Mutant sequence of rice OsABCD1 gene, method for regulating and controlling rice cadmium accumulation and application of mutant sequence

Abstract

The invention relates to a mutation sequence of a rice OsABCD1 gene as well as a method and application of the mutation sequence in regulation and control of rice cadmium accumulation. In particular to a mutant sequence of a rice OsABCD1 gene, a protein coded by the mutant sequence, a carrier, a transformant, a method for reducing cadmium accumulation in a rice plant and application of the method. According to the invention, gene mutation is carried out on a target site I of the rice OsABCD1 gene, so that the function of the gene is lost, and the accumulation of cadmium in rice is reduced; gene resources and technical support are provided for cultivation of rice varieties with the cadmium absorption content reduced, the problem that the cadmium content in rice exceeds the standard is effectively solved, and the important agricultural application value is achieved.

Description

Technical Field

[0001] The present disclosure relates to the technical field of rice genetic engineering, and in particular, to a mutant sequence of a rice OsABCD1 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in a rice plant, and applications thereof. Background Art

[0002] Rice is one of the most important food crops in the world, and its quality is closely related to human food security. Cadmium (Cd), as a transitional heavy metal element, is known as the "first of the five poisons" and is difficult to eradicate due to its accumulation, concealment and irreversibility. Cadmium accumulated in the edible parts of crops will be enriched in the human body through the food chain and cause a variety of diseases, posing a potential health threat to humans. Rice has a higher cadmium accumulation characteristic than other crops. With the rapid development of urban industrialization, the problem of excessive cadmium content in rice is becoming increasingly serious. At present, reports of excessive cadmium in rice grains are emerging in an endless stream. Studies have shown that in highly cadmium-contaminated soil, nearly 80% of rice has excessive cadmium content, posing a huge threat to human health. Different rice varieties have different cadmium absorption capacities. Therefore, breeding low-cadmium rice varieties is an effective strategy to reduce the cadmium content in rice. Low-cadmium rice varieties will not increase the additional cost of rice production and play an important role in soil pollution prevention and control.

[0003] The ABC transporter family, also known as ATP-binding cassette transporter, is one of the largest and oldest known protein superfamilies. ABC transporters have ATP binding domains and transmembrane structures. The family members are widely distributed in the cytoplasmic membrane, mitochondrial membrane, endoplasmic reticulum membrane, vacuole membrane and other locations. Their function is to transport substrates across the membrane, such as metal ions, secondary metabolites, lipids and other substances. They release energy for transmembrane transport of substances through the binding and hydrolysis of ATP. At present, the largest number of ABC transporters has been found in plants, with 133 in rice. The rice ABC family is divided into 8 subfamilies, ABCA~ABCI, of which the number of ABCG subfamily proteins is the largest. Studies have shown that OsABCG43, a member of this family, may be related to the transport of heavy metal Cd. However, there are few reports on the regulation of rice cadmium transport by other proteins in the ABC family. Therefore, finding target genes that can reduce the cadmium content in rice can provide genetic resources for rice low-cadmium breeding, which has important agricultural application value. Summary of the invention

[0004] In order to solve the problem of excessive cadmium in rice in the prior art, the purpose of the present invention is to screen genes and methods that can reduce cadmium in rice, and to cultivate rice varieties with reduced cadmium absorption content.

[0005] In order to achieve the above object, the present disclosure provides, in a first aspect, a mutant sequence of a rice OsABCD1 gene, wherein the mutant sequence is obtained by mutating the nucleotide sequence of the rice OsABCD1 gene; the mutation comprises substitution, deletion and / or addition of one or more nucleotides in the rice OsABCD1 gene; The nucleotide sequence of the rice OsABCD1 gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCD1 gene is shown as SEQ ID NO: 2.

[0006] Optionally, the mutant sequence is selected from at least one of the following sequences: (1) a nucleotide sequence as shown in SEQ ID NO: 3 obtained by inserting base A between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene; (2) a nucleotide sequence as shown in SEQ ID NO: 5 obtained by inserting base C between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene; (3) A nucleotide sequence as shown in SEQ ID NO: 7 obtained by deleting the fragment AAAGCAC from position 4 to position 10 of the sequence of target site I of the rice OsABCD1 gene; (4) A nucleotide sequence as shown in SEQ ID NO: 9 obtained by deleting the fragment AAAG from position 4 to position 7 of the sequence of target site I of the rice OsABCD1 gene; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:11.

[0007] The second aspect of the present disclosure provides a protein encoded by the mutant sequence of the first aspect, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and / or SEQ ID NO: 10.

[0008] The third aspect of the present disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:11.

[0009] The fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the target site I is introduced into the transformant, or the vector described in the third aspect is introduced into the transformant; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:11.

[0010] A fifth aspect of the present disclosure provides a method for reducing cadmium accumulation in rice plants, the method comprising: By editing the rice OsABCD1 gene, the nucleotide sequence of the rice OsABCD1 gene was mutated, and the protein encoded by the OsABCD1 gene was changed; The mutation comprises substitution, deletion and / or addition of one or more nucleotides in the rice OsABCD1 gene.

[0011] Optionally, the gene editing method comprises: S1. Design of CRISPR / Cas9 editing vector based on target site Ⅰ of rice OsABCD1 gene; S2. The CRISPR / Cas9 editing vector is infected into rice plants through Agrobacterium, and mutations are randomly made at the target site I in the rice plants. Then, the designed primers are used for detection to screen T0 generation positive plants with functional defect mutations. S3, self-pollinating the T0 generation positive plants, screening and obtaining T1 generation homozygous mutant plants, and obtaining rice plants with reduced cadmium content; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO: 11; The sequences of the primers are shown in SEQ ID NO:12 and SEQ ID NO:13.

[0012] Optionally, in step S2, the mutation includes one of the following: (a) inserting base A between the 6th and 7th bases of the sequence of target site Ⅰ of rice OsABCD1 gene; (b) inserting base C between bases 6 and 7 of the sequence of target site Ⅰ of rice OsABCD1 gene; (c) deleting the fragment AAAGCAC from position 4 to position 10 of the sequence of target site Ⅰ of rice OsABCD1 gene; (d) The fragment AAAG from position 4 to position 7 of the sequence of target site I of the rice OsABCD1 gene is deleted.

[0013] A sixth aspect of the present disclosure provides applications of rice OsABCD1 genes and proteins encoded by rice OsABCD1 genes in regulating cadmium accumulation in rice and cultivating rice varieties with reduced cadmium absorption content.

[0014] The seventh aspect of the present disclosure provides the use of the rice OsABCD1 gene of the first aspect, the protein of the second aspect, the vector of the third aspect or the transformant of the fourth aspect in regulating cadmium accumulation in rice and cultivating rice varieties with reduced cadmium absorption content.

[0015] Through the above technical scheme, the present invention causes the loss of function of the gene by performing gene mutation on the target site I of the rice OsABCD1 gene, thereby reducing the accumulation of cadmium in rice; it provides genetic resources and technical support for the cultivation of rice varieties with reduced cadmium absorption content, effectively improves the problem of excessive cadmium content in rice, and has important agricultural application value.

[0016] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 It is obtained using CRISPR / Cas9 osabcd1-1 , osabcd1-2, osabcd1-3 and osabcd1-4 Genotyping diagram of mutants and wild type.

[0018] Figure 2 It's gene-edited rice osabcd1-1 and osabcd1-2 Results of cadmium content detection in mutants and wild type (WT). DETAILED DESCRIPTION

[0019] The specific implementation of the present disclosure is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present disclosure, and is not used to limit the present disclosure.

[0020] In a first aspect, the present disclosure provides a mutant sequence of a rice OsABCD1 gene, wherein the mutant sequence is obtained by mutating the nucleotide sequence of the rice OsABCD1 gene; the mutation comprises substitution, deletion and / or addition of one or more nucleotides in the rice OsABCD1 gene; The nucleotide sequence of the rice OsABCD1 gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCD1 gene is shown as SEQ ID NO: 2.

[0021] In the present disclosure, the inventors of the present disclosure surprisingly found that the OsABCD1 (accession number: LOC_Os01g11946) gene can regulate the accumulation of cadmium in rice. The present disclosure reduces the accumulation of cadmium in rice by mutating the target site I of the rice OsABCD1 gene to cause the gene to lose its function.

[0022] In a specific embodiment of the present disclosure, the mutant sequence is selected from at least one of the following sequences: (1) a nucleotide sequence as shown in SEQ ID NO: 3 obtained by inserting base A between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene; (2) a nucleotide sequence as shown in SEQ ID NO: 5 obtained by inserting base C between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene; (3) A nucleotide sequence as shown in SEQ ID NO: 7 obtained by deleting the fragment AAAGCAC from position 4 to position 10 of the sequence of target site I of the rice OsABCD1 gene; (4) A nucleotide sequence as shown in SEQ ID NO: 9 obtained by deleting the fragment AAAG from position 4 to position 7 of the sequence of target site I of the rice OsABCD1 gene; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:11.

[0023] In the present disclosure, the inventors of the present disclosure designed an editing vector according to target site I, infected the vector into rice plants through Agrobacterium, randomly mutated at the target site in the rice plant, and then performed mutant sequence detection according to the designed primers, and selected mutant strains with base A or C insertion and AAAGCAC fragment or AAAG fragment deletion. The base A or C was inserted into the sequence of target site I, resulting in corresponding changes in the codon order and composition after the inserted base site, the stop codon appeared prematurely, and the protein function changed; or, the AAAGCAC fragment or AAAG fragment was deleted, resulting in a change in the open reading frame, premature termination of protein translation, and change in protein function.

[0024] The second aspect of the present disclosure provides a protein encoded by the mutant sequence of the first aspect, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and / or SEQ ID NO: 10.

[0025] According to the present disclosure, the nucleotide sequence shown in SEQ ID NO:3 encodes the protein shown in SEQ ID NO:4; the nucleotide sequence shown in SEQ ID NO:5 encodes the protein shown in SEQ ID NO:6; the nucleotide sequence shown in SEQ ID NO:7 encodes the protein shown in SEQ ID NO:8; and the nucleotide sequence shown in SEQ ID NO:9 encodes the protein shown in SEQ ID NO:10.

[0026] The third aspect of the present disclosure provides a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:11.

[0027] The fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the target site I is introduced into the transformant, or the vector described in the third aspect is introduced into the transformant; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:11.

[0028] In the present disclosure, the host cell of the transformant may be a genetically engineered bacterium, and preferably, the genetically engineered bacterium may be Agrobacterium EHA105.

[0029] A fifth aspect of the present disclosure provides a method for reducing cadmium accumulation in rice plants, the method comprising: By editing the rice OsABCD1 gene, the nucleotide sequence of the rice OsABCD1 gene was mutated, and the protein encoded by the OsABCD1 gene was changed; The mutation comprises substitution, deletion and / or addition of one or more nucleotides in the rice OsABCD1 gene.

[0030] In the present disclosure, gene editing is performed on the rice OsABCD1 gene to change the protein encoded by the OsABCD1 gene, thereby causing the OsABCD1 gene to lose its function, which is beneficial for cultivating rice varieties with reduced cadmium absorption content, and the problem of excessive cadmium content in rice is solved.

[0031] In a specific embodiment of the present disclosure, the gene editing method comprises: S1. Design of CRISPR / Cas9 editing vector based on target site Ⅰ of rice OsABCD1 gene; S2. The CRISPR / Cas9 editing vector is infected into rice plants through Agrobacterium, and mutations are randomly made at the target site I in the rice plants. Then, the designed primers are used for detection to screen T0 generation positive plants with functional defect mutations. S3, self-pollinating the T0 generation positive plants, screening and obtaining T1 generation homozygous mutant plants, and obtaining rice plants with reduced cadmium content; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO: 11; The sequences of the primers are shown in SEQ ID NO:12 and SEQ ID NO:13.

[0032] In a preferred embodiment of the present disclosure, in step S2, the mutation includes one of the following: (a) inserting base A between the 6th and 7th bases of the sequence of target site Ⅰ of rice OsABCD1 gene; (b) inserting base C between bases 6 and 7 of the sequence of target site Ⅰ of rice OsABCD1 gene; (c) deleting the fragment AAAGCAC from position 4 to position 10 of the sequence of target site Ⅰ of rice OsABCD1 gene; (d) The fragment AAAG from position 4 to position 7 of the sequence of target site I of the rice OsABCD1 gene is deleted.

[0033] A sixth aspect of the present disclosure provides applications of rice OsABCD1 genes and proteins encoded by rice OsABCD1 genes in regulating cadmium accumulation in rice and cultivating rice varieties with reduced cadmium absorption content.

[0034] The seventh aspect of the present disclosure provides the use of the rice OsABCD1 gene of the first aspect, the protein of the second aspect, the vector of the third aspect or the transformant of the fourth aspect in regulating cadmium accumulation in rice and cultivating rice varieties with reduced cadmium absorption content.

[0035] In the present disclosure, by mutating the rice OsABCD1 gene and changing the structure and function of the protein encoded by the rice OsABCD1 gene, the cadmium content in the rice grains of the obtained mutant plants is significantly reduced, indicating that the rice OsABCD1 gene can effectively reduce the cadmium content in the rice grains after mutation. Cultivating rice varieties with reduced cadmium absorption content using the mutant of the rice OsABCD1 gene has potential application value in agricultural applications.

[0036] The present disclosure is further described in detail below through examples.

[0037] The raw materials used in the examples can be obtained from commercial sources. If no specific experimental conditions are specified in the examples, they are all based on conventional conditions known to those skilled in the art.

[0038] Example 1 This example is used to illustrate rice osabcd1 Obtaining mutants.

[0039] In order to study the function of rice OsABCD1 gene, CRISPR / Cas9 technology was used to site-specifically edit the nucleotide sequence of target site Ⅰ of rice OsABCD1 gene as shown in SEQ ID NO: 1. The sequence of target site Ⅰ was: GCCAAAGCACGTAACAAAG (SEQ ID NO: 11).

[0040] Specific methods include: 1. Construction of CRISPR / Cas9 recombinant vector: (1) Sequence comparison analysis was performed using the NCBI database to search for homologous genes of the Arabidopsis thaliana OsABCD1 gene in rice using the gene sequence. A homologous gene was found in the rice genome and we named the gene OsABCD1 (SEQ ID NO: 1). The nucleotide coding region (CDS) sequence is shown in SEQ ID NO.1 and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0041] (2) Design target sites of the OsABCD1 gene in the rice genome, and analyze the target site I of the OsABCD1 gene mutation: GCCAAAGCACGTAACAAAG. Design a CRISPR / Cas9 editing vector based on target site I, infect the vector into rice plants through Agrobacterium, and mutate the target site I in the rice plants; Figure 1 Bases A and C were inserted into the sequence of target site I, respectively, to delete the AAAGCAC fragment or the AAAG fragment in target site I, and four types of mutated editing vectors were obtained.

[0042] 2. Obtain pure and transgenic rice: (1) The japonica rice variety Nipponbare was used as the recipient material for transformation, and the T0 generation of transgenic rice plants was obtained using the Agrobacterium-mediated rice callus genetic transformation method.

[0043] PCR amplification was performed using two pairs of primers GP2091-2079-F: ACGAAGGGTTCCCAAAACCA (SEQ ID NO: 12); and GP2091-2079-R: AACACCCAGGAGTGGAAACA (SEQ ID NO: 13) to amplify a fragment containing the target site. After gel excision and recovery, sequencing was performed to detect plants with mutations at the target site.

[0044] (2) The results showed that the T0 transgenic plants contained OsABCD1, and the target site Ⅰ of the OsABCD1 gene had an A base inserted into the target site Ⅰ ( osabcd1-1 , SEQ ID NO: 3), C base inserted into target site Ⅰ ( osabcd1-2 , SEQ ID NO: 5), with AAAGCAC fragment deletion ( osabcd1-3 , SEQ ID NO: 7) or having a deletion of the AAAG fragment ( osabcd1-4 , SEQ ID NO: 9), causing the stop codon to appear prematurely to terminate translation, resulting in osabcd1-1, osabcd1-2, osabcd1-3 and osabcd1-4 The function of the OsABCD1 gene in the mutant is altered.

[0045] (3) Harvest osabcd1-1 and osabcd1-2 The seeds of the functional defective homozygous mutant were propagated for the next generation, and mixed DNA samples were taken from the T1 generation homozygous mutant seedlings for sequencing and identification. The results showed that all T1 generation plants were homozygous mutant plants. The harvested seeds were T1 generation gene-edited rice, and the cadmium content of the grains (brown rice) of the T1 generation homozygous mutant plants was determined. The results are as follows: Figure 2 As shown, "**" indicates that compared with the wild type, p <0.01; “*” indicates that compared with the wild type, p <0.05; “***” indicates that compared with the wild type, p <0.001. Figure 2 It can be seen that osabcd1-1 and osabcd1-2 The cadmium content in the grains (brown rice) of functionally defective homozygous mutant rice was significantly increased or decreased compared with that of wild-type rice.

[0046] The results show that mutating the rice OsABCD1 gene using gene editing methods can reduce the cadmium content in the grains, providing a new idea for breeding rice varieties with reduced cadmium absorption content.

[0047] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0048] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0049] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A mutant sequence of rice OsABCD1 gene, characterized in that: The mutant sequence is obtained by mutating the nucleotide sequence of the rice OsABCD1 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCD1 gene; The nucleotide sequence of the rice OsABCD1 gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCD1 gene is shown as SEQ ID NO:

2.

2. The mutant sequence according to claim 1, wherein The mutant sequence is selected from at least one of the following sequences: (1) a nucleotide sequence as shown in SEQ ID NO: 3 obtained by inserting base A between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene; (2) a nucleotide sequence as shown in SEQ ID NO: 5 obtained by inserting base C between the 6th and 7th bases of the sequence of target site I of the rice OsABCD1 gene; (3) A nucleotide sequence as shown in SEQ ID NO: 7 obtained by deleting the fragment AAAGCAC from position 4 to position 10 of the sequence of target site I of the rice OsABCD1 gene; (4) A nucleotide sequence as shown in SEQ ID NO: 9 obtained by deleting the fragment AAAG from position 4 to position 7 of the sequence of target site I of the rice OsABCD1 gene; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:

11.

3. The protein encoded by the mutant sequence according to claim 1 or 2, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 and / or SEQ ID NO:

10.

4. A carrier, characterized in that The vector is a CRISPR / Cas9 editing vector, the vector has a target site I inserted therein, and produces a mutant sequence as described in claim 1 or 2; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:

11.

5. A transformant, characterized in that: The host of the transformant is a genetically engineered bacterium; the target site I is introduced into the transformant, or the vector according to claim 4 is introduced into the transformant; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO:

11.

6. A method for reducing cadmium accumulation in rice plants, characterized in that: The method includes: By editing the rice OsABCD1 gene, the nucleotide sequence of the rice OsABCD1 gene was mutated, and the protein encoded by the OsABCD1 gene was changed; The mutation comprises substitution, deletion and / or addition of one or more nucleotides in the rice OsABCD1 gene.

7. The method according to claim 6, wherein: The gene editing method comprises: S1. Design of CRISPR / Cas9 editing vector based on target site Ⅰ of rice OsABCD1 gene; S2. The CRISPR / Cas9 editing vector is infected into rice plants through Agrobacterium, and mutations are randomly made at the target site I in the rice plants. Then, the designed primers are used for detection to screen T0 generation positive plants with functional defect mutations. S3, self-pollinating the T0 generation positive plants, screening and obtaining T1 generation homozygous mutant plants, and obtaining rice plants with reduced cadmium content; Wherein, the nucleotide sequence of the target site I is shown in SEQ ID NO: 11; The sequences of the primers are shown in SEQ ID NO:12 and SEQ ID NO:

13.

8. The method according to claim 7, wherein: In step S2, the mutation includes one of the following: (a) inserting base A between the 6th and 7th bases of the sequence of target site Ⅰ of rice OsABCD1 gene; (b) inserting base C between bases 6 and 7 of the sequence of target site Ⅰ of rice OsABCD1 gene; (c) deleting the fragment AAAGCAC from position 4 to position 10 of the sequence of target site Ⅰ of rice OsABCD1 gene; (d) The fragment AAAG from position 4 to position 7 of the sequence of target site I of the rice OsABCD1 gene is deleted.

9. Application of rice OsABCD1 gene and the protein encoded by rice OsABCD1 gene in regulating cadmium accumulation in rice and cultivating rice varieties with reduced cadmium absorption content.

10. Use of the rice OsABCD1 gene according to claim 1 or 2, the protein according to claim 3, the vector according to claim 4 or the transformant according to claim 5 in regulating cadmium accumulation in rice and cultivating rice varieties with reduced cadmium absorption content.

Images