Construction method and application of in-vivo fixed-point knockdown Mett13 protein expression transgenic mouse

Abstract

The invention belongs to a molecular biological technology, and discloses a construction method and an application of sgRNA of targeted Mett13 as well as a transgenic mouse for knocking down Mett13 protein expression at a fixed point. A coding gene of guide RNA of Mett13 is obtained through Crispick online tool design, a PiggyBAC transposase system and a fertilized egg injection mode are utilized, a target gene is randomly inserted into a mouse genome, and then a TGsgMett13 overexpression transgenic mouse model is obtained through genotype identification and screening. The TGsgMettl3 overexpression transgenic mouse model can express a guide gene of Mettl3 in a whole body tissue, the TGsgMettl3 overexpression transgenic mouse model and a tissue-specific Cas9 overexpression mouse are hybridized to knock down the expression quantity of Mettl3 in a specific tissue in a mouse body, and a new tool and thought are provided for researching the Mettl3 gene function.

Description

Technical Field

[0001] The present invention relates to molecular biology technology, and more specifically, to a method for constructing and using a sgRNA targeting Mettl3 and a transgenic mouse for knocking down Mettl3 protein expression at a specific site. Background Art

[0002] Genetically engineered mice refer to mouse models that have foreign genes integrated into chromosomes through transgenic technology and can be stably inherited. In the field of contemporary biological and medical research, the selection and creation of model organisms has become a key step in revealing gene functions and disease mechanisms. Among many model organisms, the gene knockout mouse model has always been an extremely valuable tool for geneticists. Given that mice and humans share approximately 99% of the same genes, mice have become an ideal choice for simulating most human biological processes. In addition, mice are widely used as experimental animals because of their small size, short life cycle and strong reproductive capacity. Therefore, purposefully knocking out a gene in mice has become a key means to determine the biological role of genetic alleles.

[0003] As a revolutionary gene editing tool, CRISPR / Cas9 technology has been widely used in gene editing of multiple species due to its unique efficiency, convenience and wide range of applications. When gRNA, crRNA and Cas protein coexist, the CRISPR / Cas9 system can cut the target gene site, and the cut site can be repaired by non-homologous end joining or homologous end joining, ultimately achieving mutation (random insertion / deletion) of the target site, site-specific knock-in of exogenous fragments and other modifications.

[0004] The normal physiological function of the human female reproductive system depends on the gonadal axis of the reproductive endocrine system, which regulates ovulation and the menstrual cycle. The maintenance of normal pregnancy depends on the receptive state of the endometrium, normal embryogenesis, and the immune microenvironment at the maternal-fetal interface. Many studies have shown that 6 A modification is related to the regulation of the physiological functions of the female reproductive system. For example, by controlling the translation of Pgr mRNA, 6 A modification, Mettl3 is essential for P4 signal transduction during embryonic development. 6 A-RNA immunoprecipitation-qPCR revealed that Pgr mRNA transcript is a target that can be activated by Mettl3-dependent m 6 AmRNA methylation. During ovarian aging, the researchers found that FTO levels in ovarian granulosa cells were upregulated to reduce the mRNA of FOS-mRNA-3′UTR. 6 A level, can alleviate ovarian aging. However, m 6 The subtle mechanisms of A modification in the physiological functions of the female reproductive system remain to be elucidated.

[0005] m 6 The formation of A is a dynamic and reversible process. 6 A "writer" is composed of three independent proteins: methyltransferase-like protein 3 (Mettl3), methyltransferase-like protein 14 (Mettl14), Wilms tumor-associated protein (WTAP), and methyltransferase-related protein (VIRMA). The methyltransferase complex catalyzes m 6 A modification. First, it was demonstrated that Mettl3 is m 6 A methyltransferase, whose expression can directly affect m 6 The total methylation level of A has a significant effect on mRNA stability, thereby affecting cell function. Mettl14 and Mettl3 can form a stable complex, which plays a vital role in substrate recognition. In addition, Mettl3 is required for the differentiation of human endometrial stromal cells in vitro. At present, there are no reports of mice with in vivo site-directed knockout of Mettl3 constructed using CRISPR / Cas9 technology. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the above-mentioned problems existing in the prior art. First, a sgRNA targeting Mettl3 is provided.

[0007] The second object of the present invention is to provide a DNA fragment containing the sgRNA targeting Mettl3 according to claim 1.

[0008] The third object of the present invention is to provide a method for constructing a TG sgMettl3 Methods for overexpression transgenic mouse models.

[0009] The fourth object of the present invention is to provide a method for constructing a transgenic mouse with site-specific knockdown of Mettl3 protein expression.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] The present invention first provides sgRNAs targeting Mettl3, wherein the sgRNAs are sgRNA1 and sgRNA2, as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0012] The present invention also provides a DNA fragment (SEQ ID NO.4) containing the sgRNA targeting Mettl3, wherein the DNA fragment includes, from the 5' end to the 3' end, a U6 promoter, sgRNA1, a U6 promoter, sgRNA2, a U6 promoter, a sgGFP encoding gene shown in SEQ ID NO.3, a CAG promoter encoding gene, an mcherry encoding protein, an SV40 poly (A) encoding gene, an mcherry encoding protein, a P2A peptide encoding gene, a GFP encoding gene, and a bGH poly (A) encoding gene.

[0013] The present invention also provides a method for constructing a TG sgMettl3 The method for overexpressing transgenic mouse model is to integrate the DNA fragment described in claim 2 into the mouse genome by using the PiggyBAC transposase system, and then obtain it by genotype identification and screening.

[0014] Preferably, the PiggyBAC mRNA is obtained by in vitro transcription; the PiggyBAC mRNA and the PiggyBAC of the DNA fragment are microinjected into the fertilized eggs of C57BL / 6J mice to obtain transgenic positive founder mice; the transgenic positive founder mice are hybridized with wild-type mice to obtain offspring, and the TG is obtained by genotyping and screening. sgMettl3 Overexpression transgenic mouse model.

[0015] The present invention also provides a method for constructing a transgenic mouse with site-specific knockdown of Mettl3 protein expression, comprising the following steps:

[0016] (1) Ltf Cre / + Mouse and Rosa26 lslcas9 / + The offspring of mice were obtained by hybridization and Ltf was obtained by genotyping and screening. Cre / + Rosa26 lslcas9 / + Mice;

[0017] (2) The TG obtained in claim 3 sgMettl3 Overexpression of transgenic mice with Ltf Cre / + Rosa26 lslcas9 / + The mice were crossed to obtain mouse offspring, and then transgenic mice with site-specific knockdown of Mettl3 protein expression were obtained through genotype identification and screening.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The TG obtained by the present invention is constructed by combining CRISPR / Cas9 technology sgMettl3The overexpression transgenic mouse model can express the guide RNA of Mettl3 throughout the body. Combined with the designed site-specific expression of Cas9 protein mice, it can achieve site-specific knockdown of Mettl3 expression in mice, providing new tools and ideas for studying the function of the Mettl3 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the instruction manual of the In-Fusion® HD Cloning Kit in Example 2;

[0021] Figure 2 Schematic diagram of the hNCR3-Tg plasmid used in Example 2;

[0022] Figure 3 The results of ScaI single enzyme digestion identification of the targeting vector in Example 2;

[0023] Figure 4 is TG in Example 3 sgMettl3 PCR electrophoresis identification results of overexpression transgenic mice;

[0024] Figure 5 TG in Example 4 sgMettl3 Ltf Cre / + Rosa26 lslcas9 / + Mouse, Ltf Cre / + Rosa26 lslcas9 / + PCR electrophoresis identification results of mice and wild-type mice; among them, Figure 5 a. Figure 5 b and Figure 5 Lane 1 of c is TG sgMettl3 Ltf Cre / + Rosa26 lslcas9 / + Mouse (Sanyang type mouse), lane 2 is Ltf Cre / + Rosa26 lslcas9 / + mice (double positive mice), wt is wild-type mice;

[0025] Figure 6 is TG in Example 5 sgMettl3 Ltf Cre / + Rosa26 lslcas9 / + Mouse, Ltf Cre / + Rosa26 lslcas9 / + Results of immunohistochemical detection of Cas9 protein in the uterus of mice and wild-type mice; the first row is the whole uterus, the second row is a partial enlargement (luminal epithelium), and the third row is an enlargement of the glandular epithelium of the whole uterus in the first row; the black horizontal line is a 100μm ruler;

[0026] Figure 7 is TG in Example 5 sgMettl3 Ltf Cre / +Rosa26 lslcas9 / + Mouse, Ltf Cre / + Rosa26 lslcas9 / + Results of immunohistochemical detection of Mettl3 protein in the uterus of mice and wild-type mice; the first row is the whole uterus, the second row is a partial enlargement (luminal epithelium), and the third row is an enlargement of the glandular epithelium of the whole uterus in the first row; the black horizontal line is a 100μm ruler. DETAILED DESCRIPTION

[0027] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0028] Example 1 Design of guide RNA (sgRNA) for Mettl3

[0029] 1. Experimental Methods

[0030] Use the Crisprick online tool to enter the following parameters:

[0031] (1) Reference genome: Mouse GRCm38

[0032] (2) Mechanism: CRISPRko

[0033] (3) Enzyme: SpyoCas9 (chen (2013) tracrRNA)

[0034] (4) Gene information: Mettl3 (Ensembl: ENSG00000165819)

[0035] 244 gene sequences were obtained by running the Crisprick online tool, and then the above sequences were screened according to the following two strategies: on the one hand, the comprehensive score of the sequence was as high as possible; on the other hand, the number of bases cut between two sgRNAs could not be a multiple of three.

[0036] 2. Experimental Results

[0037] The two Mettl3 sgRNAs were obtained as follows:

[0038] sgRNA1: 5'-TGCCGCCCAGGAGTTGATTG-3' (SEQ ID No. 1);

[0039] sgRNA2: 5'-GTTGAAAAGTTTCGCTCTCG-3' (SEQ ID No. 2).

[0040] Example 2 Construction and enzyme digestion verification of PiggyBAC plasmid

[0041] 1. Construction of expression elements and plasmids

[0042] The sgRNA expression element was designed (sequence as SEQ ID NO.4): U6-sgRNA1-U6 sgRNA2-U6-sgRNA3-CAG-mcherry-SV40 poly(A)-mcherry-P2A-GFP-bGHpoly(A); the sgRNA1 was as shown in SEQ ID No.1; the sgRNA2 was as shown in SEQ ID No.2; the sgRNA3 was as shown in SEQ ID No.3, and sent to Shanghai Sangon Biotechnology Co., Ltd. for whole gene synthesis.

[0043] sgRNA3: 5'-CGAAGTTATATTAAGGGTTC-3' (SEQ ID No. 3).

[0044] 2. DNA recombination method refers to the instructions of In-Fusion® HD Cloning Kit, such as Figure 1 As shown; hNCR3-Tg plasmid is from Shanghai Nanmo Biotechnology Development Co., Ltd., and the plasmid is as shown Figure 2 As shown; the hNCR3-Tg plasmid was cut open by double digestion with BamHI and SalI to produce sticky ends, and the target fragment U6-sgRNA1-U6sgRNA2-U6-sgRNA3-CAG-mcherry-SV40 poly(A)-mcherry-P2A-GFP-bGH poly(A) was amplified by PCR, and the obtained target fragment and the digested vector were recombined by In-Fusion enzyme.

[0045] 3. Enzyme digestion of hNCR3-Tg plasmid vector: After preparing the system as shown in Table 1, digest in a 37°C water bath for 2.5 hours, add 5ul of 10× Loading Buffer, and perform 1% agarose gel electrophoresis. Then recover the enzyme-digested vector fragments.

[0046] Table 1 Enzyme digestion system

[0047] Component name Dosage / ul 10×HBuffer 6 B H 2 SalI 2 hNCR3-Tg (about 200ng / ul) 20 ddH2O 30 Total volume 60

[0048] 4. In-Fusion enzyme connection: Mix the system shown in Table 2 and place it in a PCR instrument for reaction at 50°C for 15 minutes. The product is directly converted into a recombinant vector connected to the target gene.

[0049] Table 2 In-Fusion System Table

[0050]

[0051] 5. Plasmid purification: Inoculate 400 ml LB with the clone that has been sequenced correctly, extract the plasmid using the NucleoBond Xtra Midi PlusEF kit, dissolve it in Nuclease-Free Water, and store it at -30°C. The steps are as follows:

[0052] The process of plasmid extraction using NucleoBond Xtra Midi Plus EF kit is as follows:

[0053] Preparation before the experiment: Add the RNase in the brown bottle to Buffer RES EF, mark it and store it at 4℃.

[0054] (1) 400 ml of bacterial solution was divided into 8 tubes and placed into 50 ml centrifuge tubes. Centrifuge at 4800 rpm for 10 min at 4°C and discard the supernatant.

[0055] (2) Add 4 ml of prepared RES EF solution to each tube and pipette until the solution is uniform without lumps. Combine every 4 tubes of solution into one tube, and finally add two tubes, each with 16 ml.

[0056] (3) Add 16 ml of Buffer Lys EF (blue) to each tube, cover the tube promptly, and slowly shake it upside down for about 4 to 5 times. Let it stand and time it. The time from pouring Lys EF solution to adding NEU EF solution should not exceed 5 minutes.

[0057] (4) When the reaction is close to 5 minutes, carefully open the lid, add 16 ml of NEU EF solution to each tube, slowly invert until the system turns into white floccules, and place on ice for 15 minutes. Xtra MidiFilter Insert Xtra Midi Columns, put into the rack, add appropriate amount (top up) of EQU EF solution into the column, and wet the cotton core in the middle;

[0058] (5) When the EQU is completely drained (the cotton core is not dry), take out the solution on the ice, shake it well, and pour it into the column. Load the sample once every few minutes. Do not let the cotton core dry out.

[0059] (6) After the solution is dripped dry, add 5 ml of FIL EF solution to the column. When adding liquid, drip it evenly on the part where the cotton core is exposed upward. Do not add it directly to the middle of the cotton core. After the solution is dripped dry, discard the cotton core.

[0060] (7) Add 35 ml of ENDO EF solution to the column, and add 15 ml of WASH EF solution after dripping dry;

[0061] (8) After dripping dry, place it aside and add 5 ml of ELU EF to each tube for elution. After dripping dry, blow the solution with a gun. Do not let the solution drip on the wall during blowing. Repeat the blowing for about 10 times. Each tube is evenly divided into 6 tubes, about 830 ul / EP tube;

[0062] (9) Add 0.7 times the volume of isopropanol to each EP tube, about 583ul / tube, shake well, and centrifuge at 12800rpm at 4℃ for 15 minutes;

[0063] (10) After centrifugation, you will see white petal-like substances at the bottom of the EP tube, which are plasmids. Carefully discard the supernatant (the plasmid is slightly slippery), add 1 ml of 75% ethanol to each tube for washing, and centrifuge at 13,000 rpm for 5 min at room temperature;

[0064] (11) After centrifugation, discard the supernatant, close the lid and centrifuge for 20 seconds, remove the tube steadily and carefully, and do not invert or violently bump it. After opening the lid, use a gun to suck out as much residual liquid as possible at the bottom of the tube. Be careful not to suck the plasmid into the gun tip;

[0065] (12) Allow to air at room temperature for 2 min. Add 20 μl of Nuclease-free water to each tube and place in a 56°C oven to dissolve for 10 min. Take out the tube and use a filter pipette to combine the tubes into one tube. Draw out 2 μl for quantitative analysis. The large-scale plasmid extraction is complete.

[0066] 6. Homologous recombination plasmid restriction enzyme identification: According to the design, a targeting piggyBAC vector containing U6-sgMettl3 was constructed. The constructed targeting vector was digested with ScaI. After the system was prepared as shown in Table 3, after digestion in a 37°C water bath for 2.0 hours, 2 ul of 10× Loading Buffer was added and 1% agarose gel electrophoresis was performed. The results are as follows: Figure 3 As shown, the results of ScaI single enzyme digestion identification of the targeting vector are theoretically 8264bp, 2536bp, 1021bp, and 359bp, which are in line with expectations, proving that the targeting vector was successfully constructed.

[0067] Table 3 Enzyme digestion system

[0068] Component name Dosage / ul 10×HBuffer 2.0 ScaI 0.5 N1-6068 plasmid (about 200 ng / ul) 5.0 ddH2O 12.5 Total volume 20.0

[0069] Example 3TG sgMettl3 Construction and screening of overexpression transgenic mouse models

[0070] 1. Experimental Methods

[0071] 1. PiggyBAC mRNA and the vector plasmid PiggyBAC containing the target insert (synthesized in Example 2) were injected into the fertilized eggs of C57BL / 6J mice by microinjection, and the injected fertilized eggs were transplanted into the oviducts of pseudo-pregnant female mice to obtain mice to be identified.

[0072] 2. DNA extraction: Cut 5 mm ear samples from 3 mice to be identified and transfer them to a 200 μL centrifuge tube.

[0073] Add 50 μL of mouse tissue lysis buffer and 1 μL of Proteinase K to a centrifuge tube, mix well, and centrifuge quickly for 20 seconds.

[0074] Place the centrifuge tube after centrifugation into the PCR instrument, set the program to 55℃20min, 95℃5min, and lyse the sample to extract DNA. Store the extracted DNA sample in a -40℃ refrigerator for later use.

[0075] PCR extension of target fragments: PCR extension of target fragments was performed on the mice to be identified using the primers shown in Table 4, the PCR amplification system shown in Table 5, and the PCR amplification program shown in Table 6.

[0076] Table 4TG sgMettl3 Genotype identification primer information

[0077] Primer Sequence5'-->3' PrimerType I ACAAGCTGGAGTACAACTACAACA Forward II CGGTAAGTGTCACTGATTTTGAACT Reverse

[0078] Table 5TG sgMettl3 Genotype identification reaction system

[0079] ReactionComponent Volume(μl) ddH2O 7.4 2x RapidTaqMasterMix* 10 PrimerI (10 pmol / μl) 0.8 Primer II (10 pmol / μl) 0.8 genomicDNA 1 Total 20

[0080] Table 6TG sgMettl3 Genotyping reaction procedure

[0081] Step Temp(℃) Time Note 1 95 3min - 2 95 15sec - 3 60 15sec - 4 72 2min repeatsteps2-4for34cycles 5 72 5min - 6 12 - hold

[0082] 3. Agarose gel electrophoresis

[0083] Clean the glue tank, glue board, comb, measuring cylinder and conical flask. After they are dried, put the glue board and comb into the glue tank for later use.

[0084] Add 60 mL of 1×TEA solution and 1.2 g of agar powder to a conical flask. According to the standards of our laboratory, we use 1.5% to 2% agarose content. Then use a microwave to heat the mixture to boiling. When the agar powder is completely dissolved and clear, take it out and shake it well for later use.

[0085] After the mixture has cooled slightly, add 6 μL of nucleic acid dye (diluted at a ratio of 1:1000), shake it again, pour it into the gel tank, and let it cool and solidify at room temperature. You can shake it slightly to check the solidification of the gel.

[0086] After the gel solidifies, pull out the comb and carefully transfer the gel to the electrophoresis tank, taking care to keep the TAE working solution in the electrophoresis tank clean and free of impurities.

[0087] 6 μL of sample was loaded into each well and labeled with DL2000 DNA Marker, where the band sizes were 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp, respectively. Finally, electrophoresis was performed at a constant voltage of 120 V for 30 min, and then the agarose gel was placed in a gel imager for band observation and photographing.

[0088] Experimental results: Figure 4 As shown, when specific primers were used, PCR amplified a band of 791 bp, and the positive mouse numbers identified were 1, 4, 6, 7, 8, 16, 18, 19, 24, 26, 27, 29, 30, 31, 33, 34, and 35.

[0089] Example 4TG sgMettl3 Ltf Cre / + Rosa26 lslcas9 / + Genotyping and screening of tool mice

[0090] 1. Experimental Methods

[0091] 1. Hybridization and propagation:

[0092] Get Ltf Cre / + Rosa26 lslcas9 / + Mice: Ltf Cre / + Mice (purchased from The Jackson Laboratory) and Rosa26 lsl-cas9 / + The Ltf Cre / + Rosa26 lslcas9 / + Mouse.

[0093] The TG obtained in Example 2 sgMettl3 Overexpression of transgenic mice with Ltf genotype Cre / + Rosa26 lslcas9 / + Crossbreed mice to obtain mouse offspring.

[0094] Each transgenic founder mouse (F0) is randomly inserted, with different insertion sites and expression levels. Usually, the F0 mouse is bred with the wild-type mouse for one generation to obtain the stable inherited F1 generation mouse. PiggyBAC transposase tends to insert the target fragment into the transcriptionally active region, but there may be the possibility of multi-site integration. Each F0 mouse is backcrossed with the wild-type mouse for at least 2-3 generations to obtain the exogenous gene single-site integration and stable expression of the F2 or F3 generation transgenic mouse, and then this mouse is independently established.

[0095] 2. DNA extraction: Cut 5 mm ear samples from 3-week-old mice to be identified and transfer them to a 200 μL centrifuge tube. Add 50 μL of mouse tissue lysis buffer and 1 μL of proteinase K to the centrifuge tube, mix well, and centrifuge quickly for 20 seconds.

[0096] Place the centrifuge tube after centrifugation into the PCR instrument, set the program to 55℃20min, 95℃5min, and lyse the sample to extract DNA. Store the extracted DNA sample in a -40℃ refrigerator for later use.

[0097] 3. PCR extension of target fragments: Use the five pairs of primers in Table 4, Table 7 and Table 10 respectively (the universal primer and wild-type primer in Table 7 identify the wild-type gene, the universal primer and mutant primer identify Ltf Cre / + Gene; in Table 10, primers p1p2 identified the wild-type gene, and primers p2p3 identified Rosa26 lslCas9 / + Gene), three PCR amplification systems in Table 5, Table 8 and Table 11 and three PCR amplification programs in Table 6, Table 9 and Table 12 were used to expand the PCR target fragments of the mice to be identified.

[0098] Table 7Ltf Cre / + Genotype identification primer information

[0099] Primers Sequence (5'-3') Primer Type 21216(T2) AACTAGCACACCTGGTTGAGG Universal primer 21217(T1) CTTCTTGGGAGGCAGTGAAC Wild-type primer 21218(T3) CAGGTTTTGGTGCACAGTCA Mutation Primer

[0100] Table 8Ltf Cre / + Genotype identification PCR amplification system

[0101]

[0102]

[0103] Table 9Ltf Cre / + Genotyping PCR reaction procedure

[0104]

[0105] Table 10Rosa26 lslCas9 / + Mouse genotype identification primer information

[0106] Primers Sequence (5'-3') P1 GGGGCGTGCTGAGCCAGACCTCCAT P2 TCCCGACAAAACCGAAAATCTGTGG P3 TGCATCGCATTGTCTGAGTAGG

[0107] Table 11 Rosa26 lslCas9 / + Genotype identification PCR reaction system

[0108]

[0109] Table 12 Rosa26 lslCas9 / + Genotyping PCR reaction procedure

[0110]

[0111] 4. Agarose gel electrophoresis

[0112] Clean the glue tank, glue board, comb, measuring cylinder and conical flask. After they are dried, put the glue board and comb into the glue tank for later use.

[0113] Add 60 mL of 1×TEA solution and 1.2 g of agar powder to a conical flask. According to the standards of our laboratory, we use 1.5% to 2% agarose content. Then use a microwave to heat the mixture to boiling. When the agar powder is completely dissolved and clear, take it out and shake it well for later use.

[0114] After the mixture has cooled slightly, add 6 μL of nucleic acid dye (diluted at a ratio of 1:1000), shake it again, pour it into the gel tank, and let it cool and solidify at room temperature. You can shake it slightly to check the solidification of the gel.

[0115] After the gel solidifies, pull out the comb and carefully transfer the gel to the electrophoresis tank, taking care to keep the TAE working solution in the electrophoresis tank clean and free of impurities.

[0116] 6 μL of sample was loaded into each well and labeled with DL2000 DNAMarker, where the band sizes were 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp, respectively. Finally, electrophoresis was performed at a constant voltage of 120 V for 30 min, and then the agarose gel was placed in a gel imager for band observation and photographing.

[0117] Experimental results: Figure 5 As shown in the figure, sample No. 1 is a triple-gene positive mouse, sample No. 2 is a double-gene positive mouse, and wt is a wild-type mouse.

[0118] Ltf Cre / +The results of PCR electrophoresis identification of the gene are shown in 5a. When using a specific primer pair (universal primer T2 + wild-type primer T1), a 215bp band was amplified in the triple-yang mice, double-yang mice and wild-type control mice. When using a specific primer pair (universal primer T2 + mutant primer T3), a 350bp band was amplified in the triple-yang mice and double-yang mice, while there was no band in the wild-type control mice.

[0119] Rosa26 lslcas9 / + The results of PCR electrophoresis identification of genes are as follows Figure 5 As shown in b, when using a specific primer pair (P1, P2), a 435bp band was amplified in the triple-yang mice, double-yang mice and wild-type control mice, while a 275bp band was amplified in the triple-yang mice and double-yang mice using a specific primer pair (P2+P3), while no band was found in the wild-type control mice.

[0120] TG sgMettl3 The results of PCR electrophoresis of the genome were as follows Figure 5 As shown in Figure c, when a specific primer pair (primer I + primer II) was used, a 791 bp band was amplified in the triple positive mice, while no band was found in the double positive mice and wild-type control mice. sgMettl3 It is a transgenic gene, not a site-specific knock-in, so it is impossible to determine whether it is homozygous or heterozygous.

[0121] Example 5 Immunohistochemistry TG sgMettl3 Ltf Cre / + Rosa26 lslcas9 / + Expression of Cas9 and Mettl3 proteins in mouse uterine epithelium

[0122] 1. Experimental Methods

[0123] 1. Solution preparation: 4% paraformaldehyde fixative: Measure 4g paraformaldehyde and dissolve it in 10mL 1×PBS and 90mL distilled water. 10×PBS: Weigh 14.2g Na2HPO4, 14.2g KH2PO4, 2g KCL, 81.8g NaCl, add deionized water to 1L. 1×PBS: Measure 100mL and add distilled water to 1000mL. Sodium citrate antigen repair solution: Weigh 1.47g trisodium citrate dihydrate and 0.18g anhydrous sodium citrate, dissolve in 300mL distilled water, add distilled water to 500mL, and adjust the pH value to 6.0. EDTA antigen repair solution: Measure 50mL 50×Tris-EDTA antigen repair solution, add 490mL distilled water, and adjust the pH to 8.0. 3% hydrogen peroxide solution: 20mL hydrogen peroxide (30%) + 180mL methanol. Blocking solution (10% goat serum): 100μL blocking goat serum + 900μL 1×PBS. Ammonia water for blueing: 1mL ammonia water + 200mL distilled water. Hydrochloric acid for color separation: 20μL salt + 20mL distilled water. Weak hematoxylin stain: 1mL hematoxylin staining solution + 3mL 1×PBS. DAB colorimetric solution: 60μLDB colorimetric solution + A solution 1200μLDB colorimetric solution B.

[0124] 2. Slide processing:

[0125] To reduce the risk of slides falling off during immunohistochemical staining, the following treatment steps can be followed: Place the slides in the acid vat and let them soak overnight. Remove the slides and rinse them thoroughly in clean water, then soak them in distilled water overnight. Remove the slides from the distilled water and dry them, then place them one by one in anhydrous ethanol solution to which a few drops of hydrochloric acid have been added and continue to soak overnight. Remove the slides from the solution and wipe them clean with a silk cloth, then wrap the slides in tin foil and heat them in an oven preheated to 180°C for 6 hours. After heating, remove the slides from the oven and let them cool to room temperature, then soak the slides in a dye vat containing 40mL acetone and 0.8mL APES for 5 minutes. Finally, remove the slides from the dye vat and place them on a slide rack to dry for 2 minutes. Rinse with DEPC water three times, then dry the surface moisture and place the slide in a slide box. After thoroughly drying in an oven at 37°C, store it for later use.

[0126] 3. Establishment and sampling of early pregnancy model in mice:

[0127] Mice were caged together and plugs were found: the double positive female mice selected above were allowed to grow naturally to 9 weeks of age and caged together with wild-type mice. At 9 am the next day, the female mice were checked for plugs in the vagina. The presence of plugs indicated successful mating and was recorded as the first day of pregnancy.

[0128] Uterine sampling: On the fourth day of pregnancy, mice were anesthetized by injection of 0.3 mL, blood was collected from the orbits, and the mice were killed by cervical dislocation. Uterine samples were collected to observe the presence of corpora lutea and blastocysts with normal morphology to determine whether the pregnancy was successful.

[0129] On the eighth day of pregnancy, the mice were anesthetized and killed in the same way as on the fourth day, and uterine samples were collected to check whether there were embryo implantation sites in the uterus, which indicated successful pregnancy. The collected tissue samples needed to be fixed in 4% formaldehyde solution, or quickly frozen with liquid nitrogen and stored at -80°C for long-term storage.

[0130] 4. Tissue fixation and paraffin section preparation: After collecting the sample, the uterus first needs to be cut into segments of appropriate size and placed in a 4% formaldehyde solution, allowing it to remain in the fixative overnight for full fixation.

[0131] The samples were dehydrated by gradient alcohol treatment using a fully automatic tissue dehydrator: 50% (40 min), 70% (40 min), 80% (40 min), 90% (40 min), 100% (40 min), 100% (40 min), 1:1 mixture of alcohol and xylene (20 min), xylene I (10 min), xylene II (10 min), 1:1 mixture of xylene and paraffin (25 min).

[0132] Wax immersion and embedding: wax I (immersion in wax for 1 hour, add appropriate amount of beeswax), wax II (immersion in wax for 1 hour, obtained by filtering wax I), and finally use wax II to embed the sample.

[0133] Sectioning: The embedded uterine sample was fixed on a wooden block and trimmed into an appropriate trapezoidal shape to be fixed on the slicer. The slice thickness was set to 5 μm. After sectioning, it was placed on a slide with distilled water, flattened and fitted in a 40°C slide dryer, and then baked in the same temperature slide dryer overnight for subsequent storage and processing.

[0134] 5. Immunohistochemistry experiment:

[0135] The sample slices were placed on a 55°C slice oven and baked for 1 h.

[0136] Dewaxing and rehydration: xylene I (10 min), xylene II (10 min), 100% alcohol (5 min), 100% alcohol (5 min), 90% alcohol (5 min), 80% alcohol (5 min), 70% alcohol (5 min), 50% alcohol (5 min), deionized water (5 min).

[0137] Microwave antigen repair: This experiment uses microwave heating repair method, and the repair solution includes sodium citrate antigen repair solution (pH=6.0) and FDTA repair solution (pH=8.0). Heat the repair solution in a microwave oven at high heat for 5 minutes until it boils slightly, put in the tissue slices, and heat at low heat for 10 minutes. During this period, small bubbles will continue to appear slowly. If the bubbles are too large or the repair solution boils, turn off the heat in advance to avoid tissue damage. After the repair solution cools naturally to room temperature, take out the slices and wash them with 1×PBS for 5 minutes.

[0138] Immunohistochemistry pen circle drawing: Take out the sample slices, shake off the water, and use absorbent paper to absorb the water droplets. Then use a histochemical pen to draw a circle around the tissue, making the circle complete.

[0139] Endogenous peroxidase removal: The sections were incubated with 3% hydrogen peroxide (methanol: 30% hydrogen peroxide = 9:1) at room temperature for 10 min, and the sample sections were washed 3 times with 1× PBS, each wash for 5 min.

[0140] Serum blocking: Add 100-200 μL of 10% goat serum to the wax circle and place it in a 37°C oven for blocking for 1 hour.

[0141] Primary antibody incubation: discard the blocking solution and incubate with the corresponding antibody at 37°C overnight (more than 16 hours). The next day, recover the primary antibody and wash three times with 1× PBS, 5 minutes each time.

[0142] Secondary antibody incubation: Prepare goat anti-rabbit IgG solution in corresponding proportion and incubate at 37°C for 1 h.

[0143] Incubation with tertiary antibodies: discard the secondary antibody, wash with 1×PBS for 3 times, 5 min each time, prepare a corresponding proportion of horseradish peroxidase (HRP) solution, then incubate with tertiary antibodies and incubate in a 37°C oven for 30 min.

[0144] Color development: discard the three antibodies, wash 3 times with 1×PBS, 5 min each time, add color developing solution to the slices, develop color under a microscope, record the color development time, and put into deionized water after color development.

[0145] Restaining: stain with diluted hematoxylin for 1 min, rinse gently with deionized water, put in ammonia water to turn blue for 2 min, then put in deionized water for 1 min, then hydrochloric acid separation for 3 s, deionized water for 1 min, then put in ammonia water for 4 min, and finally put the sections in deionized water for 5 min.

[0146] Gradient dehydration: 50% alcohol (2 min), 70% alcohol (2 min), 80% alcohol (2 min), 90% alcohol (2 min), 100% alcohol (2 min), 100% alcohol (2 min), xylene I (3 min), xylene II (3 min).

[0147] Neutral gum sealing: After wiping the glass slide clean, add an appropriate amount of neutral resin, and then observe and photograph under a microscope after sealing.

[0148] Experimental results: The expression results of Cas9 are as follows Figure 6 As shown, the results of immunohistochemistry showed that there was no Cas9 protein expression signal in wild-type control mice, while in the uterus of triple-positive and double-positive mice, Cas9 was expressed in both the luminal epithelium and glandular epithelial tissues, and no Cas9 protein expression signal was detected in the matrix.

[0149] Mettl3 expression results Figure 7 As shown in the figure, in the uterus of double positive mice and wild-type control mice, Mettl3 expression signals were found in the luminal epithelium, glandular epithelium and stroma. In the uterus of triple positive mice, the expression signals of Mettl3 in the luminal epithelium and glandular epithelium were significantly downregulated. However, the expression level of Mettl3 in the stroma was not significantly different from that of double positive mice and wild-type control mice.

[0150] Therefore, the TG constructed by the present invention sgMettl3 TG obtained by crossing over-expressing transgenic mice with mice expressing Cas9 in the uterine epithelium sgMettl3 Ltf Cre / + Rosa26 lslcas9 / + Mice can knock down the expression of Mettl3 in the uterine epithelium.

[0151] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. An sgRNA targeting Mettl3, characterized in that The sgRNAs are sgRNA1 and sgRNA2, as shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

2. A DNA fragment containing the sgRNA targeting Mettl3 according to claim 1, characterized in that: The DNA fragment includes, from the 5' end to the 3' end, U6 promoter, sgRNA1, U6 promoter, sgRNA2, U6 promoter, sgGFP encoding gene shown in SEQ ID NO.3, CAG promoter encoding gene, mcherry encoding protein, SV40 poly (A) encoding gene, mcherry encoding protein, P2A peptide encoding gene, GFP encoding gene, and bGH poly (A) encoding gene.

3. A method for constructing TG sgMettl3 A method for overexpressing a transgenic mouse model, characterized in that The DNA fragment described in claim 2 is integrated into the mouse genome by using the PiggyBAC transposase system, and then obtained by genotype identification and screening.

4. A method for constructing a transgenic mouse with site-specific knockdown of Mettl3 protein expression, characterized in that: The following steps are involved: (1) Ltf Cre / + Mouse and Rosa26 lslcas9 / + The offspring of mice were obtained by hybridization and Ltf was obtained by genotyping and screening. Cre / + Rosa26 lslcas9 / + Mice; (2) The TG obtained in claim 3 sgMettl3 Overexpression of transgenic mice with Ltf Cre / + Rosa26 lslcas9 / + The mice were hybridized to obtain mouse offspring, and then transgenic mice with site-specific knockdown of Mettl3 protein expression were obtained through genotype identification and screening.

Images