Short hairpin ribonucleic acid (shRNA) expression system based on parainfluenza virus 5 type L strain PIV5-L and application of shRNA expression system

Abstract

The invention discloses a recombinant plasmid L-GFPshCtrl, the sequence of which is as shown in SEQ ID NO.9, and a recombinant plasmid L-GFP-shCtrl, the sequence of which is as shown in SEQ ID NO.10. The invention also discloses a preparation method of the recombinant plasmid L-GFPshCtrl. Based on the two recombinant plasmids, two different L-RNAi systems are respectively constructed to deliver shRNA: one is that amiRNA is connected to the 3'end of irrelevant mRNA to jointly serve as a transcript, namely an L-GFPshRNA system; according to one method, shRNA is used as a single transcript by utilizing transcription termination and initiation signals of PIV5-L, namely an L-GFP-shRNA system. On the basis of the two different L-RNAi delivery systems constructed by the invention, the UBR5 is taken as a target spot, shUBR5 is used for replacing shCtrl in a recombinant plasmid L-GFPshCtrl or L-GFP-shCtrl by virtue of a seamless cloning technology, and the recombinant plasmid L-GFPshUBR5 or L-GFP-shUBR5 is constructed; the L-GFPshUBR5 or the L-GFP-shUBR5 system can be used for effectively down-regulating the protein expression of the UBR5 in a breast cancer cell strain MDAMB231 and a B lymphoma cell strain DG75.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a shRNA expression system based on parainfluenza virus type 5 L strain PIV5-L and an application thereof. Background Art

[0002] RNA interference (RNAi) is a process in which small interfering RNA (siRNA) or endogenous microRNA (miRNA) downregulates gene expression at the post-transcriptional level by degrading complementary mRNA and / or inhibiting its translation. By artificially introducing siRNA of the target gene into the target cell, the expression of the target gene can be effectively inhibited. There are three main RNA interference strategies currently used: direct synthesis of siRNA in vitro, delivery of short hairpin RNA (shRNA) or artificial miRNA (amiRNA) through vectors. AmiRNA is the most commonly used siRNA delivery strategy in RNAi technology because it is more "natural" and safer, can simulate the process of siRNA production in the body, and has almost no effect on the body's own miRNA synthesis. Many studies have optimized the design of amiRNA based on the biosynthesis process of miRNA, from multiple aspects such as the pri-miRNA backbone, the length of the stem and flanking sequences, the selection of siRNA sequence and vector, and the insertion position in the vector.

[0003] Nucleic acid shearing mediated by RNAi technology can effectively achieve gene expression regulation and is widely used in the study of gene function and disease treatment methods. However, in the in vitro or in vivo application of RNAi technology, a safe, efficient and universal delivery platform remains the biggest challenge. For RNAi technology, the current common delivery vectors are still viral vectors, such as adenoviruses (Ads), lentiviruses and adeno-associated viruses. However, due to the difficulty of infecting some cell lines or the low infection rate, as well as safety issues in clinical trials, an efficient, universal and safe RNAi delivery system remains to be explored. Summary of the invention

[0004] The purpose of the present invention is to solve the problem of low efficiency of RNAi delivery systems in the prior art, and to provide a shRNA expression system and application based on parainfluenza virus type 5 L strain PIV5-L, which can effectively achieve target gene knockdown by transcribing shRNA alone or together with GFP gene as a transcript.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows: the recombinant plasmid L-GFPshCtrl, the sequence of which is shown in SEQ ID NO.9.

[0006] The present invention also provides a recombinant plasmid L-GFP-shCtrl, the sequence of which is shown in SEQ ID NO.10.

[0007] The present invention also provides a shRNA expression system based on parainfluenza virus type 5 L strain PIV5-L, comprising the above-mentioned recombinant plasmid L-GFPshCtrl or recombinant plasmid L-GFP-shCtrl.

[0008] The present invention also provides an application of the shRNA expression system in constructing a gene knockdown cell line, wherein the shRNA targeting the target gene replaces the shCtrl in the recombinant plasmid L-GFPshCtrl or the recombinant plasmid L-GFP-shCtrl through seamless cloning technology to construct a recombinant plasmid L-GFPshRNA or L-GFP-shRNA; the recombinant plasmid L-GFPshRNA or L-GFP-shRNA is transfected into BHK-optT7 cells to complete the packaging of the recombinant virus; the packaged recombinant virus is used to infect the target cells to knock down the expression of the target gene in the target cells.

[0009] Preferably, the shRNA is shUBR5, and the sequence is shown in SEQ ID NO.13; the shUBR5 targets the UBR5 gene in tumor tissue cells.

[0010] Preferably, the gene fragment containing shUBR5 is amplified using plasmid pGIPZ-shUBR5 as a template and connected into the linearized vector of L-GFPshCtrl and L-GFP-shCtrl digested with NheI and SbfI to construct the recombinant plasmids L-GFPshUBR5 and L-GFP-shUBR5.

[0011] Preferably, the primers for amplifying the gene fragment containing shUBR5 are PIV5-miR30-21-F and PIV5-miR30-R, and the sequences are shown in SEQ ID NO.11 and SEQ ID NO.12.

[0012] More preferably, the tumor tissue cells are breast cancer cell line MDA-MB231 or B lymphoma cell line DG75.

[0013] The beneficial effects of the present invention are:

[0014] (I) In the present invention, recombinant plasmids L-GFPshCtrl and L-GFP-shCtrl were constructed. Based on these two recombinant plasmids, two different L-RNAi systems were constructed to deliver shRNA: one is to connect amiRNA to the 3' end of irrelevant mRNA as a transcript, namely, the L-GFPshRNA system; the other is to use the transcription termination and start signals of PIV5-L itself to deliver shRNA as a separate transcript, namely, the L-GFP-shRNA system.

[0015] (ii) Based on the two different L-RNAi delivery systems constructed by the present invention, UBR5 was used as the target, and shUBR5 replaced shCtrl in the recombinant plasmid L-GFPshCtrl or L-GFP-shCtrl through seamless cloning technology to construct recombinant plasmid L-GFPshUBR5 or L-GFP-shUBR5; L-GFPshUBR5 or L-GFP-shUBR5 system can effectively downregulate the protein expression of UBR5 in breast cancer cell line MDAMB231 and B lymphoma cell line DG75. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the genome structure of the L-RNAi system virus strain targeting UBR5 based on PIV5-L.

[0017] Figure 2 Packaging of L-RNAi recombinant virus strain targeting UBR5.

[0018] Figure 3 This is an agarose gel electrophoresis diagram of the amplified shRNA fragment in the genome of the L-RNAi recombinant virus strain targeting UBR5.

[0019] Figure 4 Growth curve determination of L-RNAi recombinant virus strain targeting UBR5.

[0020] Figure 5 Northern Blot hybridization detection results of shRNA after Vero cells were infected with L-RNAi recombinant virus strain targeting UBR5.

[0021] Figure 6 This is the result of immunoblotting detection of downregulation of UBR5 protein expression mediated by the L-RNAi recombinant virus strain targeting UBR5. Figure 6 A is infected breast cancer cell MDA-MB231, Figure 6 B is the infection of B lymphoma cells DG75. DETAILED DESCRIPTION

[0022] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0023] The PIV5-L-GFP plasmid was provided and preserved by the Department of Pathogenic Biology, School of Basic Medical Sciences, Fudan University; the B lymphoma cell line DG75 was purchased from the American Type Culture Collection [ATCC], Manassas, VA); the plasmids pGIPZ-shCtrl, pGIPZ-shUBR5, and the breast cancer cell line MDA-MB231 were donated by Professor Wei Fang of Shanghai Jiao Tong University.

[0024] Plasmid PIV5-L-GFP is disclosed in the literature: Xiaoqing Liu, Lilan Zheng, Ting Wang, A System Based on Novel Parainfluenza Virus PIV5-L for Efficient Gene Delivery of B-Lymphoma Cells. Journal of Virology: 96(8): e0025722.

[0025] Example 1

[0026] AmiRNA is composed of a target-specific shRNA sequence and a backbone based on natural primary miRNA (pri-miRNA), and pri-miR-30a is one of the known and commonly used siRNA backbones. In this embodiment, two L-shRNA systems are designed with miR-30a as the backbone for shRNA delivery: 1) Attaching the shRNA embedded in the miR-30 backbone to the C-terminus of the GFP gene; 2) Using the transcription start and stop elements of PIV5-L itself to independently express the shRNA embedded in the miR-30 backbone, as shown in the attached figure. Figure 1 shown.

[0027] 1. Plasmid Construction

[0028] 1.1 Construction of plasmid pGIPZ-shCtrl(NheI)

[0029] By PCR, the shCtrl with miR-30a as the backbone in the vector pGIPZ-shCtrl was connected to the plasmid PIV5-L-GFP to construct L-shRNA. PIV5-L-GFP is the full-length plasmid of the genome of parainfluenza virus type 5 L strain PIV5-L. Since the PIV5-L-GFP vector itself contains the enzyme XhoI used for linearization of the vector in the pGIPZ-shCtrl vector, the XhoI restriction site was first changed to the NheI restriction site, and the constructed plasmid was named pGIPZ-shCtrl(NheI).

[0030] 1.1.1 PCR to obtain the target fragment

[0031] Using pGIPZ-shCtrl as template, PCR was performed using high-fidelity enzyme Max MasterMix (purchased from Vazyme). The PCR products were subjected to agarose gel electrophoresis and recovered using PCR Clean-Up Kit (DP04-300, GeneMark) after confirming that the bands were single.

[0032] Primer sequences:

[0033] pGIPZ-4076-F:

[0034] CGGTGAAGAATAATGTACAAGTAGCGGCCG, SEQ ID NO.1;

[0035] pGIPZ-5392-R:

[0036] CTAGCCTTCTGTTGGGTTAACCTGAAGAAGT, SEQ ID NO. 2.

[0037] 1.1.2 Enzyme digestion

[0038] pGIPZ-shCtrl was digested with NotI and XhoI to obtain the linearized vector. The digestion system was:

[0039]

[0040] 1.1.2 Connection

[0041] The fragment obtained by the above PCR was connected to the linearized vector of pGIPZ-shCtrl digested with NotI and XhoI by seamless cloning technology, followed by transformation. After 16-18 hours, single clone colonies were picked for colony PCR, and 3 positive clones were sent for sequencing to obtain the plasmid pGIPZ-shCtrl (NheI).

[0042] 1.2 Construction of L-GFPshCtrl and L-GFP-shCtrl

[0043] 1.2.1 PCR to obtain the target fragment

[0044] Using the pGIPZ-shCtrl(NheI) constructed in step 1.1 as a template, Max Master Mix (purchased from Vazyme) was used for PCR. The PCR product miR30-shCtrl-1 (262 bp) was subjected to agarose gel electrophoresis. After confirming that the band was single, it was recovered using PCR Clean-Up Kit (DP04-300, GeneMark). The primer sequences are as follows:

[0045] PIV5-miR30-F1:

[0046] GCTTTTAAGAAAAAAGTAGGCCCGGACGGGTTTGAATGAGGCTTCAG TACTTTACAGAATCG, SEQ ID NO.3;

[0047] PIV5-shCtrl-R:

[0048] CTCTTGGTTTTTTCTTAAAAGCCTGCAGGTGAATTCCGAGGCAGTAGG CACTCTCG, SEQ ID NO.4.

[0049] Since the construction of L-GFP-shCtrl requires the introduction of the transcription elements of the virus itself, the pGIPZ-shCtrl (NheI) constructed in step 1.1 was used as a template, and two PCRs were performed. The transcription start and stop elements of the parainfluenza virus PIV5-L itself were added to the primers. The second PCR used the product of the first PCR as a template. The second PCR product miR30-shCtrl-2 (286 bp) was subjected to agarose gel electrophoresis. After confirming that the band was single, it was recovered using PCR Clean-Up Kit (DP04-300, GeneMark). The downstream primer is still PIV5-shCtrl-R (as shown in SEQ ID NO.4), and the upstream primer sequence is as follows:

[0050] PIV5-miR30-F2:

[0051] GCTTTTAAGAAAAAAGTAGGCCCGGACGGGTTTGAATGAGGCTTCAG TACTTTACAGAATCG, SEQ ID NO.5;

[0052] PIV5-miR30-F3:

[0053] ACGAGCTGTACAAGTAATGCGGCCGCTTTTAAGAAAAAAGTAGGCCC GGACG, SEQ ID NO.6;

[0054] The transcription start and stop element sequence of the parainfluenza virus PIV5-L itself is shown in SEQ ID NO.7: TTTTAAGAAAAAAGTAGGCCCGGACGGGT.

[0055] 1.2.2 Enzyme digestion

[0056] NotI restriction enzyme digestion of PIV5-L-GFP to obtain linearized vector, restriction enzyme digestion system:

[0057]

[0058] 1.2.3 Connection

[0059] The fragments miR30-shCtrl-1 and miR30-shCtrl-2 obtained by the above PCR were connected to the linearized vector of PIV5-L-GFP cut by NotI by seamless cloning technology, and then transformed. After 16-18 hours, single clones were picked for colony PCR, and 3 positive clones were sent for sequencing, thus obtaining plasmids L-GFPshCtrl and L-GFP-shCtrl( Figure 1 ). The sequence of shCtrl is shown in SEQ ID NO.8, (5'-3'): TCTCGCTTGGGCGAGAGTAAG; the sequences of plasmids L-GFPshCtrl and L-GFP-shCtrl are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0060] 1.3 Construction of L-GFPshUBR5 and L-GFP-shUBR5

[0061] 1.3.1 PCR to obtain the target fragment

[0062] Using plasmid pGIPZ-shUBR5 as template, Max Master Mix (purchased from Vazyme) high-fidelity enzyme was used for PCR to amplify the gene fragment containing shUBR5 in pGIPZ-shUBR5. The PCR product was subjected to agarose gel electrophoresis. After confirming that the band was single, it was recovered using PCR Clean-Up Kit (DP04-300, GeneMark). The primer sequences are as follows:

[0063] PIV5-miR30-21-F:

[0064] CTTCAGGTTAACCCAACAGAAGGCTAGCGAGTGCTGTTGACAGTGAG CGA, SEQ ID NO.11;

[0065] PIV5-miR30-R:

[0066] GGTTTTTTCTTAAAAGCCTGCAGGTGAATTCCGAGGCAGTAGGCAC, SEQ ID NO. 12.

[0067] 1.3.2 Enzyme digestion

[0068] NheI and SbfI were used to digest L-GFPshCtrl and L-GFP-shCtrl prepared in step 1.2 to obtain a linearized vector. Enzyme digestion system:

[0069]

[0070] 1.3.3 Connection

[0071] The gene fragment containing shUBR5 obtained by the above PCR was connected into the linearized vector of L-GFPshCtrl and L-GFP-shCtrl respectively after digestion with NheI and SbfI by seamless cloning technology, and then transformed. After 16-18 hours, single clone colonies were picked for colony PCR, and 3 positive clones were sent for sequencing, thus obtaining plasmids L-GFPshUBR5 and L-GFP-shUBR5. The schematic diagram of their genome structure is shown in the figure. Figure 1 The sequence of shUBR5 is shown in SEQ ID NO. 13 (5'-3'): TTGGAACAGGCTACTATTAAA.

[0072] Note: Since the basic requirement for the successful rescue of PIV5 virus is that the full length of the viral genome needs to be a multiple of "6", the primers constructed by the above plasmids L-GFPshUBR5 and L-GFP-shUBR5 plasmids are only suitable when the number of shRNA is 21bp. When the number of shRNA is not 21, the bases near the restriction site need to be appropriately increased or decreased according to the number of shRNA so that the full length of the viral genome is still a multiple of "6" after being connected to the viral vector.

[0073] 2. Virus packaging

[0074] BHK-optT7 cells were plated at 0.5 million / well (6-well plate). After 20-24 hours, when the cell confluence reached about 80%-90%, transfection was performed. Fresh 6% FBSDMEM, antibody-free culture medium was used before transfection. The transfection system was as follows:

[0075]

[0076] After the above system is prepared, mix it evenly, leave it at room temperature for 10 minutes, then add it dropwise to the cells in the 6-well plate. After 6-8 hours, replace it with complete medium. Culture it in a 37℃ cell culture incubator and observe it once a day. After 3 days, obvious syncytia can be seen. Figure 2As shown in the figure, syncytia and green fluorescence were clearly observed 3 days after transfection, which preliminarily indicated that the modified virus strain was successfully rescued. Specific primers for shRNA were designed to perform PCR analysis on viral RNA extracted from the viral supernatant (primer sequences are shown in Table 1). Figure 3 As shown, the genomes of the recombinant virus strains all carry complete shRNA fragments, and compared with the wild-type strains, there is no significant difference in the growth curves of different recombinant virus strains ( Figure 4 ), indicating that the shRNA and GFP gene fragments were not lost during viral replication and packaging, and the insertion of these gene fragments had no obvious effect on viral growth. Therefore, these results show that the PIV5-L-based L-GFPshRNA (L-GFPshCtrl, L-GFPshUBR5) or L-GFP-shRNA (L-GFP-shCtrl, L-GFP-shUBR5) system can stably carry shRNA without affecting viral replication.

[0077] Table 1 Primer sequences used for genome detection of L-RNAi recombinant virus strains

[0078]

[0079] 3. Validation of PIV5-L-based shRNA system for interfering gene expression

[0080] 3.1 Detection of shRNA (shCtrl, shUBR5) transcription by Northern Blot. The results are as follows Figure 5 As shown, shRNA can be detected in Vero cells infected with recombinant virus strains carrying shRNA, proving that L-GFPshRNA (L-GFPshCtrl, L-GFPshUBR5) and L-GFP-shRNA (L-GFP-shCtrl, L-GFP-shUBR5) recombinant virus strains can stably express exogenous shRNA (shCtrl, shUBR5) after infecting target cells. At the same time, in Vero cells infected with L-GFPshUBR5 and L-GFP-shUBR5, there was almost no significant difference in the shUBR5 expression levels between L-GFPshUBR5 and L-GFP-shUBR5; however, the expression of shUBR5 in the infection group with MOI=10 was significantly higher than that in the infection group with MOI=1. These results indicate that the L-RNAi system can effectively transcribe shRNA. In order to enhance the detection signal generated by Dig-UTP, the probe designed for detecting shRNA has three repeated shRNA sequences ( Figure 5 ).

[0081] 3.2 In order to further detect the gene interference efficiency of L-GFPshUBR5 and L-GFP-shUBR5 system, the breast cancer cell line MDA-MB231 was infected with recombinant virus at MOI=1 or 10, and the cells were collected at 24 and 48 hours after infection to detect the protein expression level of UBR5. Figure 6 As shown in A, compared with the Ctrl infection group, the UBR5 protein expression level in the shUBR5 infection group was significantly reduced at MOI=10, among which the knockdown effect of the L-GFP-shUBR5 infection group was more obvious than that of L-GFPshUBR5; while at MOI=1, there was no significant change in the protein expression level, that is, the system needs to be at MOI=10 to achieve a better knockdown effect. In addition, the UBR5 expression in the Ctrl infection group also decreased 48h after infection, which may be affected by viral infection.

[0082] 3.3 This example further verified the knockdown effect in B lymphoma cell lines, infected DG75 cell lines with MOI = 10, and collected cells 48 hours after infection to detect the expression level of UBR5 protein. Figure 6 As shown in Figure B, consistent with the above results, whether shRNA is linked to another gene in the same coding region or shRNA is expressed independently, the expression level of UBR5 protein is significantly decreased after infection with the L-RNAi recombinant virus strain, and the gene knockdown effect of L-GFP-shUBR5 is better than that of L-GFPshUBR5. The above results show that the shRNA system based on PIV5-L can interfere with gene expression.

[0083] The specification and drawings of the present invention are considered to be illustrative rather than restrictive. On the basis of the present invention, those skilled in the art can make some substitutions and modifications to some of the technical features according to the disclosed technical content without creative labor, all of which are within the protection scope of the present invention.

Claims

1. Recombinant plasmid L-GFPshCtrl, characterized in that: The sequence is shown as SEQ ID NO.

9.

2. Recombinant plasmid L-GFP-shCtrl, characterized in that: The sequence is shown as SEQ ID NO.

10.

3. A shRNA expression system based on parainfluenza virus type 5 L strain PIV5-L, characterized in that: It comprises the recombinant plasmid L-GFPshCtrl as claimed in claim 1 or the recombinant plasmid L-GFP-shCtrl as claimed in claim 2.

4. Use of the shRNA expression system according to claim 3 in constructing a gene knockdown cell line, characterized in that: By using seamless cloning technology, the shRNA targeting the target gene replaces the shCtrl in the recombinant plasmid L-GFPshCtrl or the recombinant plasmid L-GFP-shCtrl to construct the recombinant plasmid L-GFPshRNA or L-GFP-shRNA; the recombinant plasmid L-GFPshRNA or L-GFP-shRNA is transfected into BHK-optT7 cells to complete the packaging of the recombinant virus; the packaged recombinant virus is used to infect the target cells to knock down the target gene expression in the target cells.

5. The use according to claim 4, characterized in that: The shRNA is shUBR5, and the sequence is shown in SEQ ID NO.13; the shUBR5 targets the UBR5 gene in tumor tissue cells.

6. The use according to claim 5, characterized in that: Using plasmid pGIPZ-shUBR5 as a template, the gene fragment containing shUBR5 was amplified and connected into the linearized vector of L-GFPshCtrl and L-GFP-shCtrl digested with NheI and SbfI to construct the recombinant plasmids L-GFPshUBR5 and L-GFP-shUBR5.

7. The use according to claim 6, characterized in that: The primers for amplifying the gene fragment containing shUBR5 are PIV5-miR30-21-F and PIV5-miR30-R, and the sequences are shown in SEQ ID NO.11 and SEQ ID NO.

12.

8. The use according to claim 5, characterized in that: The tumor tissue cells are breast cancer cell line MDA-MB231 or B lymphoma cell line DG75.

Images