Application of CtANR3 gene in breeding new safflower lines with high content of yellow pigment

By overexpressing or transiently silencing the CtANR3 gene in safflower, the yellow pigment synthesis pathway was regulated, solving the problem of insufficient yellow pigment content in safflower and achieving a significant increase in yellow pigment content, thus meeting the application needs of natural pigments.

CN119120515BActive Publication Date: 2025-12-12SHIHEZI UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411594736.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-10
Publication Date
2025-12-12
Estimated Expiration
2044-11-10

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively increase the content of safflower yellow pigment, affecting its application potential in traditional Chinese medicine, food, and cosmetics.

Method used

By introducing the CtANR3 gene and using genetic engineering technology to construct new safflower varieties, the overexpression or transient silencing of the CtANR3 gene can be achieved, thereby regulating the synthesis pathway of safflower yellow pigment and increasing the yellow pigment content.

Benefits of technology

It significantly increased the content of safflower yellow pigment, meeting the needs of natural pigments in traditional Chinese medicine, food, and cosmetics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses application of a CtANR3 gene in cultivating a new safflower strain with high content of yellow pigment, and belongs to the technical field of molecular biology. CtANR3 The full-length sequence of the coding region is 1014 bp, and is named as CtANR3 It is found through research that after the safflower CtANR3 gene is transiently silenced, the content of yellow pigment of the safflower is significantly reduced; the safflower CtANR3 gene plant expression vector is constructed, is transfected into safflower varieties, and the content of yellow pigment of the safflower overexpressing the gene is significantly increased.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a CtANR3 gene and application of the CtANR3 gene in increasing content of safflower yellow. BACKGROUND

[0002] In recent years, with the enhancement of people's health consciousness, the demand for natural pigments gradually increases. As an important medicinal plant and food colorant, safflower (Carthamus tinctorius L.) has important pharmacological activities and is widely concerned due to the rich yellow pigment in its petals. Safflower yellow is one of the main components of safflower, has various pharmacological effects such as antioxidant, anti-inflammatory and hypolipidemic, and is widely used in traditional Chinese medicine, food, cosmetics and other fields. SUMMARY

[0003] The application aims to increase the content of safflower yellow, and provides a CtANR3 gene and application of the CtANR3 gene in increasing the content of safflower yellow.

[0004] A CtANR3 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1 of the sequence listing;

[0005] A plasmid pGreenIISK-CtANR3 is obtained by inserting the CtANR3 gene into pGreenIISK.

[0006] The application of the safflower CtANR3 gene in increasing the content of safflower yellow.

[0007] The application provides application of the CtANR3 gene in cultivating a new safflower strain with high content of yellow pigment, and belongs to the technical field of molecular biology. The cDNA obtained by reverse transcription of RNA of Ji Hong No. 1 safflower petals at the flowering stage is used as a template, and specific primers are used for amplification to obtain a full-length sequence of 1023 bp of a coding region, which is named as CtANR3. It is found through research that the content of yellow pigment significantly decreases after transient silencing of the safflower CtANR3 gene, the constructed safflower CtANR3 gene plant expression vector significantly increases the content of yellow pigment in the safflower variety by overexpressing the CtANR3 gene. BRIEF DESCRIPTION OF DRAWINGS

[0008] Figure 1 Hydroxysafflor yellow A standard control solution;

[0009] Figure 2 Content of safflower yellow in the M6 strain;

[0010] Figure 3 Content of safflower yellow in the M35 strain;

[0011] Figure 4 Figure 2 Electrophoresis result of RNA extraction of safflower petals of Jihong No. 1 variety;

[0012] Figure 5C PCR electrophoresis map of CtANR3 gene;

[0013] Figure 6 Expression amount of CtANR3 gene in two strains;

[0014] Figure 7 Bacterial liquid PCR identification of CtANR3 gene;

[0015] Figure 8 Transient silencing of safflower CtANR3 gene and determination of safflower yellow pigment content;

[0016] Figure 9 Transient overexpression of safflower CtANR3 gene and determination of safflower yellow pigment. DETAILED DESCRIPTION

[0017] Example 1 HPLC analysis of safflower yellow pigment content of safflower strains obtained by mutagenesis treatment of Jihong No. 1 safflower variety

[0018] 1) Materials

[0019] Through cobalt 60 mutagenesis technology, 42 genetically stable safflower strains were obtained by mutagenesis treatment of Jihong No. 1 safflower variety; the petals of different strains of safflower were selected as the research object, 0.1 gram of safflower petals of each strain was taken and treated by high-speed grinder.

[0020] 2) Extraction of safflower yellow pigment

[0021] According to the sample, 1.4 times the amount of water was added; under the condition of 55℃, ultrasonic extraction was carried out for 30 minutes, and the ultrasonic power was 200W. This step was repeated twice. The extract was filtered with 0.22 µm nylon membrane, and the upper liquid phase was collected for analysis.

[0022] 3) HPLC analysis of safflower yellow pigment content

[0023] Agilent XDB-C18 chromatographic column (250 mm x 4.6 mm, 5 µm) was used; 0.4% formic acid (A)-methanol (B) was used as the mobile phase, and the proportion was 7:3.

[0024] The detection wavelength was 402 nm; the flow rate was 1 mL / min; and the column temperature was 25℃.

[0025] As Figure 1 , 2The M6 strain has the highest content of safflor yellow, which is 33.7642-48.5638 mg / g, and the M35 has the lowest content of safflor yellow, which is 0.6468-0.9842 mg / g.

[0026] Example 2 Cloning of the coding region sequence of CtANR3 gene

[0027] 1. Safflower petal RNA extraction

[0028] 1) Scissors, mortar, pestle and spatula were wrapped with tin foil paper and dried in a 180℃ oven for 4h for sterilization;

[0029] 2) 1.5mL centrifuge tubes and pipette tips were treated with 0.1% DEPC overnight, then autoclaved at 120℃ for 20min, and dried in a 60℃ oven for standby;

[0030] 3) About 100mg of safflower petals were taken and ground into fine powder with liquid nitrogen, and then divided into two 1.5mL EP tubes, each added with 1mL of RNAiso Plus and mixed evenly, and then placed at room temperature for 5min;

[0031] 4) Centrifuged at 12000rpm for 5min at 4℃, and the supernatant was transferred to a new 1.5mL centrifuge tube;

[0032] 5) Added chloroform with a volume of 1 / 5 of the RNAiso Plus, and then mixed and shaken, and then placed at room temperature for 5min;

[0033] 6) Centrifuged at 12000rpm for 15min at 4℃, and the supernatant was transferred to a new 1.5mL centrifuge tube;

[0034] 7) Added isopropanol with the same volume as the supernatant, and then placed at room temperature for 10min, and then centrifuged at 12000rpm for 10min at 4℃;

[0035] 8) Discarded the supernatant and reserved the precipitate, and then added 1mL of 75% ethanol to wash the precipitate, and then centrifuged at 12000rpm for 5min at 4℃, and this step was repeated once;

[0036] 9) Discarded the supernatant and reserved the precipitate, and then dried at room temperature;

[0037] 10) The extracted RNA was dissolved with RNA-Free water, and then stored at -80℃ for standby.

[0038] 11) The concentration of total RNA sample of safflower was determined by NanoDrop2000 ultramicro spectrophotometer (purchased from Thermo company).

[0039] 12) The purity of RNA was detected by 2% agarose gel electrophoresis, and after electrophoresis, it was stained with nucleic acid dye and photographed on the ultraviolet gel imaging system. The total RNA extraction of safflower petals is shown in Figure 4 , and Figure 1 It can be seen that there are two clear bands of 28S and 18S, and the brightness of 28S band is about 2 times of 18S. It shows that the RNA extraction is complete and there is no degradation, which can meet the needs of subsequent experiments.

[0040] 2, Synthesis of the first strand cDNA

[0041] Take the RNA stored at-80℃, detect the concentration of RNA by nanogrop, and the concentration of extracted RNA is about 1000 ng / ul. According to the operation instruction of reverse transcription kit, carry out reverse transcription of cDNA, and the reverse transcription reaction system is shown in table 1 and table 2. The cDNA after reverse transcription is stored in-20℃ refrigerator for standby.

[0042] Table 1 First round reverse transcription reaction system

[0043] ;

[0044] Carry out the following reaction on PCR instrument: 65℃, 5min, quickly cool on ice.

[0045] Table 2 Second round reverse transcription reaction system

[0046] ;

[0047] Reverse transcription reaction conditions

[0048] 42℃ 55min

[0049] 70℃ 10min

[0050] Cool on ice, get cDNA for subsequent reaction, and store at-20℃ for standby.

[0051] 3, Cloning of CtANR3 gene coding region sequence

[0052] The previous genome sequencing of safflower was carried out by the research group, and the CtANR3 (anthocyanidin reductase) gene of safflower was annotated. The specific primers were designed according to the coding region sequence annotated in the genome, and RT-PCR amplification was carried out, and the cloning primers were designed as follows:

[0053] CtANR3f: ATGGAAGAGAGTAAAAGCAGC

[0054] CtANR3f: TCACGATCTCTTAGCACATTC

[0055] The cDNA obtained by reverse transcription of the RNA of the petals of Crocus sativus L. at the red flower stage was used as a template for amplification. The amplification product was connected with a pEASY-T1 (Beijing Zison Gold Biotechnology Co., Ltd.) cloning vector, and the DH5a E. coli competent cells were transformed. After correct verification by bacterial liquid PCR (PCR, polymerase chain reaction), the correct sequencing was sent for sequencing. The full-length sequence of the coding region was 1023 bp, and was named CtANR3. The base sequence is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2. Figure 5

[0056] Example 3 Expression analysis of the CtANR3 gene in two strains

[0057] The total RNA of the petals of two strains of Crocus sativus L. M6 and M35 was extracted, and the first strand cDNA template was synthesized by reverse transcription. The fluorescence quantitative PCR primer of the CtANR3 gene was designed by using the primer design online website (http: / / www.primer3plus.com / cgi-bin / dev / primer3plus.cgi). The TB Green® Premix Ex Taq™ (TaKaRa) kit was used for the fluorescence quantitative PCR reaction, and the reaction system is shown in Table 3. The fluorescence quantitative machine used was Agilent Mx3000P, and the relative expression amount was calculated by using the method of 2 -△△Ct . Each sample was repeated for 3 times. The results showed that the expression amount of the CtANR3 gene in the M6 strain was significantly higher than that in the M35 strain (see Figure 6 ).

[0058] Table 3 qRT-PCR reaction system

[0059] Tab.3 qRT-PCR reaction system

[0060] Reagent Amount TB Green Premix Ex Taq (2x) 10 μL PCR Forward Primer (10 μM) 0.4 μL PCR Reverse Primer (10 μM) 0.4 μL ROX Reference Dye II (50X) 0.4 μL cDNA 1 μL RNase Free dH2O Up to 20 μL

[0061] The reaction program used Normal 2 step, and was as follows:

[0062] Example 4 Construction of the plant expression vector of the CtANR3 gene of Crocus sativus L.

[0063] ​The CtANR3 coding region fragment containing Xho I and Hind III enzyme digestion sites was amplified by TransStart® FastPfu Fly DNA Polymerase (Beijing Zoman Biotech Co., Ltd.), and pTRV2 and pGreenIISK vectors containing Flashcut™ Xho I and Flashcut™ Hind III (Monarq (Wuhan) Biotech Co., Ltd.) were single-digested, and purified by a DNA purification kit (Tiangen Biotech (Beijing) Co., Ltd.). The target fragment was ligated with the linearized vector using a single fragment seamless cloning kit (Monarq (Wuhan) Biotech Co., Ltd.), and the ligation product was transformed into E. coli DH5α competent cells. The transformants were screened on kanamycin (50 mg / L)-containing resistance plates, and single colonies were inoculated and shaken, and then the bacterial liquid was identified by PCR Figure 7 ), and both had the target band, indicating that the expression vector was successfully constructed, and was named pTRV2-CtANR3 and pGreenIISK-CtANR3.

[0064] Example 5 Transformation of Agrobacterium competent cells

[0065] The target gene was transformed into Agrobacterium by freeze-thaw method, and the process was as follows:

[0066] 1) Add 1 µl pTRV2-CtANR3, pGreenIISK-CtANR3 plasmid DNA to 100 µl Agrobacterium EHA105 competent cells, and store in liquid nitrogen for 5 min;

[0067] 2) Quickly place it in a 37℃ water bath and heat shock for 5 min;

[0068] 3) Add 1 ml of fresh YEP culture solution to the centrifuge tube and shake on a 28℃ shaker for 2-4 hours;

[0069] 4) Take 50 μl-100 μl of transformed bacterial liquid and spread on solid LB plates containing 50 μg / ml kan+100 μg / ml Rif, and incubate in a 28℃ incubator for 2-3 days to screen the transformants;

[0070] 5) Pick single colonies and inoculate in Agrobacterium liquid medium, and incubate at 28℃ until OD600≈0.8, take 1 μl of bacterial liquid for PCR detection, the method is the same as above;

[0071] 6) The remaining bacterial liquid was quickly frozen in liquid nitrogen and then stored at -80℃ for standby after being mixed with glycerol at 4:1 (V:V).

[0072] Example 6 Silencing of Safflower CtANR3 Gene and Determination of Yellow Pigment Content

[0073] TRV1 and TRV2 are formed from two strands of originally complementary double-stranded RNA. Among them, TRV1 can enhance the replication and spread of TRV2, playing an auxiliary role. When TRV1 and TRV2 are mixed, the partially complementary strands can form double-stranded RNA, which is more stable. The mixed double-stranded RNA can better replicate and spread in plant cells, thereby realizing gene interference. Therefore, in the experiment, we usually take pTRV1 + pTRV2 as the control group, and pTRV1 + pTRV2- target gene as the experimental group.

[0074] The agrobacterium liquid containing pTRV1, pTRV2, pTRV2-CtANR3 plasmid was cultured to OD600=0.8-1.0, 5000 rpm centrifuged to collect the bacterial body, and the bacterial body was resuspended to OD600=0.8 with buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6). pTRV1 was mixed with pTRV2 and pTRV2-CtANR3 agrobacterium suspension 1:1, respectively, and activated at 28°C in the dark for 3 h. The leaf blades near the flower buds were injected using a syringe. The red flower plants were grown in the dark for 1 day, and then moved to the artificial climate room for 10 days. 0.1 g of petals from the control and experimental groups were injected, and the petals were extracted with 14 times water for 3 times, and the supernatant was combined and filtered through a 0.22 μm filter membrane to detect the content of yellow pigment. It was found that the content of yellow pigment decreased significantly after transient silencing Figure 8 ).

[0075] Example 7 Overexpression of CtANR3 gene of Crocus sativus and determination of saffron yellow pigment

[0076] The agrobacterium liquid containing pGreenIISK, pGreenIISK-CtANR3 plasmid was cultured to OD600=0.8-1.0, 5000 rpm centrifuged to collect the bacterial body, and the bacterial body was resuspended to OD600=0.8 with buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6), and activated at 28°C in the dark for 3 h. The pGreenIISK and pGreenIISK-CtGRF5 agrobacterium suspensions were injected into the flower buds and nearby leaves of Crocus sativus, respectively. The red flower plants were grown in the dark for 1 day, and then moved to the artificial climate room for 8 days. The yellow pigment in the injected leaves was extracted. It was found that the content of saffron yellow pigment increased significantly after transient overexpression Figure 9 ).

Claims

1. Application of CtANR3 gene with nucleotide sequence as shown in SEQ ID NO. 1 in improving content of hydroxysafflor yellow A in safflower varieties.