:33 itself. The DNA coding sequence of the Spacer shorter than 20-nt length is a truncated version of SEQ ID NO:33. The portion of the DNA coding sequence of the Spacer longer than 20-nt that exceeds SEQ ID NO:33 is the 5' part of the nucleotide coding sequence of the FP segment of the C-terminus of GFxFP next to x, i.e., the nucleotide sequence continuously extended from SEQ ID NO:33 to 3' direction.

[0289] The aforementioned SiCas12i expression vector and the BFP-P2A-GFxFP reporter vector with different Spacer DNA coding sequences were co-transfected into the HEK293 cell line by PEI transfection method. After 48 hours of culture, cells with double positive transfection (both red and blue fluorescence) were sorted by flow cytometry. It was found that when the Spacer length was greater than 15nt, SiCas12i had efficient cleavage activity in the cell ( Figure 5 ).

[0290] DNA nucleotide coding sequence of spacer sequence / target sequence 10-nt CCATTACAGT 12-nt CCATTACAGTAG 14-nt CCATTACAGTAGGA 15-nt CCATTACAGTAGGAG 16-nt CCATTACAGTAGGAGC 17-nt CCATTACAGTAGGAGCA 18-nt CCATTACAGTAGGAGCAT 19-nt CCATTACAGTAGGAGCATA 20-nt CCATTACAGTAGGAGCATAC(SEQ ID NO:33) 21-nt CCATTACAGTAGGAGCATACG 22-nt CCATTACAGTAGGAGCATACGG 23-nt CCATTACAGTAGGAGCATACGGG 24-nt CCATTACAGTAGGAGCATACGGGA 26-nt CCATTACAGTAGGAGCATACGGGAGA 27-nt CCATTACAGTAGGAGCATACGGGAGAC 28-nt CCATTACAGTAGGAGCATACGGGAGACA 30-nt CCATTACAGTAGGAGCATACGGGAGACAAG 32-nt CCATTACAGTAGGAGCATACGGGAGACAAGCT 35-nt CCATTACAGTAGGAGCATACGGGAGACAAGCTTTG 40-nt CCATTACAGTAGGAGCATACGGGAGACAAGCTTTGGCCAC 45-nt CCATTACAGTAGGAGCATACGGGAGACAAGCTTTGGCCACCTACG 50-nt CCATTACAGTAGGAGCATACGGGAGACAAGCTTTGGCCACCTACGGCAAG

[0291] Table 1: Different lengths of spacer DNA nucleotide coding sequences / target sequences

[0292] Example 4: SiCas12i cleavage of the TTR gene in mammalian cells

[0293] In order to test the cleavage activity of SiCas12i on endogenous genes, 14 and 6 crRNAs were designed for mouse TTR gene (mTTR) and human TTR gene (hTTR), respectively, containing different 5'-TTN as PAM.CrRNA-mTTR and crRNA-hTTR are constructed on the mCherry red fluorescent protein expression vector that can express SiCas12i protein in mammalian cells, that is, crRNA is transcribed by a single vector and SiCas12i protein is expressed, and the vector is successfully transfected into host cells by red fluorescence indication.SiCas12i / crRNA-mTTR and SiCas12i / crRNA-hTTR expression vectors are transfected into mouse N2A cell line and human HEK293 cell line respectively by PEI transfection method.After 48 hours of culture, mCherry red fluorescence-positive cells are obtained by flow cytometry sorting.

[0294] The TTR gene target site of the transfected positive cells was PCR amplified. By deep sequencing and comparison analysis of the PCR products, it was found that the CRISPR-SiCas12i system of the present invention had a maximum cleavage activity of 91.77% at the TTR gene of the mouse N2A cell line, and a maximum cleavage activity of 99.85% at the TTR gene of the human HEK293 cell line. Since the cleavage at any one or more of the target sites shown in the TTR gene can lead to TTR gene inactivation, the highest cleavage activity at any of the sites shown can be considered as the highest efficiency for inactivating the TTR gene as a whole. In other words, SiCas12i can achieve a gene inactivation efficiency of up to 91.77 for the mouse TTR gene and up to 99.85% for the human TTR gene.

[0295] Target sequence Indel total ratio(%) mTTR-1 TTGCCTCGCTGGACTGGTATTTG 36,250 71,553 50.66 mTTR-2 TTGTGTCTGAAGCTGGCCCCGCG 60,837 73,708 82.53 mTTR-3 TTCCCTTCGACTCTTCCTCCTTT 63,024 78,418 80.37 mTTR-4 TTCCTCCTTTGCCTCGCTGGACT 39,196 107,179 36.57 mTTR-5 TTGACCATCAGAGGACATTTGGA 83,346 120,336 69.26 mTTR-6 TTGGATTCTCCAGCACCCTGGGC 57,889 315,351 18.36 mTTR-7 TTACAGCCACGTCTACAGCAGGG 79,919 117,015 68.30 mTTR-8 TTCAAAAAGACCTCTGAGGGATC 89,744 148,541 60.42 mTTR-9 TTGAACACTTTTACAGCCACGTC 20,802 136,682 15.22 mTTR-10 TTGTAGAAGGAGTGTACAGAGTA 96,448 105,094 91.77 mTTR-11 TTCTCATCTGTGGTGAGCCCGTG 20,548 99,368 20.68 mTTR-12 TTGTAGAAGGAGTGTACAGAGTA 26,791 35,925 74.57 mTTR-13 TTCTACAAACTTCTCATCTGTGG 43,757 116,430 37.58 mTTR-14 TTTCACAGCCAACGACTCTGGCC 26,290 106,510 24.68

[0296] Table 2: Editing efficiency of SiCas12i at different sites of mouse TTR gene (the first three bases are PAM region)

[0297] Target sequence Indel Total Ratio (%) hTTR-1 TTGACCATCAGAGGACACTTGGA 18,383 159,005 11.56 hTTR-2 TTCAGAAAGGCTGCTGATGACAC 116,017 292,247 39.70 hTTR-3 TTGTAGAAGGGATATACAAAGTG 647,858 673,470 96.20 hTTR-4 TTGGCATCTCCCCATTCCATGAG 1,085,294 1,086,931 99.85 hTTR-5 TTCCAGTAAGATTTGGTGTCTAT 711,892 768,861 92.59 hTTR-6 TTCCACCACGGCTGTCGTCACCA 233,948 504,804 46.34

[0298] Table 3: Editing efficiency of SiCas12i at different sites of the human TTR gene (the first three bases are the PAM region)

[0299] Example 5: Comparison of the cleavage activity of SiCas12i and control SpCas9, LbCas12a and Cas12i.3 in mammalian cells

[0300] In order to compare SiCas12i and control SpCas9, LbCas12a and Cas12i.3 cleavage activity in different endogenous gene sites. Four sites with 5'-TTN and 3'-NGG PAM were selected in the DNMT1, TTR and PCSK9 genes of the people respectively for testing, and these four sites are suitable for both Cas12 and Cas9. SiCas12i, SpCas9, LbCas12a and Cas12i.3 corresponding guide RNAs (crRNA for Cas12 and sgRNA for Cas9) (SEQID NO:63-78) were designed for these four sites respectively. The guide RNA is constructed accordingly on the mCherry red fluorescent protein expression vector that can express SiCas12i, SpCas9, LbCas12a or Cas12i.3 protein in mammalian cells, i.e., guide RNA is transcribed by a single vector and Cas protein is expressed, and the vector is successfully transfected into host cells by red fluorescence indication. SiCas12i / crRNA, SpCas9 / sgRNA, LbCas12a / crRNA and Cas12i.3 / crRNA expression vectors were transfected into the human HEK293 cell line by PEI transfection method. After 48 hours of culture, mCherry red fluorescence-positive cells were sorted by flow cytometry.

[0301] PCR amplification was performed on the target sites of transfected positive cells. Through deep sequencing and comparison analysis of PCR products, it was found that SiCas12i had the highest cleavage activity at three sites, and the cleavage activity at four sites was higher than that of Cas12i.3 and LbCas12a ( Figure 6 ).

[0302] Example 6: Comparison of the cleavage activity of SiCas12i and control Cas12i.3 in endogenous genes

[0303] In order to further compare the cleavage activity of SiCas12i and control Cas12i.3 in endogenous genes, 11 target sequences with different 5'-TTN as PAM were selected in TTR and PCSK9 genes for testing. The crRNAs of SiCas12i and Cas12i.3 were designed for these 11 sites respectively. The crRNA was constructed on an mCherry red fluorescent protein expression vector that can express SiCas12i or Cas12i.3 protein in mammalian cells, that is, crRNA was transcribed and Cas protein was expressed by a single vector, and the vector was successfully transfected into the host cell by red fluorescence. SiCas12i / crRNA and Cas12i.3 / crRNA expression vectors were transfected into human HEK293 cell lines by PEI transfection method, respectively. After 48 hours of culture, mCherry red fluorescence-positive cells were obtained by flow cytometry sorting.

[0304] The target sites of transfected positive cells were PCR amplified. Through T7E1 enzyme treatment and gel electrophoresis, it was found that SiCas12i had higher or equivalent cleavage activity than Cas12i.3 at all sites ( Figure 7-8 ).

[0305] Target sequence 5’-PAM TTR-1 AATCCAAGTGTCCTCTGATGGT TTG TTR-2 AATGTGGCCGTGCATGTGTTCA TTC TTR-3 TAGATGCTGTCCGAGGCAGTCC TTC TTR-4 CACCACGGCTGTCGTCACCAAT TTC PCSK9-1 TTCCTGGCTTCCTGGTGAAG TTC PCSK9-2 CTGGTGAAGATGAGTGGCGA TTC PCSK9-3 AAGTTGCCCCATGTCGACTA TTG PCSK9-4 CCCAGAGCATCCCGTGGAAC TTG PCSK9-5 GCCCAGAGCATCCCGTGGAA TTT PCSK9-6 CCCCTCCACGGTACCGGGCG TTA PCSK9-7 CCCCTCCACGGTACCGGGCG TTA

[0306] Table 4: Human TTR and PCSK9 gene target sequences with different PAMs

[0307] Example 7: Application of SiCas12i in single base editing (A->I)

[0308] In order to obtain the dSiCas12i version that loses cutting activity, dSiCas12i (amino acid sequence is SEQ ID NO:79-82) with D700A, D650A, E875A or D1049A single point mutations are constructed. Spacer sequences of 20nt and 23nt are designed for human KLF4 gene loci (SEQ ID NO:83-84, respectively). Two kinds of crRNA with the aforementioned Spacer sequence are constructed on the mCherry red fluorescent protein expression vector that can express four kinds of dSiCas12i in mammalian cells, i.e., crRNA is transcribed by a single vector and Cas protein is expressed, and the vector is successfully transfected into host cells by red fluorescence indication. dSiCas12i / crRNA expression vectors are transfected into human HEK293 cell line respectively by PEI transfection method. After 48 hours of cultivation, mCherry red fluorescence positive cells are obtained by flow cytometry sorting.

[0309] PCR amplification was performed on the KLF4 site of transfected positive cells. Sequencing analysis revealed that the D700A point mutation resulted in a decrease in cleavage activity of about 84% compared to its wild type. The D650A point mutation resulted in a decrease in cleavage activity of about 99% compared to its wild type, the E875A point mutation resulted in a decrease in cleavage activity of about 100% compared to its wild type, and the D1049A point mutation resulted in a decrease in cleavage activity of about 98% compared to its wild type. The difference in spacer length between 20nt and 23nt had no significant effect on cleavage activity ( Figure 9 ).

[0310] Select dSiCas12i (D1049A) to establish fusion protein with TadA8e (SEQ ID NO: 85), and also use dCas12i.3 to construct fusion protein with TadA8e (SEQ ID NO: 86) as a control. This design of TadA8e-dSiCas12i and TadA8e-dCas12i.3 corresponding guide RNA (SEQ ID NO: 87-88) for human KLF4 gene locus. The guide RNA is constructed on the mCherry red fluorescent protein expression vector that can express TadA8e-dSiCas12i and TadA8e-dCas12i.3 protein in mammalian cells, i.e., the guide RNA is transcribed by a single vector and Cas protein is expressed, and the vector is successfully transfected into host cells by red fluorescence. TadA8e-dSiCas12i / crRNA and TadA8e-dCas12i.3 / crRNA expression vectors are transfected into human HEK293 cell lines by PEI transfection method. After 48 hours of culture, mCherry red fluorescence positive cells were sorted by flow cytometry.

[0311] PCR amplification of the KLF4 site of transfected positive cells. Sequencing analysis revealed that TadA8e-dSiCas12i has more than 10% single-base editing activity in mammalian cells ( Figure 10 ).

[0312] Example 8: Effect of DR sequence of SiCas12i on activity

[0313] In order to test whether the DR sequence of SiCas12i can tolerate mutations, a series of mismatches or deletions were designed at different positions of the DR sequence. A total of 5 different DR variants (DR-A, DR-B, DR-C, DR-D, DR-E; their DNA coding sequences are shown in Figure 2) were designed without destroying the DR secondary structure (i.e., the secondary structure of the DR variant was substantially the same as that of the DR WT). Figure 11Left panel; The RNA sequences of DR WT and the five DR variants thereof are SEQ ID NOs: 101-106, respectively, containing 5% to 30% mutations in the stem-loop region. The target sequence (SEQ ID NO: 33) was designed on the aforementioned BFP-P2A-GFxFP reporter vector (see Example 2), and the coding sequences (SEQ ID NOs: 89-94) of the six corresponding crRNAs (SEQ ID NOs: 95-100) were constructed on the reporter vector behind the U6 promoter for driving crRNA transcription.

[0314] The aforementioned SiCas12i mCherry red fluorescence expression vector and the BFP-P2A-GFxFP reporter vector were co-transfected into the human HEK293 cell line by PEI transfection method. After 48 hours of culture, cells transfected with double positive (both red and blue fluorescence) were sorted by flow cytometry. Through analysis, it was found that SiCas12i had a high degree of cleavage activity (characterized by green fluorescence intensity) under different DR variants, which was comparable to WT DR ( Figure 11 (right panel). It can be seen that when the DR secondary structure is maintained (i.e., the secondary structure of the DR variant is substantially the same as that of the DR WT), the CRISPR-Cas12i system can tolerate mismatches or deletions on the DR without losing cleavage activity, and has a wide range of adaptability to DR changes.

[0315] sequence

[0316]

[0317]

[0318]

[0319]

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

Claims

1. A Cas12i protein comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identity to the amino acid sequence shown in any one of SEQ ID NO: 1-10 (preferably, SEQ ID NO: 1-3 and 6, more preferably, SEQ ID NO: 1).

2. The Cas12i protein of any one of the preceding claims, wherein the Cas12i protein is substantially lacking (e.g., retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or less) the corresponding wild-type Cas12i protein for a target sequence of a target DNA complementary to a guide sequence. Spacer specific endonuclease cleavage activity.

3. The Cas12i protein of any one of the preceding claims, wherein the Cas12i protein is included in one or more amino acid changes in its RuvC domain so that the Cas12i protein is substantially lacking (e.g., retaining less than 50%, 40%, 35%, 30%, 27.5%, 25%, 22.5%, 20%, 17.5%, 15%, 12.5%, 10%, 7.5%, 5%, 4%, 3%, 2.5%, 2%, 1% or lower) corresponding wild-type Cas12i protein for the target sequence of the target DNA complementary to the guide sequence Spacer (Spacer) specific endonuclease cleavage activity.

4. the Cas12i protein according to any one of the preceding claims, wherein the amino acid change is selected from amino acid addition, insertion, deletion and replacement.

5. The Cas12i protein according to any one of the preceding claims, the Cas12i protein being included in the amino acid replacement at one or more positions corresponding to the 700th (D700), the 650th (D650), the 875th (E875) or the 1049th (D1049) of the sequence shown in SEQ ID NO:

1.

6. Cas12i protein according to any one of the preceding claims, the amino acid replacement being selected from D700A / V, D650A / V, E875A / V and D1049A / V.

7. The Cas12i protein of any one of the preceding claims, wherein the amino acid replacement is selected from D700A, D650A, E875A and D1049A.

8. the Cas12i protein of any one of the preceding claims, the amino acid replacement being selected from D700A, D650A, E875A, D1049A, D700A+D650A, D700A+E875A, D700A+D1049A, D650A+E875A, D650A+D1049A, E875A+D1049A, D700A+D650A+E875A, D700A+D650A+D1049A, D650A+E875A+D1049A, and D700A+D650A+E875A+D1049A.

9. The Cas12i protein according to any one of the preceding claims, the Cas12i protein comprising the amino acid sequence shown in any one of SEQ ID NO:79-82.

10. The Cas12i protein of any one of the preceding claims, which is connected to one or more functional domains.

Images