Development and application of molecular marker for identifying female parent of pine tree

Abstract

The invention discloses development and application of a molecular marker for identifying a female parent of a pine tree. The technical problem to be solved is how to identify or assist in identifying the female parent of the pine tree. Specifically, the invention discloses application of substances for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646 in identification of a female parent of a pine tree to be detected or in preparation of a product for identifying the female parent of the pine tree to be detected. The SNP237 is an SNP in pine mitochondria, is the 237th nucleotide of a sequence 1, and is C or T; the SNP336 is an SNP in pine mitochondria, is the 336th nucleotide of a sequence 1, and is G or T; the SNP351 is an SNP in pine mitochondria, is the 351th nucleotide of a sequence 1, and is A or C; the SNP412 is an SNP in pine mitochondria, is the 412th nucleotide of a sequence 1, and is A or C; the SNP598 is an SNP in pine mitochondria, is the 598th nucleotide of a sequence 1, and is C or T; the SNP646 is an SNP in pine mitochondria, is the 646th nucleotide of a sequence 1 and is T or C. The source of a female parent to be detected is determined according to the sequence, and the invention can be used for industrial and agricultural production.

Description

Technical Field

[0001] The present invention specifically relates to the development of a molecular marker for pine maternal parent identification and its application. Background Art

[0002] Traditionally, the classification of pine trees is mainly based on germplasm identification based on phenotypic traits. However, morphological characteristics are not reliable in distinguishing some tree species. This is mainly manifested in the following ways: some species have overlapping areas in natural distribution, and there is no reproductive isolation, but the genetic variation within the species is large, and these species are not easy to distinguish; the offspring produced by hybridization of different tree species usually have morphological characteristics and anatomical traits between the two parents; some pine tree species have large variation in morphological traits within the population, and under different site conditions, the same population has significant morphological variation, which affects the observation results; and some interspecific trait differences are only manifested at a certain stage of growth and development, and it is impossible to judge their maternal origin in the early stages.

[0003] With the development of molecular markers, mature and reliable technologies have been provided for the identification of germplasm with consistent genetic background. Among all molecular markers, microsatellite markers (simple sequence repeat, SSR) and ISSR (inter-simplesequence repeat) technologies are more stable than RAPD (random amplified polymorphic DNA) and AFLPs (amplified fragment length polymorphisms). The former is widely used in the identification of germplasm of closely related species and hybrids and the evaluation of genetic diversity of germplasm, but the disadvantage is that specific primers need to be designed, and the cost of developing a large number of primers is high. In addition, SSR and ISSR can only determine the parent tree species of hybrid offspring, and cannot further distinguish the paternal and maternal parents of hybrid offspring. How to identify the source of the maternal parent of pine trees is a technical problem faced by people in this field. Summary of the invention

[0004] The technical problem solved by the invention is how to provide a method for identifying the origin of the female parent of a pine tree.

[0005] In order to solve the above technical problems, the present invention provides the following applications.

[0006] Use of a substance for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646 in identifying a pine parent to be tested or in preparing a product for identifying a pine parent to be tested;

[0007] The SNP237 is a SNP in pine mitochondria, which is the 237th nucleotide of sequence 1, which is C or T;

[0008] The SNP336 is a SNP in pine mitochondria, which is the 336th nucleotide of sequence 1, which is G or T;

[0009] The SNP351 is a SNP in pine mitochondria, which is the 351st nucleotide of sequence 1, and is A or C;

[0010] The SNP412 is a SNP in pine mitochondria, which is the 412th nucleotide of sequence 1, and is A or C;

[0011] The SNP598 is a SNP in pine mitochondria, which is the 598th nucleotide of sequence 1, which is C or T;

[0012] The SNP646 is a SNP in pine mitochondria, which is the 646th nucleotide of sequence 1, and is T or C.

[0013] In the above, the pine tree mother plant to be tested may be any one of Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus armandii, Pinus bungeana or Pinus thunbergii.

[0014] In order to solve the above technical problems, the present invention also provides the following applications.

[0015] The application is any of the following:

[0016] 1) Use of a substance for detecting SNP237 in preparing a product for identifying whether the pine tree parent to be tested is from white pine;

[0017] 2) Use of a substance for detecting SNP412 in preparing a product for identifying whether the pine tree parent to be tested is from Pinus sylvestris var. mongolica;

[0018] 3) Use of a substance for detecting SNP646 in preparing a product for identifying whether the pine tree parent to be tested is from North American pine;

[0019] 4) Application of substances for detecting SNP336 and SNP598 in the preparation of products for identifying whether the pine tree parent to be tested is from Korean pine;

[0020] 5) Use of substances for detecting SNP351 and SNP412 in preparing products for identifying whether the pine tree parent to be tested is from pine tree A, wherein the pine tree A group includes red pine and Chinese pine;

[0021] 6) Use of substances for detecting SNP336, SNP598 and SNP646 in preparing a product for identifying whether the pine tree parent to be tested is from pine tree A, wherein the pine tree A group includes Xinjiang pentaphyllum and Armand pine;

[0022] The SNP237 is a SNP in pine mitochondria, which is the 237th nucleotide of sequence 1, which is C or T;

[0023] The SNP336 is a SNP in pine mitochondria, which is the 336th nucleotide of sequence 1, which is G or T;

[0024] The SNP351 is a SNP in pine mitochondria, which is the 351st nucleotide of sequence 1, and is A or C;

[0025] The SNP412 is a SNP in pine mitochondria, which is the 412th nucleotide of sequence 1, and is A or C;

[0026] The SNP598 is a SNP in pine mitochondria, which is the 598th nucleotide of sequence 1, which is C or T;

[0027] The SNP646 is a SNP in pine mitochondria, which is the 646th nucleotide of sequence 1, and is T or C.

[0028] In the above, the sequence 1 is a mitochondrial DNA sequence, which includes an intron sequence. In the actual detection process, SNP237, SNP336, SNP351, SNP412, SNP476, SNP598, and SNP646 can be detected and analyzed by detecting the nucleotide sequence of the mRNA transcribed from the sequence 1, the cDNA reversely transcribed from the mRNA, or the amino acid sequence of the protein encoded by the sequence 1.

[0029] In order to solve the above technical problems, the present invention also provides the following method.

[0030] The method is any of the following:

[0031] M1) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Pinus leucophylla, comprising detecting SNP 237 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Pinus leucophylla according to the detection result, wherein the SNP 237 is from the SNP 237 of claim 1;

[0032] If the SNP237 of the pine tree to be tested is T, the maternal parent of the pine tree to be tested is from Pinus thunbergii; if the SNP237 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is not from Pinus thunbergii;

[0033] M2) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Pinus sylvestris, comprising detecting SNP412 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Pinus sylvestris according to the detection result, wherein the SNP412 is from the SNP412 of claim 1;

[0034] If the SNP412 of the pine tree to be tested is A, the maternal parent of the pine tree to be tested is from Pinus sylvestris var. mongolica; if the SNP412 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is not from Pinus sylvestris var. mongolica;

[0035] M3) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from a North American pine, comprising detecting SNP646 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from a North American pine according to the detection result, wherein the SNP646 is the SNP646 described in claim 1;

[0036] If the SNP646 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is from North American pine; if the SNP646 of the pine tree to be tested is T, the maternal parent of the pine tree to be tested is not from North American pine;

[0037] M4) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Korean pine, comprising detecting SNP336 and SNP598 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Korean pine according to the detection result, wherein the SNP336 is the SNP336 described in claim 1, and the SNP598 is the SNP598 described in claim 1;

[0038] If SNP336 of the pine tree to be tested is T and SNP598 is T, the maternal parent of the pine tree to be tested is from Pinus koraiensis; otherwise, the maternal parent of the pine tree to be tested is not from Pinus koraiensis;

[0039] M5) A method for identifying or assisting in identifying whether the pine tree mother parent to be tested is from pine tree A, comprising detecting SNP351 and SNP412 in the mitochondria of the pine tree to be tested, and determining whether the pine tree mother parent to be tested is from pine tree A according to the detection result, wherein the SNP351 is the SNP351 described in claim 1, the SNP412 is the SNP412 described in claim 1, and the pine tree A group is red pine and Chinese pine;

[0040] If the SNP351 of the pine tree to be tested is A and the SNP412 is C, then the maternal parent of the pine tree to be tested comes from pine tree A; otherwise, the maternal parent of the pine tree to be tested does not come from pine tree A;

[0041] M6) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is derived from pine tree A, comprising detecting SNP336, SNP598 and SNP646 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is derived from pine tree A according to the detection results, wherein the SNP336 is the SNP336 described in claim 1, the SNP598 is the SNP598 described in claim 1, the SNP646 is the SNP646 described in claim 1, and the pine tree A group includes Xinjiang pentaphyllum and Armand pine;

[0042] If SNP336 of the pine tree to be tested is T, SNP646 is T, and SNP598 is C, then the maternal parent of the pine tree to be tested comes from pine tree A; otherwise, the maternal parent of the pine tree to be tested does not come from pine tree A.

[0043] The SNP237 is C, which means that the 237th nucleotide of sequence 1 is C;

[0044] The SNP237 is T, which means that the 237th nucleotide of sequence 1 is T;

[0045] The SNP336 is G, which means that the nucleotide at position 336 of sequence 1 is G;

[0046] The SNP336 is T, which means the nucleotide at position 336 of sequence 1 is T;

[0047] The SNP351 is C, which means that the nucleotide at position 351 of sequence 1 is C;

[0048] The SNP412 is A when the 412th nucleotide of sequence 1 is A;

[0049] The SNP412 is C when the 412th nucleotide of sequence 1 is C;

[0050] The SNP598 is C when the 598th nucleotide of sequence 1 is C;

[0051] The SNP598 is T means that the 598th nucleotide of sequence 1 is T;

[0052] The SNP646 is T means that the 646th nucleotide of sequence 1 is T;

[0053] The SNP646 is C, which means the 646th nucleotide of sequence 1 is C.

[0054] In the above, if the mother parent of the pine tree to be tested is Pinus sylvestris var. mongolica, the sequence of region 1 of the pine tree genome to be tested is sequence 2.

[0055] In the above, if the mother parent of the pine tree to be tested is Pinus densiflora, the sequence of region 1 of the pine tree genome to be tested is sequence 3.

[0056] In the above, if the mother parent of the pine tree to be tested is Pinus tabulaeformis, the sequence of region 1 of the pine tree genome to be tested is sequence 4.

[0057] In the above, if the mother parent of the pine tree to be tested is Pinus koraiensis, the sequence of region 1 of the pine tree genome to be tested is sequence 5.

[0058] In the above, if the mother parent of the pine tree to be tested is Pinus pentaphyllum, the sequence of region 1 of the pine tree genome to be tested is sequence 6.

[0059] In the above, if the mother parent of the pine tree to be tested is Pinus armandii, the sequence of region 1 of the pine tree genome to be tested is sequence 7.

[0060] In the above, if the mother parent of the pine tree to be tested is white pine, the sequence of region 1 of the pine tree genome to be tested is sequence 8.

[0061] In the above, if the mother parent of the pine tree to be tested is North American pine, the sequence of region 1 of the pine tree genome to be tested is sequence 9.

[0062] In order to solve the above technical problems, the present invention also provides the following products.

[0063] The product is any of the following:

[0064] P1) a product for identifying or assisting in identifying whether the pine tree parent to be tested is from white pine, comprising a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is the SNP237 described in claim 1;

[0065] P2) a product for identifying or assisting in identifying whether the pine tree mother to be tested is from Pinus sylvestris var. mongolica, comprising a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is SNP412 as described in claim 1;

[0066] P3) a product for identifying or assisting in identifying whether the pine tree parent to be tested is from North American pine, comprising a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is SNP646 as described in claim 1;

[0067] P4) a product for identifying or assisting in identifying whether the pine tree mother to be tested is from Korean pine, comprising a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP336 and SNP598 described in claim 1;

[0068] P5) identifying or assisting in identifying whether the pine tree parent to be tested is a product of pine tree A, wherein the pine tree A component is red pine and Chinese pine, and comprising a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP351 and SNP412 as described in claim 1;

[0069] P6) Identifying or assisting in identifying whether the pine tree mother to be tested is a product of pine tree A, wherein the pine tree A component is Xinjiang pentaphyllum and Armand pine, and comprising a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is SNP336, SNP598 and SNP646 as described in claim 1.

[0070] In the above-mentioned applications, methods and products, the products of the substances for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646 are as follows D1), D2), D3) or D4):

[0071] D1) contains in vitro nucleic acid amplification primers for specific amplification and detection of the SNP;

[0072] D2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in D1);

[0073] D3) a kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0074] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2) or the kit described in D3).

[0075] The in vitro nucleic acid amplification technology can be polymerase chain reaction (PCR), strand displacement amplification (SDA), ligase chain reaction (LCR) and nucleic acid sequence-dependent amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent isothermal amplification technology (HDA) or Qβ replication technology.

[0076] The present application uses polymerase chain reaction (PCR) as an amplification method to perform polymorphism detection.

[0077] The specific amplification in D1) can detect the nucleotide sequence of the polymorphic sites SNP1-SNP8 by the presence or absence of amplification products or by the presence or absence of amplification products combined with auxiliary reagents such as probes.

[0078] In the above-mentioned applications, methods and products, the in vitro nucleic acid amplification primer may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include but are not limited to dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected without a marker.

[0079] In the above M1), if the pine tree mother parent to be tested is not from Pinus bungeana, then the pine tree mother parent to be tested may be from Pinus sylvestris var. mongolica, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus armandii or Pinus truncatum.

[0080] In the above M2), if the pine tree mother parent to be tested is not from Pinus sylvestris var. mongolica, the pine tree mother parent to be tested may be from Pinus bungeana, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus armandii or Pinus sylvestris.

[0081] In the above M3), if the pine tree mother parent to be tested is not from North American pine, then the pine tree mother parent to be tested may be from white pine, Scotch pine, red pine, Chinese pine, Korean pine, Xinjiang five-needle pine or Armand pine.

[0082] In the above M4), if the pine tree mother to be tested is not from Pinus koraiensis, then the pine tree mother to be tested may be from Pinus bungeana, Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus pentaphyllum, Pinus armandii or Pinus truncatum.

[0083] In the above M5), if the pine tree mother parent to be tested is not from Pinus densiflora and Pinus tabulaeformis, the pine tree mother parent to be tested may be from Pinus bungeana, Pinus sylvestris, Pinus koraiensis, Pinus pentaphyllum, Pinus armandii or Pinus truncatum.

[0084] In the above M6), if the pine tree mother parent to be tested is not from Pinus armandii and Pinus armandii, the pine tree mother parent to be tested may be from Pinus bungeana, Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis or Pinus rapa.

[0085] In the above-mentioned application, product or method, the in vitro nucleic acid amplification primers include a primer pair e for amplification; the primer pair e consists of primers eF and eR;

[0086] The primer eF is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 10; the primer eR is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 11.

[0087] In order to solve the above technical problems, the present invention also provides the following applications.

[0088] Use of a substance for detecting a pine parent to be tested in identifying a pine parent to be tested or in preparing a product for identifying a pine parent to be tested; the substance for detecting a pine parent to be tested is a substance for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646;

[0089] The SNP237 is a SNP in pine mitochondria, which is the 237th nucleotide of sequence 1, which is C or T;

[0090] The SNP336 is a SNP in pine mitochondria, which is the 336th nucleotide of sequence 1, which is G or T;

[0091] The SNP351 is a SNP in pine mitochondria, which is the 351st nucleotide of sequence 1, and is A or C;

[0092] The SNP412 is a SNP in pine mitochondria, which is the 412th nucleotide of sequence 1, and is A or C;

[0093] The SNP598 is a SNP in pine mitochondria, which is the 598th nucleotide of sequence 1, which is C or T;

[0094] The SNP646 is a SNP in pine mitochondria, which is the 646th nucleotide of sequence 1, and is T or C.

[0095] In order to solve the above technical problems, the present invention also provides the following applications.

[0096] Application of sequence 1 in the preparation of products for identifying the maternal or parental origin of pine trees.

[0097] Use of sequence 1 in identifying the mother or parental source of pine trees.

[0098] The nucleotide sequence shown in SEQ ID NO:1.

[0099] The pine tree may be Pinus densiflora, Pinus sylvestris, Pinus tabuliformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus strobus or Pinus sibirica.

[0100] Beneficial Effects

[0101] The present invention discloses the development of a molecular marker for pine maternal identification and its application. The technical problem to be solved is how to identify or assist in the identification of pine maternal parents. Specifically disclosed is the application of substances for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646 in identifying the pine maternal parent to be tested or in the preparation of products for identifying the pine maternal parent to be tested; the SNP237 is a SNP in the mitochondria of pine, which is the 237th nucleotide of sequence 1, which is C or T; the SNP336 is a SNP in the mitochondria of pine, which is the 336th nucleotide of sequence 1, which is G or T; the SNP351 is a SNP in the mitochondria of pine, which is the 336th nucleotide of sequence 1, which is G or T; the SNP351 is a SNP in the mitochondria of pine, which is the 336th nucleotide of sequence 1, which is G or T; the SNP351 is a SNP in the mitochondria of pine The present invention discloses a SNP in the mitochondria of pine, which is the 351st nucleotide of sequence 1, which is A or C; the SNP412 is a SNP in the mitochondria of pine, which is the 412th nucleotide of sequence 1, which is A or C; the SNP598 is a SNP in the mitochondria of pine, which is the 598th nucleotide of sequence 1, which is C or T; the SNP646 is a SNP in the mitochondria of pine, which is the 646th nucleotide of sequence 1, which is T or C. The maternal source to be tested is determined according to the sequence, and the present invention can be used for industrial and agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 This is a comparison chart of mitochondrial atp6 marker sequences. Specific embodiments

[0103] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0104] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0105] In the following examples, the DNA sequence was obtained by using the Sanger sequencing technology. The sequencing results were expressed in the form of four bases, ATCG, and were checked using the Sanger Scanner 2.0 software. A single peak indicated that the sequencing result was accurate.

[0106] In terms of morphological characteristics, tree species with similar distribution areas may be indistinguishable; the morphological characteristics of the same tree species at different ages or under different site conditions may vary significantly; and it is difficult to determine the morphological characteristics of offspring produced by hybridization from those of their parents.

[0107] The commonly used molecular markers SSR and ISSR require the design of specific primers, and the development cost of a large number of primers is high. In addition, the two markers can only determine the parental tree species of the hybrid offspring, and cannot further distinguish the father and mother of the hybrid offspring.

[0108] There is a small genome in the cytoplasm of eukaryotic cells, including mitochondrial DNA and chloroplast DNA, which has a certain degree of genetic autonomy and can relatively independently determine the inheritance of certain traits. In pine trees, mitochondria are maternally inherited. Based on this characteristic of pine trees, the present invention develops mitochondrial specific primers in common northern pine trees that can distinguish different pine trees as much as possible. By comparing the DNA sequence of the target fragment, the maternal parent or parent of the hybrid offspring can be determined while distinguishing the tree species.

[0109] Example 1 Development of labeled primers

[0110] Detection of the source of pine mother tree:

[0111] Based on the mitochondrial genome data of loblolly pine, the needles of common northern pine trees in China, including Pinus densiflora, Pinus sylvestris, Pinus tabuliformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus strobus, and Pinus sibirica, were selected as materials to screen mitochondrial specific markers by amplification and sequence comparison of single genes. The screening principles are as follows: the selected sequence can distinguish different species as much as possible; the more conservative regions in the sequence are selected to avoid large gap regions; a sequence that is the same for all species must be left at both ends of the selected sequence to set the primers; in order to ensure the stability of the primers, the primer length range is set to 18-25bp, and the annealing temperature is 50-60℃; considering the range of Sanger first-generation sequencing technology, the target band range is set to 400-1500bp. According to the screening principles, one primer (atp6) was finally determined, as shown in Table 1. The amplified sequences of different primers in different species are:

[0112] The present invention discovered a sequence with multiple polymorphic sites in mitochondria, which is named atp6. The specific sequence 1 is as follows:

[0113] (Sequence 1) wherein w represents A or T; y represents C or T; k represents G or T; and m represents A or C.

[0114] The SNP237 is a SNP in pine mitochondria, which is the 237th nucleotide of sequence 1, which is C or T;

[0115] The SNP336 is a SNP in pine mitochondria, which is the 336th nucleotide of sequence 1, which is G or T;

[0116] The SNP351 is a SNP in pine mitochondria, which is the 351st nucleotide of sequence 1, and is A or C;

[0117] The SNP412 is a SNP in pine mitochondria, which is the 412th nucleotide of sequence 1, and is A or C;

[0118] The SNP598 is a SNP in pine mitochondria, which is the 598th nucleotide of sequence 1, which is C or T;

[0119] The SNP646 is a SNP in pine mitochondria, which is the 646th nucleotide of sequence 1, and is T or C.

[0120] If the SNP237 of the pine tree to be tested is T, then its mother parent is white pine, and if the SNP237 of the pine tree to be tested is C, then its mother parent is not white pine. Then its mother parent can be Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphyllum, Pinus armandii or Pinus truncatum.

[0121] If the SNP336 of the pine tree to be tested is G, then its mother parent is Pinus sylvestris, Pinus densiflora, Pinus tabulaeformis or Pinus bungeana. If the SNP336 of the pine tree to be tested is T, then its mother parent is Pinus koraiensis, Pinus pentaphyllum, Pinus armandii or Pinus thunbergii.

[0122] If the SNP351 of the pine tree to be tested is A, its mother parent is Pinus sylvestris, Pinus densiflora or Pinus tabulaeformis. If the SNP351 of the pine tree to be tested is C, its mother parent is Pinus koraiensis, Pinus pentaphyllum, Pinus armandii, Pinus bungeana or Pinus tabulaeformis.

[0123] If the SNP412 of the pine tree to be tested is A, its mother parent is Pinus sylvestris var. mongolica; if the SNP412 of the pine tree to be tested is C, its mother parent is Pinus densiflora, Pinus tabulaeformis, Pinus koraiensis, Pinus pentaphylla, Pinus armandii, Pinus bungeana or Pinus truncatum.

[0124] If SNP598 of the pine tree to be tested is T, its mother parent is red pine, Chinese pine or Korean pine. If SNP598 of the pine tree to be tested is C, its mother parent is larch, Xinjiang five-needle pine, Armand pine, white pine or North American pine.

[0125] If SNP646 of the pine tree to be tested is C, its mother parent is North American pine. If SNP646 of the pine tree to be tested is T, its mother parent is red pine, Chinese pine, Korean pine, Scots pine, Xinjiang five-needle pine, Armand pine or white pine.

[0126] SNP 237 can distinguish white pine; SNP412 can distinguish Pinus sylvestris var. mongolica; SNP646 can distinguish Pinus sylvestris var. mongolica; SNP336 and SNP598 can distinguish Pinus koraiensis; SNP351 and SNP412 can distinguish Pinus densiflora and Pinus tabulaeformis / others; SNP336, SNP598 and SNP646 can distinguish Pinus armandii and Pinus armandii / others.

[0127] The SNP237 is C, which means that the 237th nucleotide of sequence 1 is C;

[0128] The SNP237 is T, which means that the 237th nucleotide of sequence 1 is T;

[0129] The SNP336 is T, which means the nucleotide at position 336 of sequence 1 is T;

[0130] The SNP336 is G, which means that the nucleotide at position 336 of sequence 1 is G;

[0131] The SNP351 is C, which means that the nucleotide at position 351 of sequence 1 is C;

[0132] The SNP351 is A means that the nucleotide at position 351 of sequence 1 is A;

[0133] The SNP412 is A when the 412th nucleotide of sequence 1 is A;

[0134] The SNP412 is C when the 412th nucleotide of sequence 1 is C;

[0135] The SNP598 is T means that the 598th nucleotide of sequence 1 is T;

[0136] The SNP598 is C when the 598th nucleotide of sequence 1 is C;

[0137] The SNP646 is T means that the 646th nucleotide of sequence 1 is T;

[0138] The SNP646 is C, which means the 646th nucleotide of sequence 1 is C.

[0139] Obtaining pine tree DNA: The CTAB method was used to extract leaf DNA of red pine (Pinus densiflora), mongolic pine (Pinus sylvestris), Chinese pine (Pinus tabuliformis), white pine (Pinus bungeana), red pine (Pinus koraiensis), Armand pine (Pinus armandii), North American pine (Pinus strobus) and Xinjiang five-needle pine (Pinus sibirica). DNA of red pine (Pinus densiflora), mongolic pine (Pinus sylvestris), Chinese pine (Pinus tabuliformis), white pine (Pinus bungeana), red pine (Pinus koraiensis), Armand pine (Pinus armandii), North American pine (Pinus strobus) and Xinjiang five-needle pine (Pinus sibirica) was obtained.

[0140] The PCR reaction system is as follows:

[0141] 3 μL of pine DNA (30 ng / mL), 2 μL of upstream primer (30 ng / mL), 2 μL of downstream primer (30 ng / mL), 25 μL of 2×Mix enzyme (Novozyme P222-03-AA), 18 μL of ddH2O, a total of 50 μL.

[0142] The PCR reaction conditions are as follows:

[0143] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at the optimum temperature (the optimum temperature is shown in Table 1) for 45 s, extension at 72°C for 1 min, 35 cycles; final extension at 72°C for 10 min.

[0144] The above PCR reaction system, PCR reaction conditions and atp6-F / atp6-R primers were used to amplify and sequence the above-mentioned red pine (Pinus densiflora) DNA, Scotch pine (Pinus sylvestris) DNA, Chinese pine (Pinus tabuliformis) DNA, white pine (Pinus bungeana) DNA, Korean pine (Pinus koraiensis) DNA, Armandi (Pinus armandii) DNA, North American pine (Pinus strobus) DNA and Xinjiang five-needle pine (Pinus sibirica) DNA, and the results are as follows:

[0145] The specific amplified mitochondrial DNA sequence of Pinus sylvestris var. mongolica (sequence 2) is as follows:

[0146] CCACTTGAGCAATCTGCCATTATCCCATTGATTCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTGACAAGTCATTTTATAATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATAAATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTTAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGCCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0147] The amplified mitochondrial DNA sequence of Pinus densiflora (Sequence 3) is as follows:

[0148] CCACTTGAGCAATCTGCCATTATCCCATTGATTCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTGACAAGTCATTTTATAATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGTCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0149] The amplified mitochondrial DNA sequence of Pinus tabuliformis (Sequence 4) is as follows:

[0150] CCACTTGAGCAATCTGCCATTATCCCATTGATTCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTG GTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTGACAAGTCATTTTATAATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGTCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0151] The amplified mitochondrial DNA sequence of Pinus koraiensis (Sequence 5) is as follows:

[0152] CCACTTGAGCAATCTGCCATTATCCCATTTTATCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTTACAAGTCATTTTATCATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGTCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0153] The amplified mitochondrial DNA sequence of Pinus sibirica Du Tour in Xinjiang (Sequence 6) is as follows:

[0154] CCACTTGAGCAATCTGCCATTATCCCATTTTATCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTTACAAGTCATTTTATCATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATAC ATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGCCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0155] The amplified mitochondrial DNA sequence of Pinus armandii (Sequence 7) is as follows:

[0156] CCACTTGAGCAATCTGCCATTATCCCATTTTATCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTTACAAGTCATTTTATCATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGCCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0157] The amplified mitochondrial DNA sequence of Pinus bungeana (Sequence 8) is as follows:

[0158] CCACTTGAGCAATCTGCCATTATCCCATTTTATCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCTGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTGACAAGTCATTTTATCATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGCCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0159] The mitochondrial DNA sequence of Pinus strobus (Sequence 9) was amplified as follows:

[0160] CCACTTGAGCAATCTGCCATTATCCCATTTTATCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCGGCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAGTTACAAGTCATTTTATCATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCATTGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGCCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTACCAATAGTTTTTGCACCGACCGGT。

[0161] Table 1 Summary of mitochondrial markers

[0162]

[0163] Example 2 Verification of mitochondrial marker primers

[0164] The needles of northern pine trees including Pinus densiflora, Pinus sylvestris, Pinus tabuliformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus strobus and Pinus sibirica were taken for extraction of genomic DNA using the CTAB method. The extracted DNA content was adjusted to 30 ng / ml to obtain densiflora DNA solution, Pinus sylvestris DNA solution, Pinus tabuliformis DNA solution, Pinus bungeana DNA solution, Pinus koraiensis DNA solution, Pinus armandii DNA solution, Pinus strobus DNA solution and Pinus sibirica DNA solution.

[0165] Using atp6-F / atp6-R in Table 1 as primers, using genomic DNA solutions of northern pine species such as Pinus dendrobii, Pinus sylvestris, Pinus tabulaeformis, Pinus bungeana, Pinus koraiensis, Pinus armandii, Pinus juncea and Pinus quinquefolia as templates, PCR was performed under the following conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at the optimal temperature for 45 s, extension at 72°C for 1 min, 35 cycles; and final extension for 10 min. The reaction system is as follows:

[0166] Genomic DNA (30 ng / ml) 3 μL, upstream primer F (30 ng / ml) 2 μL, downstream primer R (30 ng / ml) 2 μL, 2×Master Mix 25 μL, ddH2O 18 μL.

[0167] The results are as follows Figure 1 As shown, atp6 can distinguish all tree species except Pinus tabulaeformis and Pinus densiflora, Pinus armandii and Pinus armandii, and can be used for pine species identification and maternal or parental identification of hybrid offspring in the future.

[0168] Example 3 Mitochondrial marker primers Primer verification (hybrid variety verification)

[0169] Hybridization Validation

[0170] The needles of 30 hybrid pine trees (Pinus tabulaeformis ♂×Pinus thunbergii ♀) with clear sources were taken and genomic DNA was extracted using the CTAB method. The extracted DNA content was adjusted to 30 ng / ml to obtain genomic DNA solutions of 30 hybrid pine trees.

[0171] Using mitochondrial atp6 (atp6-F / atp6-R) as primers and genomic DNA solutions of 30 hybrid pines as templates, PCR was performed under the conditions of pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at the optimal temperature (optimum temperature is shown in Table 1) for 45 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min. The reaction system (50 μL system) is as follows:

[0172] 3 μL of pine DNA (30 ng / ml), 2 μL of upstream primer F (30 ng / ml), 2 μL of downstream primer R (30 ng / ml), 25 μL of 2×Mix enzyme (Novozyme P222-03-AA), 18 μL of ddH2O, a total of 50 μL. The results of gel excision and sequencing are as follows:

[0173] The sequences amplified by the atp6-F / atp6-R primer pair are consistent with the above sequence 8, as follows:

[0174] CCACTTGAGCAATCTGCCATTATCCCATTTTATCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCG GCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCTGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAG TGACAAGTCATTTTATCATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCAT TGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGCCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0175] The results showed that in the sequence comparison results of 30 hybrid pine trees with northern pine trees, the pine trees with SNP237 being T, had white pine as their mother, which was consistent with the actual situation.

[0176] Hybridization Validation II

[0177] The needles of 30 hybrid pine trees (Pinus sylvestris ♂×Pinus koraiensis ♀) obtained by artificial controlled pollination (emasculation, bagging and pollination) were used to extract genomic DNA using the CTAB method. The extracted DNA content was adjusted to 30 ng / ml to obtain genomic DNA solutions of 30 hybrid pine trees.

[0178] Using atp6 (atp6-F / atp6-R) as primers and genomic DNA solutions of 30 hybrid pines as templates, PCR was performed under the conditions of pre-denaturation at 94°C for 5 min; denaturation at 94°C for 45 s, annealing at the optimum temperature (the optimum temperature is shown in Table 1) for 45 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min. The reaction system (50 μL system) is as follows:

[0179] 3 μL of pine DNA (30 ng / ml), 2 μL of upstream primer F (30 ng / ml), 2 μL of downstream primer R (30 ng / ml), 25 μL of 2×Mix enzyme (Novozyme P222-03-AA), 18 μL of ddH2O, a total of 50 μL. The results of gel excision and sequencing are as follows:

[0180] The sequences amplified by the atp6-F / atp6-R primer pair are consistent with the above sequence 5, as follows:

[0181] CCACTTGAGCAATCTGCCATTATCCCATTTTATCCTATGAATATAGGAAACTTGTATTTCCCATTCACAAATCCATCTTTGTCCATGCCGCTAACTATCAGTTCAGTCTTGCTCTTGGTTCATTTCGTTACTAAGAACGGAGGGGGAAACTCAGTACCAAATGCTCG GCAATCCTCGGTAGAGCTTATTCATGATTTCGTGCCGAACCTGGTGAACGAACAAATAGGTGGTCTTTCCGGAAATGTTAAGCAAAAGTCTTCCCCTCGCATCTCGGTCACTCTTACTTCTTCGTCATTTCGTAATCCCCAGGGTATGATACCATATAGCTCCACAG TTACAAGTCATTTTATCATTACTTCGGGTCTCCCATTTTCGATTTCTATTGGAATTACTATAGTGGGATCTCAAATACATGGGCTTCATTTTTCCAGCTTCTCATCACCCGCAGGAGTACCACTGCCGTTAGCACCTTTCTCAGTACTCCTTGAGCTAATCCCTCAT TGTTTCCGCGCATCAAGCTTAGGAATACGTTTATCCGCTAATATGATGGCTGGTCATAGTTCAGTAAAGATCCCAAGTGGGTTCGCTCGGACTATGTCATGTATGAATAATATTATGTATTCCATAGGAGATCCGGGTCCTCTATCAATAGTTTTTGCACCGACCGGT

[0182] The results showed that among the sequence comparison results of 30 hybrid pine trees with northern pine trees, those with SNP336 being T and SNP598 being T had a mother plant of Pinus koraiensis, which was consistent with the actual situation.

[0183] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a substance for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646 in identifying a pine parent to be tested or in preparing a product for identifying a pine parent to be tested; The SNP237 is a SNP in pine mitochondria, which is the 237th nucleotide of sequence 1, which is C or T; The SNP336 is a SNP in pine mitochondria, which is the 336th nucleotide of sequence 1, which is G or T; The SNP351 is a SNP in pine mitochondria, which is the 351st nucleotide of sequence 1, and is A or C; The SNP412 is a SNP in pine mitochondria, which is the 412th nucleotide of sequence 1, and is A or C; The SNP598 is a SNP in pine mitochondria, which is the 598th nucleotide of sequence 1, which is C or T; The SNP646 is a SNP in pine mitochondria, which is the 646th nucleotide of sequence 1, and is T or C.

2. Application, characterized in that, The application is any of the following: 1) Use of a substance for detecting SNP237 in preparing a product for identifying whether the pine tree parent to be tested is from white pine; 2) Use of a substance for detecting SNP412 in preparing a product for identifying whether the pine tree parent to be tested is from Pinus sylvestris var. mongolica; 3) Use of a substance for detecting SNP646 in preparing a product for identifying whether the pine tree parent to be tested is from North American pine; 4) Application of substances for detecting SNP336 and SNP598 in the preparation of products for identifying whether the pine tree parent to be tested is from Korean pine; 5) Use of substances for detecting SNP351 and SNP412 in preparing products for identifying whether the pine tree parent to be tested is from pine tree A, wherein the pine tree A group includes red pine and Chinese pine; 6) Use of substances for detecting SNP336, SNP598 and SNP646 in preparing a product for identifying whether the pine tree parent to be tested is from pine tree A, wherein the pine tree A group includes Xinjiang pentaphyllum and Armand pine; The SNP237 is a SNP in pine mitochondria, which is the 237th nucleotide of sequence 1, which is C or T; The SNP336 is a SNP in pine mitochondria, which is the 336th nucleotide of sequence 1, which is G or T; The SNP351 is a SNP in pine mitochondria, which is the 351st nucleotide of sequence 1, and is A or C; The SNP412 is a SNP in pine mitochondria, which is the 412th nucleotide of sequence 1, and is A or C; The SNP598 is a SNP in pine mitochondria, which is the 598th nucleotide of sequence 1, which is C or T; The SNP646 is a SNP in pine mitochondria, which is the 646th nucleotide of sequence 1, and is T or C.

3. A method, characterized in that The method is any of the following: M1) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Pinus leucophylla, comprising detecting SNP 237 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Pinus leucophylla according to the detection result, wherein the SNP 237 is from the SNP 237 of claim 1; If the SNP237 of the pine tree to be tested is T, the maternal parent of the pine tree to be tested is from Pinus thunbergii; if the SNP237 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is not from Pinus thunbergii; M2) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Pinus sylvestris, comprising detecting SNP412 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Pinus sylvestris according to the detection result, wherein the SNP412 is from the SNP412 of claim 1; If the SNP412 of the pine tree to be tested is A, the maternal parent of the pine tree to be tested is from Pinus sylvestris var. mongolica; if the SNP412 of the pine tree to be tested is C, the maternal parent of the pine tree to be tested is not from Pinus sylvestris var. mongolica; M3) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from a North American pine, comprising detecting SNP646 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from a North American pine according to the detection result, wherein the SNP646 is the SNP646 described in claim 1; If the SNP646 of the pine tree to be tested is C, the female parent of the pine tree to be tested is from North American pine; If the SNP646 of the pine tree to be tested is T, then the female parent of the pine tree to be tested is not from North American pine; M4) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is from Korean pine, comprising detecting SNP336 and SNP598 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is from Korean pine according to the detection result, wherein the SNP336 is the SNP336 described in claim 1, and the SNP598 is the SNP598 described in claim 1; If SNP336 of the pine tree to be tested is T and SNP598 is T, the maternal parent of the pine tree to be tested is from Pinus koraiensis; otherwise, the maternal parent of the pine tree to be tested is not from Pinus koraiensis; M5) A method for identifying or assisting in identifying whether the pine tree mother parent to be tested is from pine tree A, comprising detecting SNP351 and SNP412 in the mitochondria of the pine tree to be tested, and determining whether the pine tree mother parent to be tested is from pine tree A according to the detection result, wherein the SNP351 is the SNP351 described in claim 1, the SNP412 is the SNP412 described in claim 1, and the pine tree A group is red pine and Chinese pine; If the SNP351 of the pine tree to be tested is A and the SNP412 is C, then the maternal parent of the pine tree to be tested comes from pine tree A; otherwise, the maternal parent of the pine tree to be tested does not come from pine tree A; M6) A method for identifying or assisting in identifying whether the maternal parent of a pine tree to be tested is derived from pine tree A, comprising detecting SNP336, SNP598 and SNP646 in the mitochondria of the pine tree to be tested, and determining whether the maternal parent of the pine tree to be tested is derived from pine tree A according to the detection results, wherein the SNP336 is the SNP336 described in claim 1, the SNP598 is the SNP598 described in claim 1, the SNP646 is the SNP646 described in claim 1, and the pine tree A group includes Xinjiang pentaphyllum and Armand pine; If SNP336 of the pine tree to be tested is T, SNP646 is T, and SNP598 is C, then the maternal parent of the pine tree to be tested comes from pine tree A; otherwise, the maternal parent of the pine tree to be tested does not come from pine tree A. The SNP237 is C, which means that the 237th nucleotide of sequence 1 is C; The SNP237 is T, which means that the 237th nucleotide of sequence 1 is T; The SNP336 is G, which means that the nucleotide at position 336 of sequence 1 is G; The SNP336 is T, which means that the nucleotide at position 336 of sequence 1 is T; The SNP351 is C, which means that the nucleotide at position 351 of sequence 1 is C; The SNP412 is A when the 412th nucleotide of sequence 1 is A; The SNP412 is C when the 412th nucleotide of sequence 1 is C; The SNP598 is C when the 598th nucleotide of sequence 1 is C; The SNP598 is T means that the 598th nucleotide of sequence 1 is T; The SNP646 is T means that the 646th nucleotide of sequence 1 is T; The SNP646 is C, which means the 646th nucleotide of sequence 1 is C.

4. The product, characterized in that The product is any of the following: P1) a product for identifying or assisting in identifying whether the pine tree parent to be tested is from white pine, comprising a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is the SNP237 described in claim 1; P2) a product for identifying or assisting in identifying whether the pine tree mother to be tested is from Pinus sylvestris var. mongolica, comprising a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is SNP412 as described in claim 1; P3) a product for identifying or assisting in identifying whether the pine tree parent to be tested is from North American pine, comprising a substance for detecting a SNP of the pine tree to be tested, wherein the SNP is SNP646 as described in claim 1; P4) a product for identifying or assisting in identifying whether the pine tree mother to be tested is from Korean pine, comprising a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP336 and SNP598 described in claim 1; P5) identifying or assisting in identifying whether the pine tree parent to be tested is a product of pine tree A, wherein the pine tree A component is red pine and Chinese pine, and comprising a substance for detecting SNPs of the pine tree to be tested, wherein the SNPs are SNP351 and SNP412 as described in claim 1; P6) Identifying or assisting in identifying whether the pine tree mother to be tested is a product of pine tree A, wherein the pine tree A component is Xinjiang pentaphyllum and Armand pine, and comprising a substance for detecting the SNP of the pine tree to be tested, wherein the SNP is SNP336, SNP598 and SNP646 as described in claim 1.

5. The use according to claim 1 or 2, the method according to claim 3, and the product according to claim 4, characterized in that: The product of the substance for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646 is as follows D1), D2), D3) or D4): D1) contains in vitro nucleic acid amplification primers for specific amplification and detection of the SNP; D2) an in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primer described in D1); D3) a kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2); D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2) or the kit described in D3).

6. The use, product or method according to claim 5, characterized in that: The in vitro nucleic acid amplification primers include a primer pair e for amplification; the primer pair e consists of primers eF and eR; The primer eF is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 10; the primer eR is a single-stranded nucleotide molecule whose nucleotide sequence is sequence 11.

7. Use of a substance for detecting a pine parent to be tested in identifying a pine parent to be tested or preparing a product for identifying a pine parent to be tested; the substance for detecting a pine parent to be tested is a substance for detecting SNP237, SNP336, SNP351, SNP412, SNP598 and / or SNP646; The SNP237 is a SNP in pine mitochondria, which is the 237th nucleotide of sequence 1, which is C or T; The SNP336 is a SNP in pine mitochondria, which is the 336th nucleotide of sequence 1, which is G or T; The SNP351 is a SNP in pine mitochondria, which is the 351st nucleotide of sequence 1, and is A or C; The SNP412 is a SNP in pine mitochondria, which is the 412th nucleotide of sequence 1, and is A or C; The SNP598 is a SNP in pine mitochondria, which is the 598th nucleotide of sequence 1, which is C or T; The SNP646 is a SNP in pine mitochondria, which is the 646th nucleotide of sequence 1, and is T or C.

8. Application of sequence 1 in the preparation of products for identifying the maternal or parental origin of pine trees.

9. Application of sequence 1 in identifying the maternal or parental origin of pine trees.

10. The nucleotide sequence shown in SEQ ID NO: 1.

Images