Candidatus liberobacter asiaticum-resistant compound targeting to phloem bacillus MurD and screening method and application thereof

Abstract

The invention relates to the technical field of biology, in particular to an anti-Huanglongbing compound of targeted phloem bacillus MurD and a screening method and application thereof. The invention discloses a screening method, which is characterized in that a phloem bacillus MurD ligase is used as a new target for screening an anti-Huanglongbing compound, and interaction analysis of a candidate compound and MurD protein is carried out, so that a compound with potential MurD inhibitory activity is efficiently screened out. According to the invention, the three screened small molecule compounds (Nilofabicin, PA-824 and AFN-1252) are further verified on the citrus scion with positive citrus huanglongbing, a high-concentration and short-time treatment mode is adopted, the verification result proves that the Nilofabicin, PA-824 and AFN-1252 can convert the positive scion into negative, the negative conversion rate can reach 41.6%, and meanwhile, a relatively high germination rate is kept. The invention not only accelerates the research and development process of anti-Huanglongbing drugs, but also improves the screening efficiency and accuracy, and provides powerful technical support for effective prevention and treatment of Huanglongbing.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an anti-Huanglongbing compound targeting MurD of Bacillus cereus and a screening method and application thereof. Background Art

[0002] Citrus Huanglongbing (HLB) has severely impacted the citrus industry in many countries and regions around the world, affecting the healthy development of the industry. As of 2021, the area affected in my country has reached 147,000 hm2. 2 , involving about 300 counties in 11 provinces including Guangdong, Fujian, and Hunan, and about 50 million citrus plants have suffered from citrus Huanglongbing. Given that there is currently no effective method to cure Huanglongbing at home and abroad, the industry generally relies on a "three-pronged" comprehensive prevention and control strategy: strengthening psyllid monitoring and prevention, timely felling of diseased trees to reduce the spread of pathogens, and promoting the cultivation of virus-free seedlings. However, these measures all face significant limitations: chemical agents to control psyllids are prone to environmental pollution and drug resistance problems; the cost of felling diseased trees is high, and the economic burden on fruit farmers is heavy, requiring high government subsidies; and the production of virus-free seedlings is limited by the high pathogen infection rate of excellent variety resources, and the detoxification technology is complex and affects the survival rate of seedlings. Therefore, exploring efficient, low-toxic, and economical anti-Huanglongbing drugs has become an urgent need in the field of scientific research. However, the characteristics of the Huanglongbing pathogen, Candidatus Liberibacter, which is difficult to be artificially pure cultured, greatly increase the difficulty of screening antimicrobial drugs by conventional methods.

[0003] Peptidoglycan, also known as murein, is the main component of bacterial cell walls and plays an important role in maintaining cell morphology, size, osmotic pressure stability and cell survival. In the process of peptidoglycan biosynthesis, the MurC-F series of amino acid ligases play an important role. They are involved in the first stage of catalyzing the formation of the pentapeptide tail. The biosynthesis of peptidoglycan is a highly conservative process, and different bacterial species have specificity. Among them, the function of the Mur series ligase is very important. Studies have shown that many important antibiotics can specifically target the biosynthesis process of peptidoglycan. Therefore, the Mur series ligase can be used as a potential target for the study of new antibacterial drugs. Summary of the invention

[0004] In view of this, the present invention proposes to use the MurD ligase of Bacillus subtilis as a new target for screening anti-Huanglongbing compounds, and through the interaction analysis between candidate compounds and MurD protein, efficiently screen out compounds with potential MurD inhibitory activity, which significantly enhances the high specificity and effectiveness of the screening process.

[0005] To this end, the present invention constructs a recombinant expression system of the murD gene, expresses and purifies the MurD protein in the host bacteria, and then performs interaction analysis with candidate compounds to screen out candidate drugs for anti-Huanglongbing that can effectively inhibit MurD. Further, the three small molecule compounds (Nilofabicin, PA-824 and AFN-1252) screened out were verified on Huanglongbing-positive citrus scions, using a high-concentration, short-time treatment method. The verification results confirmed that Nilofabicin, PA-824 and AFN-1252 effectively increased the negative conversion rate of positive scions, while maintaining a high germination rate. The present invention not only accelerates the research and development process of anti-Huanglongbing drugs, but also improves screening efficiency and accuracy, providing strong technical support for the effective prevention and treatment of Huanglongbing.

[0006] The technical solution of the present invention is achieved in this way:

[0007] In a first aspect, the present invention provides a method for screening anti-Huanglongbing compounds targeting Candidatus Liberibacter MurD, comprising the following steps:

[0008] S1. Transforming a recombinant expression vector containing a target gene fragment into a host bacterium to obtain a recombinant expression strain, wherein the target gene fragment includes a DNA sequence encoding a MurD ligase having an amino acid sequence as shown in SEQ ID NO.1;

[0009] S2, inducing the recombinant expression strain to express the target protein MurD, separating and purifying the target protein, and using SDS-PAGE gel electrophoresis to detect and analyze, and then collecting the purified protein;

[0010] S3. Determine the ability of candidate compounds to interact with purified protein MurD, and screen out compounds that can bind to purified protein MurD as anti-Huanglongbing compounds targeting Bacillus subtilis MurD.

[0011] In some preferred embodiments, the method for screening anti-Huanglongbing compounds targeting MurD of Bacillus phloem, further comprises the steps of:

[0012] S4, randomly divide the citrus Huanglongbing positive scions into an experimental group and a CK group, the experimental group is treated with the compound screened in step S3; the CK group is treated with clean water; the scions are cultured under the same conditions until they sprout, and then qPCR is used to detect the pathogen using the DNA of the apical meristem of the new bud as a template; if the Huanglongbing negative rate of the experimental group is higher than that of the CK group, the verification results show that the screened compound has an inhibitory effect on the Huanglongbing pathogen. Among them, in some embodiments,

[0013] The length of the positive scion is 6-8 nodes / strip, the compound screened in step S3 to be verified is configured into a solution with a concentration of 50-200 μM, and the treated positive scion is cut into a prepared culture medium containing 1 / 3 peat, 1 / 3 vermiculite, and 1 / 3 soil; the cutting container is a culture box made of PC material with a height of 9 cm, a length of 7.5 cm, and a width of 7.5 cm; 1 / 4MS culture solution containing 50-200 μM of the compound to be verified is used for spraying treatment, once every 3 days, and 10 mL is sprayed each time; and the culture is carried out under the conditions of a constant temperature of 26±1°C, a light intensity of 4000lx, and alternating light and dark for 12 hours each.

[0014] In some preferred embodiments, the step S1 specifically further includes:

[0015] A1, using genomic DNA extracted from citrus leaves carrying Huanglongbing as a template, and using the forward and reverse primer sequences as shown in SEQ ID NO.2-3, respectively, to amplify the target gene fragment by PCR;

[0016] A2. Use BamHI and Xho I enzymes to connect the PCR product to the linearized vector pET28a-SUMO, respectively, and then transform it into E.coli DH5α competent cells. After extracting the recombinant plasmid from the transformed DH5α cells, perform gene sequencing; transform the plasmid with the correct gene sequencing result into E.coli BL21 competent cells to obtain a recombinant expression strain.

[0017] In some preferred embodiments, the step S2 specifically further includes:

[0018] B1, culturing the recombinant expression strain with LB medium, and then inducing with IPTG to express the target protein;

[0019] B2. The separation of the target protein includes removing imidazole by dialysis and removing the SUMO tag by ULP1 protease cleavage; the chromatography includes nickel column affinity chromatography, gel filtration chromatography and anion exchange chromatography.

[0020] In some preferred embodiments, step S3 specifically further comprises: using isothermal titration calorimetry to determine the binding constant Ka of each candidate compound and the purified protein MurD. In some embodiments, the concentration of the candidate compound solution is 50-500 μM, and the concentration of the MurD protein solution is 20-50 μM; the parameter settings of the isothermal titration calorimetry include: number of drops 10, time interval between each drop 120 s, power 10 μCal / s, and stirrer speed 250 r / min.

[0021] In a second aspect, the present invention provides an anti-Huanglongbing compound targeting MurD of Bacillus spp. obtained by any of the above-mentioned screening methods for anti-Huanglongbing compounds targeting MurD of Bacillus spp. Further, the anti-Huanglongbing compound includes: Nilofabicin, PA-824 or AFN-1252.

[0022] In a third aspect, the present invention also provides the use of anti-Huanglongbing compounds targeting MurD of Bacillus subtilis in the prevention and treatment of Huanglongbing, wherein the anti-Huanglongbing compounds are obtained by screening by any of the above-mentioned screening methods for anti-Huanglongbing compounds targeting MurD of Bacillus subtilis, and / or the anti-Huanglongbing compounds include Nilofabicin, PA-824 or AFN-1252.

[0023] The beneficial effects of the present invention include at least the following:

[0024] (1) The present invention uses the MurD ligase of Bacillus subtilis as a new target for screening anti-Huanglongbing compounds, and through the interaction analysis between candidate compounds and MurD protein, efficiently screens out compounds with potential MurD inhibitory activity. The screening method provided in this aspect significantly enhances the high specificity and effectiveness of the screening process. At the same time, the present invention can quickly identify compounds with potential anti-Huanglongbing activity, greatly shortening the cycle from initial screening of the compound library to verification of anti-disease activity, and providing a timely and effective solution for the prevention and control of Huanglongbing. The research results of the present invention help to reveal the key role of MurD ligase in the occurrence and development of Huanglongbing, provide a theoretical basis for the prevention and control of Huanglongbing, and provide ideas and methods that can be used as reference for the study of other plant diseases.

[0025] (2) The small molecule compounds Nilofabicin, PA-824 and AFN-1252 screened out by the present invention have anti-Huanglongbing effects. For example, the small molecule compound AFN-1252 with a detoxification rate of 41.6% has significant potential in scion treatment, indicating that it can significantly improve the success rate of cultivating disease-free seedlings. Compounds such as AFN-1252 are of great value for the detoxification of stem tip micro-bud grafting, and they are time-saving, simple and easy to operate. They can reduce the virus-carrying rate of stem tip materials in advance, providing more effective stem tip materials for improving the detoxification rate of virus-free seedlings. In view of the fact that conventional grafting reproduction also relies on healthy scion materials with low pathogen titers, the use of compound pretreatment of scions and combined with molecular detection technology can further optimize the acquisition rate of healthy seedlings. Therefore, the technical solution provided by the present invention provides a new way to obtain healthy seedlings for the breeding of disease-free citrus varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0027] Figure 1 The peak diagram of MurD protein-ion exchange in the purification of MurD protein of the present invention, the arrow indicates the protein peak of MurD;

[0028] Figure 2 The figure is the SDS-PAGE gel electrophoresis analysis of different collection tubes of MurD protein-ion exchange in the purification of MurD protein of the present invention, wherein the relative molecular weight of 64.42 KDa is the MurD protein with a solubilizing tag;

[0029] Figure 3 This is the interaction analysis between MurD protein and the small molecule compound Nilofabicin. Ratio represents the molar ratio of protein to small molecule compound.

[0030] Figure 4 Analysis of the interaction between MurD protein and small molecule compound PA-824;

[0031] Figure 5 Analysis of the interaction between MurD protein and the small molecule compound AFN-1252. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0033] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0034] The terms "including" and "having" and any variations thereof of the present invention are intended to cover non-exclusive inclusions. For example, a process, method, device, product or equipment comprising a series of steps is not limited to the listed steps or modules, but may optionally include steps not listed, or may optionally include other steps inherent to these processes, methods, products or equipment.

[0035] In the present invention, the term "multiple" refers to two or more than two. "And / or" describes the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B can represent the following three situations: A exists alone, A and B exist at the same time, and B exists alone. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0036] The molecular detection method of the citrus Huanglongbing pathogen in the embodiment of the present invention is as follows:

[0037] 1. Sampling method

[0038] For plant sampling, select the 3rd to 5th leaves that are mature and mechanically undamaged on the main branches in the east, south, west, and north of each citrus plant for mixed sampling, cut the midrib of the leaf, and freeze it in liquid nitrogen for DNA extraction. Extract the total DNA of the plant leaf veins. For scions, collect the bark of the branch containing the phloem for sampling. For newly sprouted buds, the new buds on each branch tip are mixed and sampled as one sample.

[0039] 2. DNA Extraction and Molecular Detection Methods

[0040] The genomic DNA can be extracted from citrus leaves by using the modified CTAB method (Chen Kunsong, Li Fang, Xu Changjie, et al. Improved CTAB method for large-scale extraction of genomic DNA from perennial plant tissues [J]. Heredity, 2004, 26 (4): 3. DOI: 10.3321 / j.issn: 0253-9772.2004.04.024.). The extracted DNA was tested by qPCR. The reaction system and conditions are shown in Table 1. Real-time fluorescence quantitative PCR instrument QuantStudio5 (purchased from Thermo Fisher Scientific, USA). The internal reference gene is the plant cytochrome oxidase gene COX, and the primers are COX + / COX - The target gene is the ribosomal protein gene rplJ / rplL of the Asian pathogen of citrus Huanglongbing, and the primer is RNR + / RNR-, the primer sequence information is shown in Table 2. The relative expression of the experimental data gene was calculated using 2 -ΔΔCT The DNA of healthy summer orange callus (as negative control) was analyzed by -ΔΔCT Set to 1, if the sample 2 -ΔΔCT A value greater than 1 is considered a positive disease plant.

[0041] Relative expression Fluorescence quantitative calculation formula:

[0042] Relative quantification: The most commonly used is the -ΔΔCT method

[0043] ΔCT(target gene)=CT(target gene in test cells)-CT(target gene in control cells)

[0044] ΔCT(reference gene)=CT(test cell reference gene)-CT(control cell reference gene)

[0045] ΔΔCT=ΔCT(target gene)-ΔCT(reference gene)

[0046] The ratio of the target gene expression in the test cells to that in the control cells = 2 -ΔΔCT

[0047] Table 1 qPCR reaction system and reaction procedure

[0048]

[0049] Table 2 Primers for qPCR detection of citrus Huanglongbing

[0050]

[0051] Example 1 Screening of anti-Huanglongbing compounds targeting MurD of Bacillus phloem

[0052] 1. Gene sequence selection and primer design

[0053] The gene sequence encoding the MurD ligase with an amino acid sequence as shown in SEQ ID NO.1 is taken as an example of the murD gene sequence in the peptidoglycan synthesis pathway in the genome of the Asian citrus Huanglongbing pathogen Candidatus Liberibacter asiaticus str.psy62 (GenBank accession number: CP001677.5) in the NCBI database. Primers were designed and evaluated using the primer design software PrimerPremier 5.0. BamH I and Xho I restriction enzyme sites were selected.

[0054] The primers were synthesized by Wuhan Qingke Biotechnology Co., Ltd. The primer sequences are as follows:

[0055] Primer name sequence SEQ ID NO <![CDATA[murD + ]]> CGCGGATCCATGAAATTAAGTAGCTTT 2 <![CDATA[murD - ]]> CCGCTCGAGTTACCATAGAGATTTCC 3

[0056] 2. Construction of recombinant expression vector

[0057] Using the modified CTAB method, genomic DNA was extracted from citrus leaves carrying Huanglongbing, and the gene fragment was amplified according to the following 33 cycles: denaturation at 95°C for 30s, annealing at 56°C for 30s, and extension at 72°C for 1min. The product fragment was recovered using a gel recovery kit (purchased from Kangwei Century Biotechnology Co., Ltd.). The recombinant expression vector was constructed, and the target fragment and the vector pET28a-SUMO were digested according to the system in Table 3, and then connected according to the system in Table 4.

[0058] Table 3 Enzyme digestion reaction system

[0059] Reaction system Volume (μL) DNA ≤1 μg B H 1 XOt 1 10×QuickCutBuffer 3 <![CDATA[ddH2O]]> upto3

[0060] Table 4 Enzyme-linked reaction system

[0061] Reaction system Volume (μL) Purpose fragment 4 Carrier 2 T4DNALiga 1 10×T4 DNA Ligase Buffer 1 <![CDATA[ddH2O]]> upto10

[0062] Transform the vector into competent cells E.coli DH5α, take 50μL of bacterial solution and spread it on LB plate containing 50mg / L Amp, and incubate it inverted in a 37℃ incubator overnight. Pick a single clone and place it in LB liquid medium containing 50mg / L Amp, and culture it at 37℃ with shaking at 180r / min for 3-5h to extract the recombinant plasmid DNA. + , murD- as upstream and downstream primers, and PCR detection was performed. The amplified products were subjected to agarose electrophoresis, and the recombinant plasmid with the correct target band was sent to Qingke Biotechnology Co., Ltd. for sequencing. The plasmid with the correct sequencing result was transformed into E.coli BL21 (DE3) competent cells.

[0063] 3. Target protein expression

[0064] The cells were cultured at 37°C in LB medium, induced with 0.3 mM IPTG after 24 h, and the cells were collected after 3 h of culture.

[0065] 4. Protein separation and purification

[0066] The cells were broken with an ultrasonic disruptor, centrifuged at 8000g for 10 minutes, and the supernatant was collected. The supernatant was eluted with nickel column affinity chromatography, and the supernatant was incubated with the balanced nickel column filler for 30 minutes to allow the target protein to bind tightly to the nickel column, and then allowed to flow out naturally. The column was washed with 25ml of 20mM Tris, 500mM NaCl, 30mM imidazole buffer and 20mM Tris, 500mM NaCl, 500mM imidazole buffer, and the effluent was collected. The samples before and after induction, supernatant, eluate and precipitate were retained for subsequent SDS-PAGE electrophoresis analysis. After a small amount of expression, it was determined that the protein could be expressed and soluble protein was produced in the supernatant.

[0067] The target protein needs to be dialyzed to remove imidazole, then centrifuged at 4°C and 12,000 r / min for 30 min to remove the precipitate, and the supernatant is slowly added to the equilibrated purification column to flow through the purification column; connect to the flow-through solution.

[0068] A Superdex200 gel filtration chromatography column was used on an AKTApure 25L protein purification system (purchased from General Electric Company, USA), the protein peak curve was observed, and the peak tip samples were collected for 12% SDS-PAGE gel electrophoresis and used for subsequent analysis. A Q HP anion exchange chromatography column was used on an AKTApure25L protein purification system, and the elution buffer was a low salt buffer (20mmol / LTris-HCl pH=8.0, 20mmol / LNaCl) and a high salt buffer (20mmol / LTris-HCl pH=8.0, 1mol / LNaCl). The flow rate was set to 1mL / min and the pressure was set to 2MPa. The SQ HP chromatography column was rinsed with a high salt buffer for two column volumes, and then the Q HP chromatography column was rinsed with a low salt buffer for two column volumes. The concentration gradient elution mode was set, and the sample was completely eluted, and the protein peak curve (such as Figure 1 The peak samples were collected and subjected to 12% SDS-PAGE gel electrophoresis. Figure 2 As shown, the analysis results show that the relative molecular weight of the SUMO-MurD protein obtained after ion exchange chromatography is 64.42KDa, and the MurD protein with the soluble tag is used for subsequent analysis. (The SUMO-MurD protein with the SUMO soluble tag can be digested with ULP to obtain a 53.16KD MurD protein. The amino acid number of MurD is 468aa, but it is unstable and will produce precipitation. Therefore, the SUMO-MurD protein with the SUMO soluble tag 64.42KD is used for subsequent analysis.)

[0069] Prepare 12% polyacrylamide gel. Take 40μL of collected protein sample and 10μL loading buffer, mix well, boil in water bath for 10min, centrifuge at 12000r / min for 5min, and then take 10μL of treated sample for loading. Perform electrophoresis at 180V, take out the gel, stain for several hours, and use destaining solution until the protein bands are clearly visible and the background is transparent. Thus, the tube number of the purest protein can be determined. Add the protein sample to a Millipore ultrafiltration centrifuge tube. The relative molecular weight of the ultrafiltration tube in this experiment is 30kDa. Set the centrifugation at 4℃ and 4500r / min, transfer the supernatant to a new centrifuge tube, collect the protein, and use it for interaction analysis between protein and candidate compounds after measuring the concentration.

[0070] 5. Interaction test between MurD protein and candidate compounds

[0071] Before the isothermal titration calorimetry (ITC) experiment, the concentration of the purified MurD protein was 20-50 μM, and the concentration of each candidate small molecule compound (purchased from MCE) was 50-500 μM, and the concentration was adjusted according to the specific experimental conditions. The titration parameters were set to 10 drops, 120 seconds between drops, 10 μCal / s power reference value, 250 r / min stirrer speed, 25 ° C temperature, 2-3 μL volume of each titration sample, and 5 seconds interval between each data collection; after the experiment, the data was processed and analyzed using Analyzer analysis software to determine the binding constant Ka (used to quantify the ability of molecules to form stable complexes, that is, the strength of the interaction between substances).

[0072] Through the analysis of the interaction between MurD protein and candidate compounds, such as Figure 3-5 As shown in the figure, the results showed that the binding constants Ka of MurD with three small molecule compounds Nilofabicin, PA-824 and AFN-1252 were 1.932e+06, 7.887e+05 and 7.876e+05, respectively, proving that there is an interaction between the protein and the small molecule compounds. Nilofabicin, PA-824 and AFN-1252 are potential inhibitors of Huanglongbing pathogen targeting MurD ligase of Bacillus phloem.

[0073] Example 2 Validation of anti-Huanglongbing compounds targeting MurD of Bacillus phloem

[0074] 1. Source of Huanglongbing positive scion

[0075] The Huanglongbing positive scion material used in this example was derived from the Gannan Citrus Research Institute in Jiangxi Province. On October 11, 2023, 12 Newhall navel orange branches were received from Gannan, which were collected from 12 Newhall navel orange trees with obvious Huanglongbing symptoms. On October 12, 2024, the phloem-containing branch bark and leaf veins were sampled and stored in liquid nitrogen. qPCR detection was performed using RNR as the target gene and COX as the internal reference gene, and the results showed that all samples were positive.

[0076] 2. Collection of Huanglongbing-positive scions and pathogen detection

[0077] On October 22, 2024, Newhall navel orange scions from southern Jiangxi were received. This batch of scions came from Huanglongbing-positive plants that had been pre-tested by qPCR molecular testing. They were collected from 4 Newhall navel orange trees showing severe symptoms of Huanglongbing, with a total of 110 branches. First, soak the citrus Huanglongbing-positive scions in detergent for 10 minutes, rinse them with clean water, and soak them in Bijieshi disinfectant for 30 minutes. Follow the instructions of Bijieshi Environmental Protection New Technology Development Co., Ltd., and then rinse them with clean water for 10 minutes. That night, a relatively consistent scion was selected for sampling, and the bark of the branches containing phloem was extracted and stored in liquid nitrogen for qPCR detection and analysis. DNA extraction and qPCR re-testing of the samples were carried out on October 25-26, 2024, and the scions were subsequently used for small molecule compound antibacterial treatment tests.

[0078] 3. Small molecule compound scion treatment method

[0079] Through preliminary tests, it was determined that a solution of a certain concentration would be used for the scion test. In November 2023, three small molecule compounds, Nilofabicin, PA-824 and AFN-1252, were used to treat citrus Huanglongbing-positive scions; Triclosan, a small molecule compound known to have anti-Huanglongbing effects, was used to treat positive scions as a positive control group; 12 replicates of scions were set for each treatment. At the same time, clear water treatment was set as the CK negative control group. (The method in Example 1 was used to conduct an interaction test on Triclosan and MurD protein, and the results showed that its binding constant Ka was 1.555e+06.)

[0080] Weigh the powder of small molecule compound, add 1% DMSO in the test tube to promote the dissolution of small molecule compound, prepare a 1mM solution, then add sterile water to make up the volume, dilute to the required concentration for use. The length of Newhall navel orange branches is kept at 6-8 nodes / strip, and 12 replicates are set for each treatment. The treated positive scion is cut into a prepared culture medium containing 1 / 3 peat, 1 / 3 vermiculite, and 1 / 3 soil. The container is a culture box made of PC material with a height of 9cm, a length of 7.5cm, and a width of 7.5cm. It is sprayed with 1 / 4MS culture solution containing small molecule compounds. Each treatment is once every 3d, and 10mL is sprayed once. The scion is placed in a GNP-9080 constant temperature incubator (purchased from Shanghai Jinghong Experimental Equipment Co., Ltd.) at 26±1℃, with a light intensity of 4000lx, and cultured under conditions of alternating light and darkness for 12h each. The number of buds is observed and recorded every day. The scions of the CK group (10 replicates) were treated with water instead of small molecule compounds, and other management methods were the same as those of the experimental group. During the cutting culture, 1 / 4MS nutrient solution was used to moisturize and supplement nutrients. After 25 days of culture, the sprouted buds (i.e., the apical meristem of the new buds) were collected, and the buds on each branch were mixed and sampled as one sample, frozen and stored in liquid nitrogen, and then qPCR detection of Huanglongbing was performed.

[0081] The test results are shown in Table 5. The negative rates of Huanglongbing after treatment with small molecule compounds Nilofabicin, PA-824 and AFN-1252 were 16.6%, 33.3% and 41.6%, respectively. The negative rate of Huanglongbing after treatment with positive control Triclosan was 25%. The CK control of 10 replicates remained positive, with a positive rate of 100%. It can be seen from the budding on the scion that the peak time of new bud germination is usually between the second and third weeks after cultivation, and the budding rate of the scion reaches an average of 65%.

[0082] Table 5 Changes of pathogens in citrus positive scion before and after treatment

[0083]

[0084]

[0085]

[0086] Note: (1) DNA from healthy summer orange callus was used as negative control. -ΔΔCT=1; + indicates positive, - indicates negative. (2) CK indicates the clean water treatment of the control group. (3) After the hypothesis test of comparing the negative rate percentages of the two samples, when P<0.05, the actual u=2.320, |u|>u0.05=1.96, the difference between the treatment of the small molecule compound AFN-1252 and the control reached a significant level. Two different lowercase letters represent a significant difference (p<0.05).

[0087] The results showed that the small molecule compounds Nilofabicin, PA-824 and AFN-1252 all had inhibitory effects on Bacillus subtilis in living scions. Furthermore, the differences between the small molecule compound AFN-1252 treatment and the positive control and negative control were significant (P<0.05).

[0088] The verification results also show that the small molecule compounds Nilofabicin, PA-824 and AFN-1252 screened by the screening method for anti-Huanglongbing compounds targeting MurD of Bacillus phloem provided by the present invention have effective anti-Huanglongbing effects. It can be seen that MurD ligase is used as a potential antibacterial target against Huanglongbing pathogens to screen small molecule compounds in vitro, and the screened small molecule compounds are verified by scion tests. The qPCR results show that the screened small molecule compounds effectively inhibit Huanglongbing pathogens, proving the accuracy and effectiveness of the screening results.

[0089] In addition, the AFN-1252 small molecule compound provided by the present invention, which has a detoxification rate of 41.6%, has significant potential in scion treatment, indicating that it can significantly improve the success rate of cultivating disease-free seedlings. Compounds such as AFN-1252 are of great value for the detoxification of stem tip micro-bud grafting, and they are time-saving, simple and easy to operate. They can reduce the virus-carrying rate of stem tip materials in advance, and provide more effective stem tip materials for improving the detoxification rate of virus-free seedlings. In view of the fact that conventional grafting reproduction also relies on healthy scion materials with low pathogen titers, the use of compound pretreatment of scions, combined with molecular detection technology, can further optimize the acquisition rate of healthy seedlings. Therefore, the technical solution provided by the present invention provides a new way to obtain healthy seedlings for the breeding of disease-free citrus varieties.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Screening method for anti-Huanglongbing compounds targeting MurD of Bacillus phloem, It is characterized in that The steps include: S1. Transforming a recombinant expression vector containing a target gene fragment into a host bacterium to obtain a recombinant expression strain, wherein the target gene fragment includes a DNA sequence encoding a MurD ligase having an amino acid sequence as shown in SEQ ID NO.1; S2, inducing the recombinant expression strain to express the target protein MurD, separating and purifying the target protein, and using SDS-PAGE gel electrophoresis to detect and analyze, and then collecting the purified protein; S3. Determine the ability of candidate compounds to interact with purified protein MurD, and screen out compounds that can bind to purified protein MurD as anti-Huanglongbing compounds targeting Bacillus subtilis MurD.

2. The method according to claim 1, It is characterized in that Also includes the steps: S4. The citrus Huanglongbing positive scions are randomly divided into an experimental group and a CK group. The experimental group is treated with the compound screened in step S3; the CK group is treated with clean water; under the same conditions, the cuttings are cultured until the scions sprout, and then qPCR is used to detect the pathogen using the DNA of the apical meristem of the new shoots as a template; if the Huanglongbing negative rate of the experimental group is higher than that of the CK group, the verification results show that the screened compounds have an inhibitory effect on the Huanglongbing pathogen.

3. The method according to claim 1, It is characterized in that The step S1 specifically includes: A1, using genomic DNA extracted from citrus leaves carrying Huanglongbing as a template, and using the forward and reverse primer sequences as shown in SEQ ID NO. 2-3, respectively, to amplify the target gene fragment by PCR; A2. Use BamHI and Xho I enzymes to connect the PCR product to the linearized vector pET28a-SUMO, respectively, and then transform it into E.coliDH5α competent cells. After extracting the recombinant plasmid from the transformed DH5α cells, perform gene sequencing; transform the plasmid with the correct gene sequencing result into E.coliBL21 competent cells to obtain a recombinant expression strain.

4. The method according to claim 1, It is characterized in that The step S2 specifically includes: B1, culturing the recombinant expression strain with LB medium, and then inducing with IPTG to express the target protein; B2. The method of separating and purifying the target protein includes: performing nickel column affinity chromatography, removing imidazole by dialysis, and then performing gel filtration chromatography, anion exchange chromatography and ultrafiltration to obtain the purified protein.

5. The method according to claim 1, It is characterized in that The step S3 specifically further comprises: using isothermal titration calorimetry to determine the binding constant Ka of each candidate compound with the purified protein MurD.

6. The method according to claim 5, It is characterized in that The concentration of the candidate compound solution is 50-500 μM, and the concentration of the MurD protein solution is 20-50 μM; The parameter settings of isothermal titration calorimetry include: number of drops 10, time interval between each drop 120 s, power 10 μCal / s, and stirrer speed 250 r / min.

7. The method according to claim 2, It is characterized in that The length of the positive scion is 6-8 nodes / strip, the compound screened in step S3 to be verified is configured into a solution with a concentration of 50-200 μM, and the treated positive scion is cut into a prepared culture medium containing 1 / 3 peat, 1 / 3 vermiculite, and 1 / 3 soil; the cutting container is a culture box made of PC material with a height of 9 cm, a length of 7.5 cm, and a width of 7.5 cm; 1 / 4MS culture solution containing 50-200 μM of the compound to be verified is used for spraying treatment, once every 3 days, and 10 mL is sprayed each time; and the culture is carried out under the conditions of a constant temperature of 26±1°C, a light intensity of 4000lx, and alternating light and dark for 12 hours each.

8. Anti-Huanglongbing compounds targeting MurD of Bacillus phloem, It is characterized in that The method is obtained by screening according to any one of claims 1 to 7.

9. The anti-Huanglongbing compound according to claim 8, It is characterized in that include: Nilofabicin, PA-824 or AFN-1252.

10. Application of anti-Huanglongbing compounds targeting MurD of Bacillus phloem in the prevention and treatment of Huanglongbing. It is characterized in that The anti-Huanglongbing compound is obtained by screening according to any one of the screening methods of claims 1 to 7, and / or the anti-Huanglongbing compound includes Nilofabicin, PA-824 or AFN-1252.

Images