A molecular marker related to drought resistance of alfalfa on chromosome 2 and application thereof

Abstract

The application provides a drought-resistance related molecular marker of Medicago sativa on chromosome 2 and an application thereof, and belongs to the technical field of biotechnology. The nucleotide sequence of the inserted or deleted fragment is shown in the sequence table SEQ ID NO. 3. The primer pair for amplifying the InDel molecular marker has the nucleotide sequences shown in SEQ ID NO. 1-2. The molecular marker and the primer pair thereof can identify or assist in identifying the drought-resistance trait of Medicago sativa. Meanwhile, the application also provides a method for rapidly identifying the drought-resistance of Medicago sativa by using the molecular marker. The method is simple and fast, the identification result is accurate, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a molecular marker related to drought resistance of alfalfa located on chromosome 2 and an application thereof. Technical Background

[0002] During the breeding process, the selection of target traits is deeply influenced by both genotype and phenotype. Traditional breeding relies on the identification and evaluation of plant appearance characteristics, but this is subject to certain limitations. Traditional methods are time-consuming, requiring years of observation and breeding to determine the genetic stability of target traits. Furthermore, appearance characteristics are easily affected by the environment, leading to uncertain results. Molecular marker-assisted selection technology, however, offers unique advantages in breeding practice. By leveraging the association between genetic markers and target traits for selection, individuals or genotypes possessing target traits can be identified more accurately and rapidly. By analyzing molecular markers in the genome, breeders can better understand the relationship between genotype and traits, allowing them to more precisely select individuals with superior traits for breeding.

[0003] Genome-wide association analysis (GWA) has attracted considerable attention in the field of breeding. By analyzing the associations between a large number of genetic markers and target traits, key genes or loci associated with these traits can be identified. The research and application of this technology has become a major hotspot and competitive area in current breeding. Drought-resistant breeding in alfalfa (Medicago sativa L.) is crucial for improving crop drought tolerance, increasing yields, and reducing resource consumption. Against the backdrop of climate change and increasingly scarce water resources, developing drought-resistant varieties can enhance crop growth and adaptability to drought conditions, reduce disaster risks, maintain agricultural production stability, promote sustainable agricultural development, and increase economic benefits for farmers. This is crucial for ensuring food security and sustainable ecological improvements. Alfalfa breeding started relatively late, and reports on the development and mapping of drought-resistant markers using GWA are very limited. Therefore, the development of molecular markers associated with drought resistance in alfalfa is crucial for establishing assisted selection breeding systems, improving germplasm resources, and breeding new varieties. Summary of the Invention

[0004] One of the objectives of the present invention is to provide an InDel molecular marker related to drought resistance of alfalfa.

[0005] A second object of the present invention is to provide an application of the above-mentioned InDel molecular marker related to drought resistance of alfalfa.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The drought resistance-related InDel molecular marker disclosed in the present invention is located on chromosome 2 of alfalfa, and the molecular marker is named Ms_Chr2_35487620.

[0008] A primer pair was used to amplify the InDel molecular marker related to drought resistance in alfalfa. The primer pair sequence corresponding to the molecular marker Ms_Chr2_35487620 is:

[0009] Ms_Chr2_35487620-F: GACACGAACGTAAAATATAACTGATCAC (shown in SEQ ID NO. 1);

[0010] Ms_Chr2_35487620-R: CGCTGAGATCTGTGGTGGATC (shown in SEQ ID NO. 2).

[0011] The present invention also discloses the use of the aforementioned molecular marker primer pair in drought-resistant assisted breeding of alfalfa. Specifically, the molecular markers of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from leaves at the seedling stage and detecting the presence of the molecular markers of the present invention, drought-resistance-related traits of alfalfa varieties can be identified. The detection can be performed using PCR, specifically the aforementioned molecular marker primer pair. The detection can also be performed using sequencing.

[0012] The present invention also discloses the application of the molecular marker in identifying drought resistance traits of alfalfa, especially in screening and identifying the drought resistance of alfalfa. Specifically, the specific steps for identifying whether alfalfa has drought resistance traits are as follows:

[0013] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the molecular marker Ms_Chr2_35487620 was used for PCR amplification. The PCR amplification reaction system is shown in Table 1:

[0014] Table 1 PCR amplification reaction system

[0015]

[0016] Pre-denaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 15 s; extension at 72°C for 10 min; and storage at 4°C.

[0017] (2) Agarose gel electrophoresis detection of PCR products: Take 3 μL and judge the drought resistance of alfalfa based on the results of the bands.

[0018] PCR amplification was performed using primer pairs Ms_Chr2_35487620-F and Ms_Chr2_35487620-R. If the PCR amplification product had only one characteristic band with a length of 181 bp as shown in SEQ ID NO.4, the alfalfa was a homozygous drought-sensitive type; if the PCR amplification product had both a characteristic band with a length of 181 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 138 bp as shown in SEQ ID NO.5, the alfalfa was a heterozygous drought-resistant type.

[0019] In addition, the present invention also protects a kit for identifying the drought resistance trait of alfalfa, comprising the primer pair Ms_Chr2_35487620-F and Ms_Chr2_35487620-R. The other components of the kit are conventional reagents, including 10× PCR buffer, dNTPs, and Taq DNA polymerase. The present invention does not impose any particular restrictions on the concentration of the primer pair; primer concentrations well known in the art may be used. The present invention does not impose any particular restrictions on the sources of the 10× PCR buffer, dNTPs, and Taq DNA polymerase; conventional PCR amplification reagents well known in the art may be used.

[0020] The kit of the present invention can be used to quickly identify the drought resistance trait of alfalfa and can also quickly identify the drought resistance genotype of alfalfa. The specific method refers to the specific steps for identifying whether alfalfa has a drought resistance trait. By performing electrophoresis detection and / or sequencing on the PCR amplification product, if the PCR amplification product has only one characteristic band with a length of 181 bp as shown in SEQ ID NO.4, the alfalfa is a homozygous drought-sensitive genotype; if the PCR amplification product has both a characteristic band with a length of 181 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 138 bp as shown in SEQ ID NO.5, the alfalfa is a heterozygous drought-resistant genotype.

[0021] The present invention has the following advantages:

[0022] (1) The inventors of the present invention screened out a molecular marker Ms_Chr2_35487620 related to drought resistance of alfalfa. The molecular marker is located on chromosome 2. The molecular marker Ms_Chr2_35487620 of the present invention can be used to quickly and accurately identify the drought resistance trait of alfalfa.

[0023] (2) Screening with markers linked to drought resistance traits is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, which helps to improve efficiency and save costs.

[0024] (3) The molecular marker of the application has the characteristics of convenient detection, stable amplification product and high specificity, and can be simply, rapidly and high-throughput applied to alfalfa drought-resistant breeding practice and variety identification. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 It is a Manhattan plot obtained based on an EMMAX model analysis result of whole genome association analysis of alfalfa drought tolerance, and the green points represent InDel positions associated in the application.

[0026] Figure 2 It is a genotype distribution box plot of the Ms_Chr2_35487620 locus of the alfalfa population in Example 1 of the application against drought index. 0 / 0 means that the genotype of the Ms_Chr2_35487620 locus is a homozygous drought-sensitive genotype, and 0 / 1 means that the Ms_Chr2_35487620 locus is a heterozygous drought-resistant genotype. The round dots are extreme values of the data, and **** represents P<0.0001.

[0027] Figure 3 It is a partial sequence alignment result of drought-resistant varieties and drought-sensitive varieties in the drought tolerance associated region.

[0028] Figure 4 It is an electrophoresis map of the amplified molecular marker of 16 alfalfa germplasm resources, and the concentration of the agarose gel is 2%. In the figure, M represents a DNA marker. DETAILED DESCRIPTION

[0029] The advantages and characteristics of the application will become clearer with the description. However, the specific experimental methods involved in the following examples are conventional methods or implemented according to the suggested conditions of the manufacturer's instructions unless otherwise specified.

[0030] Unless otherwise specified, the technical means used in the examples is the conventional means familiar to those skilled in the art. The experimental methods in the following examples are conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained from the market.

[0031] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as familiar to those skilled in the art. In addition, any method and material similar or equivalent to those described can be applied in the application. The preferred implementation methods and materials described herein are only for demonstration.

[0032] Example 1 Development of molecular markers related to drought resistance of alfalfa

[0033] The application measures the drought resistance of alfalfa by using a drought resistance index (DRI) of alfalfa. The higher the value, the more drought-resistant the alfalfa is. The lower the value, the less drought-resistant the alfalfa is (drought-sensitive). After measuring the DRI of the alfalfa population, a InDel site (green site) is located in the alfalfa by GWAS analysis, and is named Ms_Chr2_35487620. The site is located at the 35487620th site on chromosome 2 of the alfalfa reference genome, wherein the first allele type is 0 / 0 type; and the second allele type is 0 / 1 type. The genotype of the population Ms_Chr2_35487620 site corresponds to the drought resistance index distribution box plot (Fig. 2), which shows that the drought resistance of the alfalfa strain with the genotype 0 / 1 is significantly higher than that of the alfalfa with the genotype 0 / 0. On the 35487620th site on the 2nd chromosome of the alfalfa, the insertion / deletion fragment GACACTCATACTCCTTGACGACCCAGTATCCTCATCAACATCA (shown in SEQ ID NO. 3) has an effect on the drought resistance of the alfalfa. The alfalfa with the inserted fragment of SEQ ID NO. 3 is drought-sensitive alfalfa, and the alfalfa with the deleted fragment of SEQ ID NO. 3 is drought-resistant alfalfa. Figure 1 Figure 2 Figure 3

[0034] According to the InDel variation and the upstream and downstream sequences thereof, the following primers are designed by using primer 5.0 software:

[0035] Ms_Chr2_35487620-F: GACACGAACGTAAAATATAACTGATCAC (shown in SEQ ID NO. 1);

[0036] Ms_Chr2_35487620-R: CGCTGAGATCTGTGGTGGATC (shown in SEQ ID NO. 2).

[0037] Then, the primers are used for PCR amplification of the to-be-tested sample. It is found that the PCR product of the homozygous drought-sensitive alfalfa sample has only a characteristic band of 181 bp, and the PCR product of the heterozygous drought-resistant alfalfa sample has a characteristic band of 181 bp and a characteristic band of 138 bp.

[0038] Example 2: Verification of the accuracy of the molecular marker described in the application

[0039] 214 accessions are identified, and the specific accessions are shown in Table 2:

[0040] ​​​Table 2 Drought resistance of 214 germplasm materials and the genotypes corresponding to the Ms_Chr2_35487620 locus

[0041]

[0042]

[0043]

[0044] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0045] The PCR amplification reaction system is as follows: 10-100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2× Taq PCR Master Mix, and deionized water to 20 μL. The PCR amplification reaction procedure is preferably as follows: pre-denaturation at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 15 s, followed by extension at 72°C for 10 min, and storage at 4°C. Separation was performed by electrophoresis on a 2% agarose gel, and after spotting, electrophoresis was conducted at 140 V DC for 2 h. PCR banding patterns for each sample were then determined.

[0046] 2) Determining the drought tolerance of alfalfa based on the size of the PCR product: if the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-resistant alfalfa;

[0047] When the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-sensitive alfalfa;

[0048] Specifically, when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 181 bp (SEQ ID NO. 4), and the alfalfa to be identified is drought-sensitive alfalfa.

[0049] The sequence of SEQ ID NO.4 is as follows:

[0050]

[0051] When the PCR product of the alfalfa to be identified is two bands, namely a band in which the fragment shown in SEQ ID NO.3 is inserted and a band in which the fragment shown in SEQ ID NO.3 is deleted, and one band of the PCR product is 181 bp in length and the other is 138 bp (SEQ ID NO.5), then the alfalfa to be identified is a heterozygous drought-resistant alfalfa.

[0052] The sequence of SEQ ID NO.5 is as follows:

[0053]

[0054] Furthermore, as shown in Table 2, of the 214 alfalfa accessions identified in this study, 173 had a genotype of 0 / 0 and 41 had a genotype of 0 / 1. The average drought resistance index of these 173 accessions under drought conditions was 1.0890, indicating drought-sensitive alfalfa. Twenty-three accessions had a genotype of 0 / 1, and the average drought resistance index of these 23 accessions was 1.7300, indicating drought-resistant alfalfa, 0.6410 higher than the average of the 173 drought-sensitive accessions. Analysis of variance indicated that the drought resistance index of drought-sensitive and drought-resistant alfalfa accessions was highly significant (P < 0.0001). Sixteen germplasms ('CF048298', 'Apex', 'Pioneer', 'Thunder', 'Longmu 806', 'Zhongmu 5', 'Caoyuan 1', 'Zhongmu 4', 'Prospect', 'WL202', 'CF048247', 'Longsheng 1174', 'Podus', 'Xinmu 4', 'CF031930', 'Jueneng') were randomly selected and tested by PCR. The test results were consistent with the genotypes and the actual drought resistance index test results ( Figure 4 ), therefore, the InDel molecular marker of the present invention can effectively identify the drought resistance of alfalfa and can be used for the prediction and screening of drought-resistant alfalfa varieties.

[0055] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. An InDel molecular marker located on chromosome 2 and associated with drought resistance in alfalfa, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment GACACTCATACTCCTTGACGACCCAGTATCCTCATCAACATCA on chromosome 2 of the alfalfa reference genome, wherein the alfalfa with the fragment inserted is drought-sensitive alfalfa, and the alfalfa with the fragment deleted is drought-resistant alfalfa. The primer pair sequence corresponding to the InDel molecular marker is: F: GACACGAACGTAAAATATAACTGATCAC; R: CGCTGAGATCTGTGGTGGATC.

2. Use of the primer pair corresponding to the InDel molecular marker according to claim 1 in identifying or assisting in identifying the drought resistance trait of alfalfa.

3. The use according to claim 2, characterized in that The method for identifying drought resistance traits of alfalfa comprises the following steps: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair corresponding to the InDel molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: PCR amplification is performed using the primer pair. If the PCR amplification product has only one characteristic band with a length of 181 bp as shown in SEQ ID NO.4, the alfalfa is a drought-sensitive type; if the PCR amplification product has both a characteristic band with a length of 181 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 138 bp as shown in SEQ ID NO.5, the alfalfa is a drought-resistant type.

4. A kit for identifying drought-resistant genotypes of alfalfa, characterized in that: The kit comprises a primer pair corresponding to the InDel molecular marker according to claim 1.

5. The use according to claim 4, characterized in that The method for identifying the drought-resistant genotype of alfalfa using the kit is as follows: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair corresponding to the InDel molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band of 181 bp in length as shown in SEQ ID NO.4, the alfalfa was a homozygous drought-sensitive genotype; if the PCR amplification product had both one characteristic band of 181 bp in length as shown in SEQ ID NO.4 and one characteristic band of 138 bp in length as shown in SEQ ID NO.5, the alfalfa was a heterozygous drought-resistant genotype.

Images