Vaccine compositions comprising antigens and TLR3 agonists

Abstract

The present invention relates to a vaccine composition comprising one or more proteins expressed on the surface of a respiratory virus or bacterium and one or more pharmaceutically acceptable excipients wherein the composition is in the form of particles having an average particle size in the range of 2 to 50 [mu] m. The protein is contained in the composition in a correctly folded three-dimensional structure.

Description

Field of the Invention

[0001] The present invention relates to the fields of medicine, immunology and vaccines. The present invention provides vaccine kits and compositions capable of stimulating the immune system, for example, against pathogenic respiratory bacteria and pathogenic respiratory viruses. The present invention also provides methods of administering the vaccines so that individuals gain immunity to pathogenic bacteria and viruses. In particular, the present invention relates to vaccine compositions against respiratory viruses or bacteria such as SARS, MERS and COVID-19. Background Art

[0002] Coronaviruses are a group of RNA viruses that cause disease in mammals. They cause respiratory infections ranging from mild to fatal. Mild illness in humans includes the common cold, while more deadly forms can cause SARS, MERS, and COVID-19. Coronaviruses constitute the subfamily Orthocoronavirinae in the family Coronaviridae, order Nidovirales, kingdom Ribiviria. They are enveloped viruses with a positive-sense, single-stranded RNA genome and a helical-symmetric nucleocapsid.

[0003] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) is the coronavirus strain that causes coronavirus disease 2019 (COVID 19), the respiratory illness responsible for the COVID-19 pandemic. It is also known as the 2019 novel coronavirus (2019-nCoV) or human coronavirus 2019 (HCoV-19 or hCoV-19). SARS-CoV2 is a Baltimore Class IV positive-sense, single-stranded RNA virus that is infectious in humans. It is the successor to the SARS-CoV-1 strain that caused the 2002-2004 SARS outbreak.

[0004] SARS-CoV2 is a strain of severe acute respiratory syndrome-related coronavirus (SARSr-CoV). It is thought to have a zoonotic origin and has close genetic similarities to bat coronaviruses, suggesting that it emerged from a bat-borne virus.

[0005] Many people with coronavirus or other viral or bacterial illnesses experience illness-related effects such as fatigue, lack of energy, muscle pain, joint pain, joint and bone aches, etc. These effects do not necessarily go away when the primary illness is under control. Therefore, approximately 10-20% of people infected with COVID-19 experience late effects several months later.

[0006] WO 2021 / 178306 relates to an immunogenic composition for preventing SARS-COVID-2 infection. However, the immunogenic composition is different from the composition of the present invention, and the immunogenic composition is administered intramuscularly.

[0007] Recently and reported in the Examples herein, the inventors observed that subjects with respiratory disease caused by COVID-19 had significantly better immune responses when the vaccine composition was administered nasally or pulmonary. It is contemplated that the principle of administering a vaccine composition at the mucosal site where the virus or bacteria encounters its host will apply to all vaccines against respiratory diseases caused by respiratory viruses or bacteria.

[0008] Therefore, it is necessary to effectively and safely prevent the diseases caused by respiratory bacteria and viral infections. There is a demand for new adjuvants and optimized administration to achieve better immune response after vaccination. This type of new vaccine requires an attractive combination of characteristics, including a strong immune response and low toxicity when the characteristics are formulated into a product. Especially, in the field of viral infections, this type of new vaccine is needed, wherein only in the past two decades, the outbreak of several MERS and SARS has spread in several countries. This type of epidemic may also have a serious impact on those individuals who incur the virus, such as generally having a serious impact on travel, hospitals, commerce and society.

[0009] During the pandemic COVID-19 situation, it has become apparent that there is a need for effective vaccines and therapeutics to combat or mitigate the side effects of diseases, including viral diseases, such as coronavirus diseases, e.g., COVID-19.

[0010] Therefore, there is a need for new effective and safe vaccines to prevent diseases originating from bacterial and especially viral infections in the respiratory system. Summary of the invention

[0011] In one aspect, the present invention relates to a vaccine composition comprising a protein expressed on the surface of a respiratory virus or bacteria for nasal administration or inhalation administration. The composition is in solid form and is administered in the form of a powder or granular composition. The protein in the composition acts as an antigen, and in the composition, the protein exists in a correctly folded three-dimensional structure so as to be correctly identified after administration. In an embodiment, the respiratory virus is a coronavirus, and the antigen is a SARS-CoV-2 spike protein. The vaccine composition comprises one or more pharmaceutically acceptable excipients. When the composition is in granular form, the particles have an average particle size in the range of 1 to 50 μm. The particle size depends on the route of administration. Smaller particle sizes are suitable for administration to the lungs. The vaccine composition may also contain an adjuvant, such as a Toll-like receptor, such as TLR3, and one or more immunostimulants.

[0012] Although the examples herein relate to vaccine compositions for preventing COVID-19 infection, it is contemplated that the compositions may be formulated with other antigens, such as those against COVID-19, particularly against respiratory diseases caused by bacteria or viruses. As described herein, no side effects associated with brain inflammation were observed, and the nasal route of administration appears to be advantageous in avoiding such side effects.

[0013] More specifically, the present invention relates to a vaccine composition comprising one or more proteins expressed on the surface of a respiratory coronavirus and one or more pharmaceutically acceptable excipients, wherein the composition is in the form of particles having an average particle size ranging from 2 to 50 μm, and wherein the one or more proteins comprise a spike protein of a coronavirus SARS, MERS or COVID-19 or a variant thereof, and wherein the composition comprises one or more sugars and a TLR agonist. In an embodiment, the TLR agonist is a TLR3 agonist.

[0014] In another aspect, the present invention relates to a composition for preventing respiratory bacterial or viral (e.g., coronavirus) infection by administering the composition intranasally or pulmonary to a subject. Most current vaccine strategies are directed to providing a composition of a fully inactivated or attenuated virus or bacteria, the core purpose of which is to induce the production of neutralizing antibodies. Antigens derived from viruses or bacteria may also be used.

[0015] Typically, the composition comprises a relevant antigen or an inactivated or attenuated bacterium or virus, such as Streptococcus pneumonia, Haemophilus influenza, Moraxella catarrhlis, etc., or a spike protein or variant thereof of, for example, a coronavirus SARS, MERS or COVID-19, and wherein the composition comprises one or more sugars and a TLR agonist. Suitable compositions are the above-described vaccine compositions and are claimed in the appended claims.

[0016] In another aspect, the present invention provides antigens based on the spike protein of COVID-19. These proteins include SEQ ID NO:3 and SEQ ID NO:7 or proteins having 99% sequence identity to SEQ ID NO:3 or SEQ ID NO:7. The use of such antigens in vaccination and vaccine compositions is also an aspect of the present invention.

[0017] Homology between two amino acid sequences or between two nucleic acid sequences is described by parameter "identity". The calculation of sequence alignment and homology score can be completed using, for example, the complete Smith-Waterman alignment for protein and DNA alignment. The default scoring matrix BLOSUM50 and identity matrix (identity matrix) are used for protein and DNA alignment respectively. For protein, the penalty for the first residue in the gap is -12, for DNA, the penalty for the first residue in the gap is -16, and for protein, the penalty for extra residues in the gap is -2, for DNA, the penalty for extra residues in the gap is -4. FASTA software package version v20u6 can be used to compare. Multiple alignments of protein sequences can be carried out using "ClustalW". Multiple alignments of DNA sequences can be carried out using protein alignment as a template, with the corresponding codons in the DNA sequence replacing amino acids. Alternatively, different software can be used to compare amino acid sequences and DNA sequences. For example, the comparison of two amino acid sequences is determined by using the Needle program in EMBOSS software package (http: / / emboss.org) version 2.8.0. The substitution matrix used was BLOSUM62, the gap opening penalty was 10, and the gap extension penalty was 0.5.

[0018] Pulmonary and intranasal administration are thought to promote the conversion of immunoglobulins to IgA, an immunoglobulin specialized for mucosal surfaces including the lungs and intestines. TLR agonists are thought to promote the activation of macrophages, resulting in increased antigen presenting capacity, increased expression of co-stimulatory molecules including CD86, and increased production and release of cytokines and chemokines, including interferons. Thus, TLR2 agonists promote T cell activation, which is the basis for the successful induction of productive neutralizing B cell responses.

[0019] The present invention also relates to a carrier composition in the form of particles for use as a carrier of antigenic material derived from a respiratory virus or respiratory bacteria, wherein the carrier composition comprises one or more pharmaceutically acceptable excipients and adjuvants, wherein the one or more pharmaceutically acceptable excipients comprise i) a disaccharide selected from trehalose, sucrose and lactose, ii) a polysaccharide selected from cyclodextrins, and wherein the adjuvant is a TLR agonist.

[0020] The vaccine composition (ie, the composition comprising the vector composition and the antigenic material) is suitably used by nasal or pulmonary administration.

[0021] In a preferred aspect, the antigenic material is derived from a virus.

[0022] In such carrier compositions, preferably the disaccharide is trehalose, the polysaccharide is hydroxypropyl-β-cyclodextrin, and the TLR agonist is a TLR3 agonist.

[0023] Trehalose is a stabilizer and filler, and hydroxypropyl β-cyclodextrin is a filler or bulk material.

[0024] In the carrier composition, the concentration of the disaccharide is in the range of 10%-60% w / w, such as 30%-55% w / w or 40%-50% w / w, and / or the concentration of the polysaccharide is in the range of 10%-60% w / w, such as 30%-55% w / w or 40%-50% w / w, and / or the concentration of the adjuvant is 0.1%-5% w / w.

[0025] One aspect of the present invention relates to a vaccine composition for preventing respiratory viral or bacterial infection, the composition comprising i) a vector composition as described in any one of claims 1 to 6, and ii) an antigenic material derived from a respiratory virus or bacteria.

[0026] In the present context, the term "antigenic material derived from a respiratory virus or bacteria" is to be understood as, for example, inactivated or attenuated respiratory viruses or bacteria, proteins or fragments thereof isolated from respiratory viruses or bacteria, recombinant proteins or fragments from respiratory viruses or bacteria, or proteins or fragments thereof expressed on the surface of a virus.

[0027] The present invention also provides a vaccine kit comprising the vaccine composition of the present invention and a composition comprising vitamin A and / or vitamin D.

[0028] It should be noted that when details related to one of the aspects of the present invention are described herein, these details are also part of the other aspects of the present invention. For example, when details related to the vaccine composition of the present invention are described, these details are also related to the composition used according to the present invention, etc. DETAILED DESCRIPTION OF THE INVENTION

[0030] The object problem of the present invention can be formulated as providing a vaccine based on a pharmaceutical composition that can be administered intranasally or by inhalation to the lungs to prevent infections of respiratory bacteria and respiratory viruses. Non-limiting examples of such viruses are the viruses described herein, including SARS, MERS or COVID, in particular COVID infection. As shown herein, the vaccine composition of the present invention can provide protection only by intranasal administration. Thus, the inventors have found that intranasal and intratracheal administration of the vaccine composition of the present invention (simulating lung administration) provides i) suitable immunity (see Fig.29 ), ii) lung protection through the formation of neutralizing antibodies ( Fig.30), iii) inhibiting the virus so that it cannot bind to its receptor ( Fig.31 ), and iv) avoiding inflammation, such as brain inflammation ( Fig.32 ).

[0031] Surprisingly, the vaccine composition of the present invention provides protection against infection without a first intramuscular administration. Thus, the composition of the present invention can be administered without the need for a medical professional to inject it into a subject in need with a syringe. Also surprisingly, nasal administration using the vaccine composition of the present invention appears to completely avoid a common side effect observed after administration of known vaccine compositions such as COVID, namely, brain inflammation.

[0032] In the first aspect, the present invention provides a vaccine composition. The physical appearance of the vaccine composition is in the form of dry powder, particularly in the form of particles, and the vaccine composition comprises an antigen, an adjuvant and at least one pharmaceutically acceptable excipient. The antigen is a protein expressed on the surface of a respiratory virus or bacterium. The vaccine composition is used for intratracheal, pulmonary or intranasal administration. The administration of the vaccine composition can be combined with the administration of vitamin A and / or vitamin D, which can be administered before, simultaneously or after the administration of the vaccine composition. As described below, the antigen is present in the vaccine composition of the present invention in the correct conformation and three-dimensional structure, which ensures correct recognition by B lymphocytes.

[0033] The antigen is one or more proteins expressed on the surface of viruses or bacteria that cause respiratory diseases. The protein can be a full-length protein or a fragment thereof. In particular, the antigen is a full-length protein, such as the spike protein of COVID-19 or a variant thereof, in particular the full-length protein (SEQ ID NO: 1), the protein expressed by SARS-CoV-2 spike S1 (SEQ ID NO: 2), ISR52 (SEQ ID NO: 3), ISR52-DS (SEQ ID NO: 7) and other known and unknown variants, including those mentioned in the embodiments herein. The composition and / or method of administration provides antigens in a natural conformation, which allows the protein to be presented in the correct three-dimensional structure to dock with its natural receptor, i.e., the Ace2 receptor expressed in the respiratory tract, with complete binding properties. The complete conformational structure is critical for the initial recognition of naive IgM B lymphocytes, which, after internalization, CD4 + Processing and activation of T helper cells are induced to undergo somatic hypermutation and switch to IgG and IgA classes, binding to the important interacting parts of the protein such as the receptor binding domain (RBD). The present invention provides a vaccine composition wherein the protein maintains its correct three-dimensional structure.

[0034] Respiratory viruses can be influenza virus, respiratory syncytial virus, parainfluenza virus, metapneumovirus, rhinovirus, coronavirus (e.g., SARS, MERS, COVID-19, alpha-, beta-, delta-, gamma-coronavirus, and coronaviruses that cause upper respiratory tract illness (29E, OC43, NL63 and HKU1), adenovirus, bocavirus.

[0035] Respiratory bacteria may be Streptococcus pneumoniae, Mycoplasma pneumonia, Haemophilus influenzae, Chlamydophilia pneumoniae, Chlamydia Psittaci, Moraxella catarrhalis, Mycobacterium tuberculosis, Mycobacterium avis, and Mycobacterium marinum.

[0036] The composition of the present invention is particularly developed when the antigen is a COVID-19 spike protein selected from SEQ ID NO: 3 or SEQ ID NO: 7, or a COVID-19 spike protein having 99% or more sequence identity with SEQ ID NO: 3 or SEQ ID NO: 7.

[0037] As seen in the examples herein, one aspect of the invention relates to the development and testing of a SARS-CoV-2 Spike S1 protein vaccine candidate, ISR52. The SARS-CoV-2 Spike glycoprotein is believed to be an essential antigen for protective immunity against severe COVID-19 disease. Several subunit vaccines based on the Spike protein have shown efficacy in clinical and preclinical development. The effects of ISR52 administered by subcutaneous, intranasal, and intratracheal routes were compared, the latter being a simulation of pulmonary inhalation, which, to our knowledge, has not been tested before for SARS-CoV-2 vaccines.

[0038] Even at low doses of ISR52, both respiratory routes provided 100% protection in a mouse model of lethal challenge, whereas only partial protection was observed with low-dose subcutaneous immunization. The results showed that anti-Spike IgG and IgA cross-reacted with the variants of interest, induced durable cellular immunity, and demonstrated the robustness of the platform when combining the Spike S1 protein with the adjuvant polyIC:LC.

[0039] However, it is contemplated that the ingredients in the vaccine composition, ie, TLR receptors and pharmaceutically acceptable excipients, form a suitable base formulation for other antigens and, therefore, the formulation can generally be used to develop nasally administered vaccines to prevent infections caused by respiratory bacteria and viruses.

[0040] The adjuvant may be a pattern recognition receptor (PRR) agonist, such as a Toll-like receptor (TLR) agonist or a RIG receptor agonist.

[0041] IgA is produced by class switching of Ig, which is regulated by multiple processes. The binding of CD40-CD40L and the secretion of other cytokines IL-4, IL-5, IL-6, IL-10 and IL-21 promote the maturation of Th2 cells, which promotes class switching to different Ig subtypes. Retinoic acid is a metabolite of vitamin A, which also synergizes with IL-5 and IL-6 to induce IgA secretion.

[0042] It is believed that pulmonary or intranasal administration promotes the conversion of immunoglobulins to IgA, which is an immunoglobulin specifically for mucosal surfaces including the lungs and the gut. It is believed that TLR agonists promote the activation of macrophages, leading to increased antigen presentation capacity, increased expression of co-stimulatory molecules including CD86, and increased production and release of cytokines and chemokines including interferon. Therefore, TLR agonists promote T cell activation, which is the basis for successful induction of productive neutralization of B cell responses. TLR3 also activates RIG-1, which stimulates the production of interferon alpha. If interferon alpha is produced late or absent in Covid-19 disease, death or severe disease is observed.

[0043] Mass vaccination campaigns have altered the course of the COVID-19 pandemic and reduced morbidity and mortality associated with SARS-CoV-2 infection. However, declining immunity and antigenic drift may result in the need for newer and improved vaccines that are distributed equitably across countries. Some second-generation vaccines attempt to target the site of infection, the respiratory tract, to induce local immunity. These include licensed vaccines reformulated as nasal sprays, as well as new vaccine candidates designed for intranasal administration or aerosolization (designed by the WHO). COVID-19 vaccine tracking and landscape (who.int) Preclinical results for these candidates suggest comparable or superior protection against SARS-CoV-2, with one even describing the induction of sterilizing immunity.

[0044] Although needle-based vaccination is the gold standard for vaccine administration, it has several limitations. First, injectable vaccines are formulated as unstable liquids that require refrigeration, or as lyophilized powders for reconstitution. Second, it requires trained health care personnel, which can be a problem in non-industrialized countries and remote areas. Third, there is a risk of needle stick injuries and needle reuse, increasing the possibility of cross-contamination. Fourth, compliance with needle-based vaccination can be low due to associated needle phobia and pain at the injection site. Finally, vaccination implemented by injection mainly induces systemic immune responses, which are not specifically targeted to the infected area of ​​the pathogen, such as mucosal sites. Therefore, alternative modes of administration are highly desired.

[0045] Various needle-free administration routes have been explored. In particular, respiratory administration seems to be an interesting mode of administration, especially for vaccines against airborne microorganisms that cause respiratory infections. Due to the large surface area, permeable epithelium and high perfusion properties of the respiratory mucosa, the respiratory mucosa is one of the best targets for biopharmaceutical uptake. In addition, since the respiratory tract is continuously exposed to foreign matter, the airways contain antigen presenting cells (APCs), such as alveolar macrophages and dendritic cells, which serve as a defense system against antigens entering the body.

[0046] Therefore, it is contemplated that direct targeting and delivery of vaccine compositions directed against diseases caused by respiratory tract infections (e.g., the COVID-19 vaccine compositions described herein) to the respiratory tract is advantageous compared to vaccine compositions administered, for example, subcutaneously or intramuscularly.

[0047] Compositions for nasal or pulmonary vaccination are known. However, most such compositions are in liquid form, intended for delivery by spray or aerosol. The composition of the present invention is in dry powder form, containing a mixture of antigen particles and one or more pharmaceutically acceptable excipients.

[0048] The powder or granular material is provided to the subject in the form of a suitable device containing the vaccine composition. When the composition is used for nasal or pulmonary administration, it is possible for the subject / she (he) to administer the composition himself. In contrast to known compositions for nasal or pulmonary administration, the vaccine composition of the present invention is designed to be sniffed by the subject in the nasal cavity. Depending on the characteristics of the vaccine composition of the present invention, the composition can also be applied to the lungs or trachea.

[0049] Nasal administration is generally by suitable devices. Suitable devices include unit dose dispensers such as those provided by ICONovo AB, Lund, Sweden. Powdair (oral inhalation, but also suitable for nasal administration) from Hovione, Portugal. Aptar Unidose is a nasal dry powder inhalation device for pediatric use. Suitable materials for such devices include polypropylene, etc.

[0050] Administration to the trachea or lungs is generally carried out by oral administration via an inhaler.

[0051] As mentioned above, the formulation of the vaccine composition is designed in such a way as to maintain the three-dimensional structure of the antigen. Therefore, the various excipients used in the composition must be carefully selected to avoid destroying the three-dimensional structure of the antigen.

[0052] In this way, it is possible to i) provide a dry vaccine composition with excellent storage stability, ii) avoid the use of liquids that may produce adverse reactions at the application site or may destroy the three-dimensional structure of the protein, and iii) ensure that the composition remains at the application site for a sufficient time.

[0053] In addition to the potential benefits to immunity, inhaled or nasally administered vaccine formulations offer logistical advantages over injectable formulations. This is especially true when the vaccine can be stored and administered (inhaled or nasally) as a dry powder, completely avoiding the need for cold chain distribution. Such vaccines can be administered directly to the lower respiratory tract via a disposable dry powder inhaler, thus eliminating the need for a needle. Preclinical studies using dry powder vaccines have shown promise against a variety of pathogens and toxins including Mycobacterium tuberculosis, human papillomavirus, botulinum neurotoxin type A, and influenza A virus, and a safe and effective dry powder vaccine for SARS-CoV-2 would be a boon to global vaccination efforts.

[0054] The present invention provides a vaccine composition comprising a SARS-CoV-2 spike protein and one or more pharmaceutically acceptable excipients, wherein the composition is in the form of particles having an average particle size in the range of 1 to 50 μm. The average particle size depends on where the powder should be after administration. In the case of administration to the nasal mucosa, the average particle size should be in the range of 20 to 50 μm, such as 30 to 40 μm, and the particle size distribution shows that less than 10% of the particles have a particle size of 10 μm or less. If the vaccine composition is used for administration to the lungs, the average particle size should be 10 μm or less, such as up to 8 μm, up to 6 μm, up to 5 μm, or in the range of 1 μm to 5 μm, such as in the range of 3 μm to 5 μm.

[0055] Particle size can generally be achieved by using the micronized material in dry form or by micronizing the final composition.

[0056] Since the vaccine composition is in the form of dry powder, the powder must be loaded into a suitable device. Such a device must be made of a material to which the vaccine composition does not adhere, because adhesion of the vaccine composition can lead to changes in the dosage administered. In addition, the vaccine composition must be flowable to effectively fill the device with powder and ensure the correct dosage administered. Therefore, the vaccine composition of the present invention is required to have suitable fluidity when measured using a stemless funnel with a diameter of 10 ± 0.01 mm and a nozzle 1 according to the method described in 2.9.16 of the European Pharmacopoeia 10.0.

[0057] As can be seen in the examples herein, only 15 mg of antigen is contained in a total of 5 g of vaccine composition. Therefore, it is important to select one or more pharmaceutically acceptable excipients to i) ensure that the correct conformation of the protein is present, ii) provide sufficient fluidity for the final vaccine composition, iii) provide a material that is non-irritating to the nasal or lung mucosa, iv) provide a material that is biodegradable - at least for pulmonary administration, and v) provide a material that will not adhere to the device (to preclude incorrect dosage).

[0058] Suitable pharmaceutically acceptable excipients are selected from cellulose, cellulose derivatives, methylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, sugars including monosaccharides, disaccharides, oligosaccharides, polysaccharides, amino acids including peptides, and mixtures thereof.

[0059] In general, the vaccine compositions of the present invention contain excipients that ensure i) suitable flowability of the granules / powder, ii) reduction of intra-particle cohesivity, iii) stabilization of the protein to maintain the correct conformation, iv) stability of the protein to avoid aggregation, and v) suitable volume of the composition to enable handling and processing of the composition.

[0060] Amino acids may be present as surface modifiers to improve particle flow and reduce intragranular cohesion. Other suitable excipients that may be used alternatively include any phospholipid or surfactant, preferably leucine (including dileucine or trileucine) and / or lecithin, NaCl, MgCl2. Alternatively, magnesium stearate or sodium stearyl fumarate will achieve the same effect, but require subsequent mechanical addition rather than directly by spray drying.

[0061] Sugar or substitutes are present to stabilize the protein, preventing aggregation and degradation by fixing and maintaining the physical conformation of the protein in an amorphous lattice. This can be achieved by a variety of sugars or sugar alcohols. Disaccharides are preferably used, and trehalose is preferred. Sugars with high transition glass transition temperatures are preferred because this limits fluidity under higher ambient humidity. Glucose, sucrose, lactose, dextrose, mannitol, maltitol can be considered. Amino acids and amino acid derivatives can also be considered.

[0062] In addition, due to the high viscosity of bulking agents in the spray drying raw material solution, they are used as process enhancers. Such excipients include: sugars, sugar alcohols, cyclodextrins, amino acids, polymers or their salts. Specific examples are cyclodextrins, hydroxypropylmethylcellulose (HPMC), HPMC derivatives, hydroxypropylcellulose, lactose, mannitol, polyethylene glycol, polylactic acid (PLA), polylactic-glycolic acid (PLGA) and polysorbate.

[0063] In particular, the one or more pharmaceutically acceptable excipients are selected from disaccharides, oligosaccharides, amino acids, peptides and polypeptides.

[0064] The monosaccharide is selected from mannose, galactose, fucose, glucose and lactulose.

[0065] The disaccharide is selected from trehalose, sucrose, lactose. As shown in the examples, trehalose is a suitable excipient.

[0066] Another suitable excipient is a cyclodextrin, such as hydroxypropyl beta-cyclodextrin.

[0067] Further suitable pharmaceutically acceptable excipients may be amino acids selected from leucine or lysine and / or may be selected from dileucine or trileucine.In particular, HPMC appears to be a suitable pharmaceutically acceptable excipient for large-scale production of vaccine compositions.

[0068] An object of the present invention is to provide a vaccine composition having as few pharmaceutically acceptable excipients as possible, but still with the purpose of maintaining the correct three-dimensional structure of the antigen. Therefore, in an interesting embodiment, in addition to the antigen (and the components contained in the antigen composition) and in addition to the adjuvant (and the components contained in the adjuvant composition), the vaccine composition also contains i) a carbohydrate (monosaccharide, disaccharide, oligosaccharide or polysaccharide), ii) an amino acid, or iii) a peptide. In particular, this vaccine composition contains i) trehalose, ii) hydroxypropyl-β-cyclodextrin, iv) leucine, v) trileucine, vi) a combination of trehalose and hydroxypropyl-β-cyclodextrin, vii) a combination of trehalose and leucine, vii) a combination of trehalose and trileucine, or viii) a combination of trehalose, hydroxypropyl-β-cyclodextrin and leucine, or ix) a combination of trehalose and trileucine, or x) a combination of trehalose, hydroxypropyl-β-cyclodextrin and trileucine. HPMC may be included in any i) to x).

[0069] In general, the vaccine composition of the present invention comprises:

[0070] i) antigens, and

[0071] ii) adjuvant, and / or

[0072] iii) flow improvers, and / or

[0073] iv) stabilizers for antigen conformation, and / or

[0074] v) Fillers.

[0075] A pharmaceutically acceptable excipient may have one or more of the above mentioned properties iii) to v).

[0076] The antigen is typically present in the composition at a concentration in the range of 10% to 30% w / w, such as 10% to 20% w / w, for example about 15% w / w.

[0077] The adjuvant is typically present in the composition at a concentration of 0.1% to 5% w / w, such as 0.1 to 2% w / w, 0.5% to 1% w / w, such as about 0.75% w / w.

[0078] The flow improver is typically present in the composition in a concentration of 2% to 30% w / w, for example 2% to 20%, 3% to 10% or 5% to 10% w / w.

[0079] The stabiliser is typically present in the composition at a concentration of 2% to 70% w / w, e.g. 10% to 60% w / w, 15% to 55% w / w, 20% to 50% w / w, 30% to 50% w / w, 40% to 50% w / w, e.g. about 46-47% w / w.

[0080] The filler is typically present in the composition in a concentration of 2% to 70% w / w, for example 10% to 60% w / w, 15% to 55% w / w, 20% to 50% w / w, 30% to 50% w / w, 40% to 50% w / w, for example about 46-47% w / w.

[0081] The vaccine composition of the present invention generally contains leucine (as a flow improver, its concentration is as described above, such as about 7% w / w), trehalose (as a stabilizer, its concentration is as described above, such as about 46.5% w / w) and cyclodextrin or its derivative (as a filler, its concentration is as described above, such as about 46.5% w / w). The composition also contains an adjuvant (usually poly IC:LC) and an antigen.

[0082] As mentioned above, the vaccine composition of the present invention also contains an adjuvant. Suitable examples are TLR agonists, such as those discussed under the title "Combination with TLR agonists" herein. Other suitable adjuvants include RIG-1 and MDA5. RIG-1 is a cytoplasmic pattern recognition receptor responsible for type 1 interferon (IFN1) responses. RIG-1 is an essential molecule in the innate immune system for identifying cells infected with viruses. These viruses include respiratory viruses such as influenza A virus and coronavirus. MDA5 (melanoma differentiation-associated protein 5) is a RIG-1-like receptor dsRNA helicase encoded by the human IFIH1 gene. MDA5 is part of the RIG-1-like receptor (RLR) family, which also includes RIG-1 and LGP2, and acts as a pattern recognition receptor capable of detecting viruses.

[0083] In embodiments, the TLR agonist is a TLR2 agonist and / or a TLR3 agonist, eg, the TLR agonist is a TLR3 agonist.

[0084] Suitable examples of TLR3 agonists are selected from poly IC and poly IC:LC.

[0085] The adjuvant, such as poly IC or poly IC:LC, is present in the composition in a concentration corresponding to the range of 0.01% to 1% w / w, such as 0.075% to 0.75% w / w, 0.08% to 0.5% w / w, 0.1% to 0.4% w / w, 0.1% to 0.25% w / w, such as about 0.15% w / w, based on the total weight of dry matter in the composition.

[0086] As mentioned above, the vaccine compositions of the present invention may also contain vitamin A and / or vitamin D (see discussion under the headings "Combination with vitamin A" and "Combination with vitamin D").

[0087] Coronavirus

[0088] The vaccine composition of the present invention is suitable for vaccination against coronavirus diseases such as SARS-CoV2.

[0089] Other coronaviruses of interest are SARS, MERS, COVID-19, alpha-, beta-, delta-, gamma-coronaviruses, and coronaviruses that cause upper respiratory tract diseases (29E, OC43, NL63, and HKU1).

[0090] The vaccine composition of the present invention comprises an antigen. The antigen may be a protein or a polymer thereof, a peptide or a polymer thereof, or an attenuated virus or bacterium. In particular, the antigen is a full-length protein expressed on the surface of a virus or bacterium. In an embodiment, the antigen may be a spike protein of SARS-CoV-2 or a variant thereof, or it may be an attenuated SARS-CoV-2 or a component thereof, or a spike protein or a portion thereof from SARS-Cov-2, such as a SARS-CoV-2 spike S1 subunit including an RBD.

[0091] The spike doses used in preclinical mouse studies ranged from 5-80 μg. In the clinic, we plan to evaluate 10-120 μ, such as 10 μg, 50 μg and 120 μg of the spike protein. The dose of adjuvant is usually 10 μg to 120 μg. PolyIC:LC in the range of 3-60 μg has been used in preclinical rodent studies. For clinical trials, we plan to use 10-60 μg, such as 20 μg or 40 μg.

[0092] Oncovir, which produces polyIC:LC, has used it in clinical trials with a nasal dose of up to 1 mg with no adverse reactions.

[0093] Vitamins A and D have been sparsely evaluated, and in mouse studies we have used 200 ng Calcitrol and 40 μg ATRA (all-trans retinoic acid) per mouse.

[0094] Coronaviruses are a group of related RNA viruses that cause disease in mammals and birds. In humans and birds, they cause respiratory infections that can range from mild to fatal. Mild illness in humans includes some cases of the common cold (which is also caused by other viruses, primarily rhinoviruses), while more deadly species can cause SARS, MERS, and COVID-19.

[0095] Coronaviruses constitute the subfamily Orthocoronavirinae in the family Coronaviridae, order Nidovirales, kingdom Riboviria. They are enveloped viruses with a positive-sense, single-stranded RNA genome and a helical symmetrical nucleocapsid. The genome size of coronaviruses is approximately 26 to 32 kilobases, one of the largest among RNA viruses. They have characteristic rod-shaped spikes protruding from their surface, which in electron micrographs produce an image reminiscent of the solar corona, from which their name is derived. Coronaviruses are large, roughly spherical particles with distinctive surface protrusions. Their size is highly variable, usually averaging 120 nm in diameter. Extreme sizes are known to have diameters of 50 to 200 nm. The total molecular weight averages 40,000 kDa. They are enclosed in an envelope that embeds many protein molecules. The lipid bilayer envelope, membrane proteins, and nucleocapsid protect the virus when it leaves the host cell.

[0096] Coronavirus disease 2019 (COVID-19) is a contagious respiratory and vascular illness caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0097] Common symptoms of COVID-19 include fever, cough, fatigue, difficulty breathing, and loss of smell and taste. Symptoms begin one to 14 days after exposure to the virus. While most people have mild symptoms, some develop acute respiratory distress syndrome (ARDS). ARDS can be triggered by cytokine storms, multi-organ failure, septic shock, and blood clots. Long-term damage to organs, particularly the lungs and heart, has been observed.

[0098] COVID-19 is spread through multiple routes, mainly involving saliva and other body fluids and excretions. These fluids can form small droplets and aerosols that can be spread when an infected person breathes, coughs, sneezes, sings or talks. This is suspected to be the main mode of transmission. The virus may also be spread through contaminated surfaces and direct contact. Infection mainly occurs when people are close to each other for a long enough period of time. It can be spread as early as two days before an infected person shows symptoms (presymptomatic), and from asymptomatic (no symptoms) individuals. In moderate cases, people remain contagious for up to ten days, and in severe cases, people remain contagious for up to two weeks.

[0099] Side effects and / or delayed effects include one or more of fatigue, lack of energy, muscle pain, joint pain, joint and bone soreness, etc.

[0100] The vaccine composition of the present invention can be used in combination with, for example, vitamin A and / or vitamin D.

[0101] Respiratory viruses can be influenza virus, respiratory syncytial virus, parainfluenza virus, metapneumovirus, rhinovirus, coronavirus, adenovirus, bocavirus.

[0102] Respiratory bacteria may be Streptococcus pneumoniae, Mycoplasma pneumoniae, Haemophilus influenzae, Chlamydia pneumoniae, Chlamydia psittaci, Moraxella catarrhalis, Mycobacterium tuberculosis, Mycobacterium avium, Mycobacterium marinum.

[0103] Combination with TLR agonists

[0104] Toll-like receptors (TLRs) are a class of proteins that play an important role in recognizing viral particles and activating the innate immune system. They are transmembrane receptors that are usually expressed on macrophages and dendritic cells and recognize molecules derived from microorganisms. Once microorganisms pass through, for example, the skin or mucous membranes, they are recognized by TLRs, which activate immune cell responses. Human TLRs include TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and TLR10. Humans lack the genes for TLR11, TLR12, and TLR13.

[0105] TLR1, TLR2, TLR4, TLR5, TLR6, and TLR10 are located on the cell membrane, while TLR3, TLR7, TLR8, and TLR9 are located in intracellular vesicles.

[0106] Activation of the TLR pathway leads to the secretion of proinflammatory cytokines, such as interleukin-1 (IL-1), IL-6, and tumor necrosis factor-α, as well as type 1 interferons. Different TLRs, such as TLR2, TLR3, TLR4, TLR6, TLR7, TLR8, and TLR9, are potentially important in COVID-19 infection.

[0107] Examples of TLR2 agonists are macrophage activating lipopeptide (MALP-2), Pam2Cys, PEG-Pam2Cys.

[0108] Examples of TLR3 agonists are PIKA analogs of poly IC, poly IC (polycytidylic acid), poly IC:LC (condensation of poly IC with poly-L-lysine and carboxymethylcellulose), and liposome-encapsulated poly IC:LC.

[0109] Examples of TLR4 agonists are LPS (lipopolysaccharide), MPL (monophosphoryl lipid A), FimH (fimbria H protein), AGP (aminoalkyl glucosamine phosphate)

[0110] An example of a TLR5 agonist is bacterial flagellin.

[0111] An example of a TLR7 agonist is 1-(2-methylpropyl)-1H-imidazo(4,5-c)quinolin-4-amine (imiquimod).

[0112] Examples of TLR9 agonists are CpG and CpG-ODN.

[0113] As mentioned above, this combination can also be combined with other adjuvants such as RIG-1 or MDA5.

[0114] Combination with Vitamin A

[0115] Immunoglobulin A (IgA) is one of the five major immunoglobulins and plays a key role in mucosal homeostasis in the gastrointestinal, respiratory and urogenital tracts, where it functions as the primary antibody of immunity. It is the second most abundant immunoglobulin type found in the body and therefore plays a vital role in protection against antigens.

[0116] IgA is produced by class switching of Ig, which is regulated by multiple processes. The binding of CD40-CD40L and the secretion of other cytokines IL-4, IL-5, IL-6, IL-10 and IL-21 promote the maturation of Th2 cells, which promotes class switching to different Ig subtypes. Retinoic acid is a metabolite of vitamin A, which also synergizes with IL-5 and IL-6 to induce IgA secretion.

[0117] Vitamin A (retinoid) is a micronutrient that is required in trace amounts in the diet of almost all vertebrates because it cannot be synthesized in sufficient amounts to maintain physiological health. Because vitamin A and its metabolites are known to have adjuvant activity, high concentrations thereof may have some therapeutic effects.

[0118] Retinol must be oxidized to retinal by an intracellular enzyme, alcohol dehydrogenase (ADH), and then irreversibly catabolized to its biologically active form, all-trans retinoic acid (from now on referred to as RA) by retinal dehydrogenase (RALDH). This biologically active metabolite can be synthesized by many cell types and tissues known to possess the RALDH enzyme required for this conversion, including DCs from different tissues such as the intestine, lung, skin, and their draining lymph nodes.

[0119] In the 1980s, it was discovered that vitamin A controls the transcellular trafficking of IgA dimers in epithelial cells. In the following decades, the effects of vitamin A on the interaction with several immune cells and stromal cells in the lamina propria were further explored.

[0120] A special feature of mucosal immune cells is their unique mucosal-imprinting phenotype, a property required for the subsequent steps of producing and secreting IgA antibody isotypes. This special property appears to require the presence of RA in the mucosal environment. The key findings regarding the effects of vitamin A (or RA) on the regulation of mucosal immune responses are that RA plays a central role in the differentiation of DCs and that mucosal DCs can metabolize retinol to retinoic acid.

[0121] Another important function of RA is to promote the DC-dependent generation of IgA antibody-secreting cells from B cells, and this process is enhanced by IgA-inducing cytokines such as IL-5 / IL-6. In fact, different lines of evidence from several animal models and human studies all agree that the synthesis of RA by lymphoid tissue DCs and other non-immune cells is required to induce IgA expression in B cells. The conclusion drawn from these studies is that RA acts as a specific IgA isotype switching factor that promotes the differentiation of IgA+ antibody-secreting cells and enhances IgA production in the presence of TGF-β. The effectiveness of this effect is modulated by the presence of IL-5 or IL-6 in the microenvironment.

[0122] Combination with Vitamin D

[0123] In general, vitamin D has antibacterial, antiviral, and anti-inflammatory properties, with its effects on activating the innate immune system and suppressing the adaptive immune system. Vitamin D deficiency has been associated with increased risk or severity of viral infections, including HIV and COVID-19. Low levels of vitamin D appear to be a risk factor for tuberculosis, and it has historically been used as a treatment.

[0124] Supplementation slightly reduced the risk and severity of acute respiratory infections and also reduced asthma exacerbations. There was no evidence that vitamin D affected respiratory infections in children under five years of age. Vitamin D supplementation substantially reduced the incidence of moderate or severe COPD exacerbations in people with baseline 25(OH)D levels less than 25 nmol / L, but not in those with less severe deficiency.

[0125] Therefore, vitamin D is a well-known and safe active substance used in medicines.

[0126] Vitamin D is a group of fat-soluble secosteroids known to increase intestinal absorption of calcium, magnesium, phosphate and many other biological effects.

[0127] Five different vitamin Ds are known: vitamin D1 (also known as a 1:1 mixture of ergocalciferol and luminosterol), vitamin D2 (also known as ergocalciferol, which can be prepared from ergosterol), vitamin D3 (also known as cholecalciferol, which can be prepared from 7-dehydrocholesterol), vitamin D4 (also known as 22-dihydrocalciferol) and vitamin D5 (also known as sitolcalciferol, which can be prepared from 7-dehydrositosterol). The vitamin D used in the present invention is selected from vitamin D1, vitamin D2, vitamin D3, vitamin D4, vitamin D5 or a mixture thereof.

[0128] In humans, the most important forms of vitamin D are vitamin D3 (cholecalciferol) and vitamin D2 (ergocalciferol). These are collectively known as calciferols. Vitamin D2 was chemically characterized in 1931. In 1935, the chemical structure of vitamin D3 was determined and shown to be derived from ultraviolet irradiation of 7-dehydrocholesterol.

[0129] Chemically, all forms of vitamin D are secosteroids, i.e., steroids with one bond in the steroid ring opened. The structural difference between vitamin D2 and vitamin D3 is the side chain of vitamin D2, which contains a double bond between carbons 22 and 23 and a methyl group on carbon 24.

[0130] Therefore, in the composition of the present invention, vitamins D2 and D3 are particularly preferred. Vitamin D3 is most preferred.

[0131] The major natural source of the vitamin is the synthesis of cholecalciferol in the subepidermal layer of the skin by a chemical reaction that is dependent on light exposure (particularly UVB radiation). Cholecalciferol and ergocalciferol can be ingested from the diet and from supplements. Only a few foods, such as fatty fish, naturally contain significant amounts of vitamin D. In the United States and other countries, milk and plant-derived milk alternatives are fortified with vitamin D, as are many breakfast cereals. Mushrooms exposed to UV light provide useful amounts of vitamin D. Dietary recommendations generally assume that all of a person's vitamin D is taken by mouth because sun exposure is variable among the population and recommendations about safe amounts of light exposure are uncertain given skin cancer risk.

[0132] Vitamin D, derived from the diet or synthesized from the skin, is biologically inactive. It is activated by two protease hydroxylation steps, the first in the liver and the second in the kidney. Most mammals can synthesize sufficient amounts of vitamin D if exposed to sufficient sunlight, so it is not essential and is not technically a vitamin. Instead, it can be considered a hormone, with activation of the vitamin D precursor hormone producing the active form, calcitriol, which then acts through nuclear receptors at multiple locations.

[0133] Cholecalciferol is converted in the liver to calcifediol (25-hydroxycholecalciferol); ergocalciferol is converted to 25-hydroxyergocalciferol. These two vitamin D metabolites (called 25-hydroxyvitamin D or 25(OH)D) are measured in serum to determine a person's vitamin D status. Calcifediol is further hydroxylated by the kidneys to form calcitriol (also called 1,25-dihydroxycholecalciferol), the biologically active form of vitamin D. Calcitriol circulates in the blood as a hormone and plays an important role in regulating calcium and phosphate concentrations and promoting healthy growth and remodeling of bones. Calcitriol has other actions, including some effects on cell growth, neuromuscular and immune function, and reducing inflammation.

[0134] Vitamin D has a prominent role in calcium homeostasis and metabolism. Its discovery is attributed to efforts to find dietary substances that are deficient in children with rickets (osteomalacia of childhood). Vitamin D supplementation is given to treat or prevent osteomalacia and rickets. Evidence for other health effects of vitamin D supplementation in the general population is inconsistent. The effect of vitamin D supplementation on mortality is unclear, with one meta-analysis finding a small reduction in mortality in the elderly and another concluding that there is no clear justification for recommending vitamin D supplementation for the prevention of many diseases and that further research of similar designs is not needed in these areas.

[0135] The active vitamin D metabolite calcitriol mediates its biological effects by binding to the vitamin D receptor (VDR), which is primarily located in the nucleus of target cells. The binding of calcitriol to the VDR causes the VDR to act as a transcription factor*, regulating the gene expression of transporters such as TRPV6 and calbindin, which are involved in calcium absorption in the intestine. The vitamin D receptor belongs to the nuclear receptor superfamily of steroid / thyroid hormone receptors, and the VDR is expressed by cells in most organs, including the brain, heart, skin, gonads, prostate, and breast.

[0136] VDR activation in intestinal, bone, kidney and parathyroid cells leads (with the help of parathyroid hormone and calcitonin) to the maintenance of calcium and phosphorus levels in the blood and to the maintenance of bone mass.

[0137] One of the most important roles of vitamin D is to maintain skeletal calcium homeostasis by promoting calcium absorption from the intestine, promoting bone resorption by increasing the number of osteoclasts, maintaining calcium and phosphate levels required for bone formation, and maintaining serum calcium levels by allowing parathyroid hormone to function properly. Vitamin D deficiency can lead to lower bone mineral density and can lead to decreased bone density (osteoporosis) or an increased risk of fractures because vitamin D deficiency alters mineral metabolism in the body. Therefore, vitamin D, as a potent stimulator of bone resorption, is also essential for bone remodeling.

[0138] VDR regulates cell proliferation and differentiation. Vitamin D also influences the immune system, and VDR is expressed in several leukocytes, including monocytes and activated T and B cells. In vitro, vitamin D increases tyrosine hydroxylase gene expression in adrenal medullary cells and affects the synthesis of neurotrophic factors, nitric oxide synthase, and glutathione. Vitamin D receptor expression decreases with age, and research results indicate that vitamin D is directly related to muscle strength, mass, and function, all of which are important factors in athletic performance.

[0139] Combination vaccines

[0140] The vaccine composition of the present invention may also contain two or more antigens, such as a mixture of protein antigens expressed on the surface of the virus. This mixture may be derived from the spike of the SARS-CoV-2 variant and the hemagglutinin and / or neuraminidase of influenza A and / or influenza B, respectively, to obtain a double or triple combination vaccine composition.

[0141] Other aspects of the invention

[0142] The present invention also relates to

[0143] i) a vaccine kit comprising:

[0144] - a composition comprising an antigen, a TLR agonist and one or more pharmaceutically acceptable excipients, and

[0145] - a label informing that the composition is to be used for vaccination by co-administration of vitamin A,

[0146] ii) i) a vaccine kit comprising:

[0147] - a composition comprising an antigen, a TLR agonist and one or more pharmaceutically acceptable excipients, and

[0148] - a label informing that the composition is to be used for vaccination by co-administration of vitamin D,

[0149] iii) i) a vaccine kit comprising:

[0150] - a composition comprising an antigen, a TLR agonist and one or more pharmaceutically acceptable excipients, and

[0151] - a label informing that the composition is to be used for vaccination by co-administration of vitamin A and vitamin D,

[0152] iv) a vaccine kit comprising:

[0153] - a first composition comprising an antigen, a TLR2 agonist and one or more pharmaceutically acceptable excipients, and

[0154] - a second composition comprising vitamin A,

[0155] v) a vaccine kit comprising:

[0156] - a first composition comprising an antigen, a TLR2 agonist and one or more pharmaceutically acceptable excipients, and

[0157] - a second composition comprising vitamin D,

[0158] vi) a vaccine kit comprising:

[0159] - a first composition comprising an antigen, a TLR2 agonist and one or more pharmaceutically acceptable excipients, and

[0160] - a second composition comprising vitamin A,

[0161] - A third composition comprising vitamin D.

[0162] General uses of the vaccine of the present invention

[0163] The vaccination methods and vaccine compositions of the invention disclosed herein can be used to provide immunity to an individual against bacteria or viruses, particularly against respiratory bacteria or viruses as described herein.

[0164] Pharmaceutical composition for vaccination against diseases caused by coronavirus

[0165] The present invention also provides a vaccination kit comprising a pharmaceutical composition comprising an antigen and a TLR3 agonist and one or more pharmaceutically acceptable excipients. The present invention also relates to a pulmonary or intranasal composition comprising an antigen and a TLR3 agonist and at least one pharmaceutically acceptable excipient.

[0166] Pharmaceutical compositions for nasal, intratracheal and pulmonary administration are in solid form. As shown in the examples herein, solid forms can be obtained by drying liquid preparations. Formulated as powders for administration by sniffing, but can also be in the form of powder sprays or dry powder inhalers.

[0167] Vaccination methods can consist of a single administration or multiple administrations over a period of time. In particular, oral administration of vitamin A and / or vitamin D can consist of multiple administrations.

[0168] The composition can be conveniently present in a suitable dosage form, such as a unit dosage form, and can be prepared by any method well known in the pharmaceutical field. Such methods include the step of combining the active ingredient (antigen) and the TLR3 agonist with one or more excipients. Typically, the preparation is prepared by uniformly and closely combining the active ingredient with a liquid carrier or a finely divided solid carrier or both.

[0169] Depending on the particular vaccination and individual to be vaccinated, as well as the route of administration, the compositions may be administered at varying doses and / or frequencies.

[0170] Pharmaceutical compositions must be stable under manufacturing and storage conditions; therefore, as required, they should be preserved from microbial contamination such as bacteria and fungi. In the case of liquid preparations as intermediate preparations, such as solutions, dispersions and suspensions, carriers can be solvents or dispersion media containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol), vegetable oils and their suitable mixtures. In the case of solid preparations, dry powder preparations are usually prepared by mixing micronized active particles with carrier particles such as those described herein before (including HPMC, hydroxypropyl cyclodextrin, sorbitol, lactose, trehalose, leucine or mannitol).

[0171] The composition can also include a pH adjuster, a stabilizer, a surfactant, a solubilizer (such as triacetin, triethyl citrate, ethyl oleate, ethyl caprylate, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone), an absorption enhancer (such as polyoxyethylene glycol or mono- or di-glycerides of fatty acids), a dispersant, a preservative, and the like.

[0172] It should be understood that, in addition to the above-mentioned ingredients, the formulations of the present invention may also include other agents conventional in the art related to the type of formulation in question. Those skilled in the art will know how to select a suitable formulation and how to prepare it (see, e.g., Remington's Pharmaceutical Sciences, 18th edition or later). Those skilled in the art will also know how to select a suitable route of administration and dosage.

[0173] The pharmaceutically acceptable salt of TLR agonist includes conventional salts and acid addition quaternary ammonium salts formed by pharmaceutically acceptable inorganic or organic acids or bases. More specific examples of suitable acid salts include hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, perchloric acid, fumaric acid, acetic acid, propionic acid, succinic acid, glycolic acid, formic acid, lactic acid, maleic acid, tartaric acid, citric acid, palmitic acid, malic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, toluenesulfonic acid, methanesulfonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, hydroxynaphthoic acid, hydroiodic acid, malic acid, sterol acid (steroic acid), tannic acid, etc. Other acids such as oxalic acid, although not pharmaceutically acceptable per se, can be used to prepare such salts, which can be used as intermediates for obtaining the compounds of the present invention and their pharmaceutically acceptable salts. More specific examples of suitable basic salts include sodium, lithium, potassium, magnesium, aluminum, calcium, zinc, N,N'-dibenzylethylenediamine, chlorprocaine, choline, diethanolamine, ethylenediamine, N-methylglucamine and procaine salts.

[0174] result

[0175] The applicability as a carrier for a vaccine composition for nasal administration for vaccination against respiratory bacteria or viruses can be seen in the examples herein. In this context, a carrier means a pharmaceutically acceptable excipient as well as a TLR agonist, but does not include any antigen, any inactivated or attenuated virus or bacteria.

[0176] It is reported in Example 3 that respiratory administration of the spike protein vaccine ISR52 protected against lethal challenge (Studies AB21-04, AB21-31).

[0177] The SARS-CoV-2 spike glycoprotein is considered to be an essential antigen for protective immunity against severe COVID-19 disease. In fact, several spike-based subunit vaccines have shown efficacy in clinical and preclinical studies in the World Health Organization vaccine tracker. Therefore, we chose the soluble spike protein as our first candidate vaccine based on the original SARS-CoV-2 sequence, because we knew that a dry powder formulation of the spike protein could be prepared later.

[0178] As described in detail in Example 3, our vaccine candidate (ISR52) was then prepared for administration to female AC70hACE2 mice, a lethal SARS-CoV and SARS-CoV-2 infection model ( et al., 2020; Tseng et al., 2007; Xu et al., 2021; Yoshikawa et al., 2009). We used low and high doses of ISR52 with poly I:C and all-trans retinoic acid (ATRA) as adjuvants. We tested three different routes of administration: subcutaneous (sc), intranasal (in), and intratracheal (it). Although intranasal immunization of SARS-CoV-2 vaccines has been investigated previously, to our knowledge, intratracheal administration has not been reported. We immunized 7 or 8 mice per group and included an additional control group of unvaccinated mice. Two immunizations were performed two weeks apart, and we then administered 2x10 5 TCID50 of the founder SARS-CoV-2 for attack.

[0179] After challenge, we monitored the health of all mice daily and euthanized mice if they lost >20% of their body weight or developed more severe symptoms consistent with our ethical approval. Based on these criteria, all mice in the unvaccinated control group were euthanized on day 4 post infection. For the low-dose subcutaneous group, 5 / 7 mice died on day 5 or 6 post infection, indicating suboptimal protection. Our finding of 100% protection in all other groups, including in the lower dose in and it groups, suggests that ISR52 improves protective immunity against SARS-CoV-2. Mice that survived challenge had no quantifiable levels of SARS-CoV-2 in the BAL, suggesting that they had cleared the infection by day 11 post infection or that the virus never entered the lungs. Histopathological analysis of lung tissue showed the presence of inflammatory cells in the lungs, potentially indicating infection, although we did not see clear differences between groups. Of most interest, brain tissue inflammation and necrosis were observed in both unvaccinated (8 / 8) and low-dose (5 / 7) and high-dose (2 / 7) subcutaneously vaccinated groups; no similar observations were made for animals vaccinated via the respiratory route. Neuronal damage is a major component of SARS-CoV-2 pathology in the hACE2 mouse model, so it is highly relevant that both in and it administration of ISR52 protected against signs of neuronal damage, even at low doses.

[0180] Bronchoalveolar lavage fluid (BAL) and organs were harvested from mice on the day of the experiment. We analyzed the presence of SARS-CoV-2 RNA in BAL and lung tissue at the time of euthanasia ( Fig.29). We detected SARS-CoV-2 RNA in the BAL of mice that died during infection, including control mice and four mice in the low-dose sc group. At the same time, low to undetectable viral RNA (Ct>35) was found in surviving mice. We obtained similar results in lung tissue, although only a few animals had quantifiable SARS-CoV-2 RNA overall. These results suggest that, with the exception of the low-dose sc group, vaccinated animals cleared the infection by day 11 post-infection or that the virus never entered the lungs. We also examined evidence of brain histopathology in challenged mice, as neuronal damage is a major part of SARS-CoV-2 pathology in the hACE2 mouse model. Histopathological analysis showed inflammation and necrosis in brain tissue of unvaccinated (8 / 8) and low-dose (5 / 7) and high-dose (2 / 7) subcutaneously vaccinated groups; no similar observations were made for animals vaccinated by the respiratory route. These results suggest that both in and it administration of ISR52 protect the hACE2 mouse model from signs of neuronal damage, even at low doses. In conclusion, we saw a clear benefit for respiratory vaccination compared with conventional subcutaneous vaccination with a low dose of ISR52.

[0181] ISR52 immunization induces humoral responses that cross-react with variant strains of interest (Studies AB21-33, AB21-73) - Examples 4 and 6

[0182] Because anti-Spike antibodies may be important in protective immunity against SARS-CoV-2, we also investigated the reactivity of sera from vaccinated mice collected before viral challenge. We analyzed the levels of serum IgG and serum IgA against the Spike S1 protein of the founder strain from Jiuzhou Jiangcheng and against the receptor binding domain (RBD) of the alpha variants of concern (VOC) B.1.1.7 and beta VOC B.1.351. We found that all vaccinated groups had detectable anti-Spike IgG up to a dilution of at least 1:10,000 for each variant, with higher IgG levels in the high-dose groups. We also found greater differences between vaccination groups when we analyzed anti-Spike IgA; however, serum IgA responses were stronger with intranasal vaccination compared with intratracheal vaccination, while IgA titers were negligible with subcutaneous vaccination. Because one of the goals of intranasal and intratracheal immunization is to induce local immune responses at the relevant infection site, we also harvested BAL from animals at the time of euthanasia. We analyzed the presence of anti-Spike IgA in the BAL and found the strongest induction of IgA in the high-dose intranasal group, minimal induction in the subcutaneous group, and weak induction in the intratracheal group. This pattern was reproduced when we analyzed the neutralizing capacity of the antibodies present in the BAL. We found that subcutaneous immunization was not associated with neutralizing activity in the BAL (1 of 13 animals in both the low-dose and high-dose groups had a detectable neutralizing antibody titer). However, we could find that 44% of the intranasal and intratracheal groups had detectable neutralizing antibody levels, with titers as high as 1 / 32 (low-dose in 2 / 8; high-dose in 5 / 7; low-dose it 1 / 7; high-dose it 4 / 5).

[0183] Combined with survival and brain histopathology data, these data suggest that in and it administrations produce more robust protection compared with sc immunization. These results are consistent with previous studies of intranasal vaccination but are the first to demonstrate the effectiveness of intratracheal immunization against SARS-CoV-2.

[0184] Example 5 concerns the dose-dependent response to the vaccine candidate ISR52 updated with variant spikes (Study AB21-31).

[0185] Our first challenge study showed that the vaccine candidate ISR52 has the potential to induce antibodies and protect against SARS-CoV-2 disease when administered intranasally or intratracheally. Following changes in the predominant circulating variants and their potential immune escape mutations, we updated our vaccine candidate to include equal amounts of monomeric α variant spike (B.1.1.7) and β variant spike (B.1.351). We focused on in and it immunizations, using 5 μg and 20 μg of total spike in this study, compared to 10 μg and 80 μg used in previous studies (Table 3). We used the same immunization and challenge schedule as in previous studies ( Figure 2 A), 11 female hACE2 mice were immunized in each group. To challenge the capacity of our vaccine candidate, we used a higher infectious dose of SARS-CoV-2 (1x10 6 TCID50). As in previous studies, all unvaccinated control mice lost weight, developed other symptoms, and were euthanized on day 4 post-infection. Unfortunately, equipment failure resulted in the death of 4 mice in the high-dose intranasal group 2 days post-infection; the deaths of these mice were considered unrelated to infection and were therefore excluded from further analysis. The low-dose groups showed a modest effect of the vaccine; 3 / 11 of the low-dose in group and 4 / 11 of the low-dose it group survived infection, while the remaining animals were euthanized on days 4, 5, or 6. By day 4 post-infection, both groups of mice had significantly lost their body weight on average. The high-dose groups showed a higher level of protection, with 4 / 7 of the in group and 7 / 11 of the it group surviving challenge. Consistent with this, we did not observe a significant loss of body weight in these mice. Thus, our vaccine was clearly dose-dependent, although we did not see differences between routes of administration by analyzing health status and survival. We analyzed SARS-CoV-2 RNA in the BAL of mice at the time of euthanasia and found detectable levels in the majority of animals euthanized before the end of the experiment; surviving animals were euthanized at 11 days post infection and had no detectable levels of SARS-CoV-2 RNA. Overall, our improved vaccine candidate showed good efficacy against high doses of virus from a different strain than that used to vaccinate mice; this was true at the higher 20 μg dose, both in and it administration.

[0186] There were no significant differences in pre- and post-challenge antibody responses between in and it administration (Studies AB21-33, AB21-34, AB21-74)

[0187] In this study, we harvested and analyzed sera after the first immunization, after the second immunization, and at the expected endpoint, and one immunization produced a weak anti-spike IgG response. The second immunization clearly resulted in a strong increase in anti-spike IgG titers in a dose-dependent manner, supporting our two-dose strategy, but we did not see differences between immunization routes (in vs. it). We then observed the cross-reactivity of serum IgG and serum IgA to four variant spike proteins from the α, β, and δ (B.1.617.2) variants of concern and the κ (B.1.617.1) variant strain being monitored after the second immunization. Despite immunization with a combination of α and β spike proteins, we found similar levels of IgG and IgA against all variant spike proteins within the group. Between groups, we saw evidence of dose-dependency, but there was no significant difference between the in and it groups at the same dose.

[0188] To complement our serological data, we pooled pre-challenge sera from each vaccine group and analyzed the neutralizing activity of the sera against the β variant (mice were specifically immunized against the β variant) and the δ variant (mice were not immunized against the δ variant). We again observed a dose-dependent effect for in and it administration. When the same doses were compared, the neutralizing titers against the β variant were the same for in and it vaccinations, consistent with the serological data against the β spike protein. Similarly, the titers against the δ strain were both 1 / 64 in the high-dose in and it groups. The only potential difference with the low-dose group was observed; the titer against the δ variant was 1 / 32 for low-dose intratracheal administration, but there were no detectable neutralizing antibodies in the low-dose intranasal group, with a detection limit of 1 / 16. We also analyzed the neutralization of the founder strain by BAL. We found neutralizing antibodies in most protected mice, but not in susceptible mice. This strong correlation suggests that the ability of the vaccine to induce an immune response in the airway is important for the vaccine's ability to protect against severe infection and death. At the same time, despite the high viral infection dose, we did not see significant differences between intranasal and intratracheal immunization. This may be the result of the phenomenon of "shared mucosal immunity", in which immunity at one mucosal site leads to immunity at a distant site. We now plan to develop our vaccine as an inhaled dry powder and advance to a Phase I / II clinical trial.

[0189] Dose-dependent responses of variant spike-based vaccine candidate ISR52

[0190] Following changes in the main circulating variants and their possible immune escape mutations, we updated our vaccine candidate to include equal amounts of α- and β-variant Spike S1. We used in and it routes of administration and decided to reduce the dose to 5 and 20 μg of total Spike S1, this time immunizing 11 female hACE2 mice per group. During this study, we harvested and analyzed sera after the first and second immunizations. As expected, one immunization produced a weak anti-Spike IgG response. The second immunization clearly resulted in a strong increase in anti-Spike IgG titers in a dose-dependent manner, supporting our two-dose strategy; however, no differences between the immunization routes (in versus it) were observed. We then investigated the cross-reactivity of serum IgG and serum IgA against three variant Spike RBDs from the α, β, and δ variant strains of concern after two immunizations. Despite immunization with a combination of α and β Spike S1 proteins, we observed similar levels of IgG and IgA against all variant RBDs within the group ( Figure 3 C, S3A, S3B, S3C, S3D, S3E, S3F, S3G). We saw evidence of dose-dependency between the groups, but there were also no significant differences between the in and it groups at the same dose.

[0191] These serological data were complemented by analysis of neutralizing activity of pre-challenge sera pooled from each group. We found that both β and δ variants were neutralized in a dose-dependent manner in vaccinated mice from both in and it groups. Neutralization titers against β and δ variants were 1:128 and 1:64 in the higher dose 20 μg i.n. and it groups, respectively, consistent with our serological data (Figs. S3B, S3C). The only potential difference was observed in the low dose groups; low dose it showed a titer of 1 / 32 against the δ variant, but no neutralizing antibodies were detected in the low dose in group, with a detection limit of 1 / 16.

[0192] After observing a clear pre-challenge immune response with our updated vaccine, we decided to conduct a double challenge study using a higher infectious dose of SARS-CoV-2 than in the first challenge study (1x10 6TCID50) to challenge the potency of our candidate vaccine. As in the first challenge study, all unvaccinated control mice lost weight, developed symptoms, and were euthanized on day 4 post infection. Unfortunately, equipment failure resulted in the death of 4 mice in the high-dose intranasal group 2 days post infection; the deaths of these mice were not considered to be related to infection and were therefore excluded from further analysis. The low-dose groups showed a modest effect of the vaccine; 3 / 11 of the low-dose in group and 4 / 11 of the low-dose it group survived infection, while the remaining animals were euthanized on days 4, 5, or 6. By day 4 post infection, both groups of mice had significantly lost their body weight on average. The high-dose group showed a higher level of protection, with 4 / 7 of the in group and 7 / 11 of the it group surviving challenge. Consistent with this, we did not observe a significant loss of body weight in these mice. Thus, our vaccine was clearly dose-dependent, although we did not see differences between routes of administration by analyzing health status and survival.

[0193] Finally, we analyzed neutralizing activity in BAL harvested at endpoint. We found neutralizing antibodies in most protected mice but not in susceptible mice. This strong correlation suggests that the ability of the vaccine to induce an immune response in the airways is important for its ability to protect against severe infection and death. At the same time, despite the high viral infection dose, we did not see significant differences between intranasal and intratracheal immunization. This may be the result of the phenomenon of "shared mucosal immunity," in which immunization at one mucosal site leads to immunity at a distant site.

[0194] Alpha-spike-based ISR52 revealed that intranasal administration induces long-lasting T cell and broadly cross-reactive antibody responses.

[0195] Preliminary results showed that a vaccine based on Spike S1 of alpha variants alone should result in a broad cross-reactive immune response. Therefore, the vaccine was updated to be based on Spike S1 alpha alone as an antigen, and antibody and T cell responses were evaluated. In this study, we focused on in and it immunization of female C57BL / 6J (black 6) mice, using a total of 5 μg and 20 μg of Spike S1. We immunized 5 or 6 mice per group on days 0 and 14, and harvested blood, BAL, and spleen cells on day 28. Spike IgG levels in serum were dose-dependent and cross-reactive with RBD of the founder strain, alpha VOC, delta VOC (B.1.617.2), and Omicron VOC (B.1.1). We found a similar broad response pattern for BAL IgA, indicating that anti-Spike IgA was induced in relevant tissues before any viral exposure, confirming that our immunization strategy resulted in the induction of a local immune response.

[0196] T cell responses may be important in eliciting long-term cross-protection against severe COVID-19 disease. It has also been shown that T cell responses protect against lethal SARS-CoV-2 challenge in the absence of detectable neutralizing antibodies in hamster and mouse models. Therefore, we investigated whether ISR52 could elicit spike peptide-reactive T cells. Two weeks after the second immunization, we stimulated T cells from mice and found IFN-γ and IL-2-producing T cells by ELISpot in all in-administered mice, consistent with previous analysis of COVID-19 intranasal vaccines. Fewer mice immunized with it showed these responses, which may indicate that intranasal administration is more effective in generating T cell responses. We found a similar pattern when analyzing IFN-γ-responsive T cells by intracellular cytokine staining, with CD4+ and CD8+ populations found in the higher in dose groups.

[0197] Next, we repeated the immunization of C57BL / 6J mice to track T cell responses over a longer period of time. At 6 months post-vaccination, we continued to observe significant CD8+ T cell responses in the higher IN group and observed a similar trend for CD4+ T cell responses. It is often a challenge for subunit vaccines to induce strong and durable CD8+ T cell responses. In addition, antibody levels were maintained at high levels 6 months post-vaccination.

[0198] Overall, our ISR52 vaccine candidate showed good efficacy against high doses of virus from strains different from the strain used to immunize mice; this was true at the higher 20 μg Spike S1 dose, both for in and it administration. In addition, broad immune responses were demonstrated in terms of both cross-reactive antibodies and long-term Spike peptide-specific T cell responses. Based on these promising viral challenge, serology, and cellular immunology data, we are advancing a dry powder formulation of ISR52 for nasal administration or inhalation in a Phase I / II clinical trial.

[0199] Overview

[0200] It will be appreciated that any features and / or aspects discussed above in conjunction with the compounds or compositions or any other aspects of the invention apply by analogy to the methods and uses described herein.

[0201] The following figures and examples are provided below to illustrate the present invention. They are intended to be illustrative and should not be construed as limiting in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0203] Figure 1-A. Primary amino acid sequence of ISR52-DS (SEQ ID NO:7). The N-terminal domain NTD (magenta), receptor binding domain RBD (green) and SD1-SD2 region (grey) are highlighted. B. Representative diagram of the 3D structure of ISR52-DS, highlighting the same color-coded regions as the primary amino acid sequence. PDB accession number 7A92 was used to prepare this schematic.

[0204] Figure 2 - Relative body weight after immunization and inoculation with SARS-CoV-2. Animals were inoculated with the virus on day 28. in: intranasal; it: intratracheal; sc: subcutaneous.

[0205] Figure 3 - Survival of hACE2 mice (untreated controls vs. immunized animals) after SARS-CoV-2 virus challenge. hACE2: human angiotensin-converting enzyme 2.

[0206] Figure 4 - IgG titers against Spike (Jiangcheng = original strain), RBD (South Africa = β) and RBD (UK = α) after immunization (geometric mean ± geometric SD). Samples were obtained on day 28. Immunizations were performed on days 0 and 14. One animal in group 6 was excluded because it received only one dose of the candidate vaccine. RBD: receptor binding domain.

[0207] Figure 5 - IgA titers (geometric mean ± geometric SD) against Spike (Jiangcheng = original strain), RBD (South Africa = β) and RBD (UK = α) after immunization. Immunizations were performed on days 0 and 14. Samples were obtained on day 28. One animal in group 6 was excluded because it received only one dose of the candidate vaccine. RBD: receptor binding domain.

[0208] Figure 6 - Total immunoglobulin titers against RBD after immunization (day 0 and day 14) (geometric mean ± geometric SD). Samples were collected at endpoint. One animal in group 6 was excluded because it received only one dose of the candidate vaccine. RBD: receptor binding domain.

[0209] Figure 7 -IgG titers in BAL against Spike (Jiangcheng = original strain), RBD (SA = β) and RBD (UK = α) (geometric mean ± geometric SD). Immunizations were performed on days 0 and 14. Samples were obtained at the endpoint. One animal in Group 6 was excluded because it received only one dose of the candidate vaccine. BAL: bronchoalveolar lavage fluid. RBD: receptor binding domain.

[0210] Figure 8- IgA titers in BAL against Spike (Jiangcheng = original strain), RBD (SA = β) and RBD (UK = α) (geometric mean ± geometric SD). One animal in Group 6 was excluded because it received only one dose of the candidate vaccine. BAL: bronchoalveolar lavage fluid. RBD: receptor binding domain.

[0211] Fig. 9 - Immunoglobulin G (IgG) and immunoglobulin A (IgA) titers against SARS-CoV-2 RBDα and β and SARS-CoV-2 Spike S1 (Jiangcheng = original strain) in serum and bronchoalveolar lavage fluid (BAL) after administration of the test substance (20 μg trimeric SARS-CoV-2 spike + 10 μg polyIC or polyIC:LC + 40 μg vitamin A; Group 1 and Group 2, respectively). Serum IgG titers were determined two weeks after the first administration of the test substance (day 14) and two weeks after the second administration of the test substance (day 28). Serum IgA titers and IgG and IgA levels in BAL fluid were determined two weeks after the second administration of the test substance. Data are expressed as arithmetic means. RBD: receptor binding domain.

[0212] Fig.10 - Immunoglobulin G (IgG) titers in serum against SARS-CoV-2 RBD α and β and SARS-CoV-2 Spike S1 (Jiangcheng = original strain) two weeks after the first administration of the test article containing different doses of polyIC:LC (day 14) and two weeks after the second administration of the test article containing different doses of polyIC:LC (day 28). Data are expressed as arithmetic means. RBD: receptor binding domain.

[0213] Fig.11 - Immunoglobulin G (IgG) titers against SARS-CoV-2 RBD α and β and SARS-CoV-2 Spike S1 (Jiangcheng = original strain) in bronchoalveolar lavage (BAL) two weeks after the second administration of the test article containing different doses of polyIC:LC. Data are expressed as arithmetic means. RBD: receptor binding domain.

[0214] Fig.12 - Immunoglobulin A (IgA) titers against SARS-CoV-2 RBD α and β and SARS-CoV-2 Spike S1 (Jiangcheng = original strain) in serum and bronchoalveolar lavage (BAL) two weeks after the second administration of the test article containing different doses of polyIC:LC. Data are expressed as arithmetic means. RBD: receptor binding domain.

[0215] Fig.13- Immunoglobulin G (IgG) and immunoglobulin A (IgA) titers in serum and bronchoalveolar lavage fluid (BAL) against SARS-CoV-2 RBD α and β and SARS-CoV-2 Spike S1 (Jiangcheng = original strain) after administration of the test substance (20 μg monomeric SARS-CoV-2 Spike + 10 μg poly IC:LC) with (Group 4) and without (Group 8) 40 μg vitamin A. Serum IgG titers were determined two weeks after the first administration of the test substance (Day 14) and two weeks after the second administration of the test substance (Day 28). Serum IgA titers and IgG and IgA levels in BAL fluid were determined two weeks after the second administration of the test substance. Data are expressed as arithmetic means. (RBD: receptor binding domain).

[0216] Fig.14 - Immunoglobulin G (IgG) and immunoglobulin A (IgA) titers against SARS-CoV-2 RBD α and β and SARS-CoV-2 Spike S1 (Jiangcheng = original strain) in serum and bronchoalveolar lavage fluid (BAL) after administration of the test substance (Group 2: 20 μg trimeric SARS-CoV-2 spike + 10 μg poly IC:LC + 40 μg vitamin A; Group 3: 20 μg SARS-CoV-2 RBD mixture + 10 μg poly IC:LC + 40 μg vitamin A; Group 4: 20 μg monomeric SARS-CoV-2 spike + 10 μg poly IC:LC + 40 μg vitamin A). Serum IgG titers were determined two weeks after the first administration of the test substance (day 14) and two weeks after the second administration of the test substance (day 28). Serum IgA titers and IgG and IgA levels in BAL fluid were determined two weeks after the second administration of the test substance. Data are expressed as arithmetic means. (RBD: receptor binding domain).

[0217] Fig.15 - Relative body weight after immunization and inoculation with SARS-CoV-2. Animals were inoculated with the virus on day 28. HD: high dose; in: intranasal; it: intratracheal; LD: low dose; pi: post infection

[0218] Fig.16 - Survival of hACE2 mice after SARS-CoV-2 virus challenge (untreated control vs. vaccinated animals). Statistical analysis was performed using the Log-Rank (Mantel-Cox) test. HD: high dose; in: intranasal; it: intratracheal; LD: low dose.

[0219] Fig.17- IgG titers (geometric mean ± geometric SD) against Spike (Jiangcheng = original strain), RBD (SA = β) and RBD (UK = α), S1 RBD2 (δ) and S1 RBD2 (κ) after immunization. Samples were obtained on days 14 and 28 or at endpoint. Immunizations were performed on days 0 and 14. HD: high dose; in: intranasal; it: intratracheal; LD: low dose; RBD: receptor binding domain.

[0220] Fig.18 - IgA titers against Spike (Jiangcheng = original strain), RBD (SA = β) and RBD (UK = α), S1 RBD2 (δ) and S1 RBD2 (κ) after immunization (geometric mean ± geometric SD). Samples were obtained on days 14 and 28 or at endpoint. Immunizations were performed on days 0 and 14. HD: high dose; in: intranasal; it: intratracheal; LD: low dose; RBD: receptor binding domain.

[0221] Fig.19 - IgG titers in BAL against Spike (Jiangcheng = original strain), RBD (SA = β) and RBD (UK = α) (geometric mean ± geometric SD). Immunizations were performed on days 0 and 14. Samples were obtained at the end point. HD: high dose; in: intranasal; it: intratracheal; LD: low dose; RBD: receptor binding domain.

[0222] Fig. 20 - IgA titers in BAL against Spike (Jiangcheng = original strain), RBD (SA = β) and RBD (UK = α) (geometric mean ± geometric SD). Immunizations were performed on days 0 and 14. Samples were obtained at the end point. HD: high dose; in: intranasal; it: intratracheal; LD: low dose; RBD: receptor binding domain.

[0223] Fig.21 - Splenocytes secreting spike-specific interleukin 2 (IL-2) or interferon gamma (IFNγ) (mean ± SEM), expressed as the number of spots, after single (D.14) or double (D.28) intranasal (in) or intratracheal (it) administration of low-dose (5μg spike + 10μg polyIC:LC, LD) or high-dose (20μg spike + 10μg polyIC:LC, HD) test substances. Analyzed using Kruskal-Wallis nonparametric ANOVA followed by Dunn's multiple comparison post hoc test, *p<0.05, **p<0.01, ***p<0.001.

[0224] Fig. 22- Spike-specific interferon gamma (IFNγ) after two intranasal (in) or intratracheal (it) administrations of low-dose (5 μg Spike + 10 μg poly IC:LC, LD) or high-dose (20 μg Spike + 10 μg poly IC:LC, HD) test article + T cell percentage (mean ± SEM). Kruskal-Wallis nonparametric ANOVA analysis followed by Dunn's multiple comparison post hoc test, **p<0.01.

[0225] Fig.23 - Relative body weight (mean ± SEM) after intranasal (in) or intratracheal (it) administration once (cohort A) or twice (cohort B) of low-dose (5 μg spike + 10 μg poly IC:LC, LD) or high-dose (20 μg spike + 10 μg poly IC:LC, HD) test article. Administration was performed on day 0 and day 14.

[0226] Fig.24 - Circulating immunoglobulin IgG titers (geometric mean ± 95% CI) after one (Day 14) or two (Day 28) administrations of low-dose (5 μg Spike + 10 μg poly IC:LC, LD) or high-dose (20 μg Spike + 10 μg poly IC:LC, HD) test article intranasally (in) or intratracheally (it) administration.

[0227] Fig.25 - Immunoglobulin (IgG) titers in bronchoalveolar lavage (BAL) fluid (geometric mean ± 95% CI) after two intranasal (in) or intratracheal (it) administrations of low-dose (5 μg Spike + 10 μg Poly-IC:LC, LD) or high-dose (20 μg Spike + 10 μg Poly-IC:LC, HD) test article.

[0228] Figure 26-AJ shows ELISA results showing cross-reactivity with spike protein, α, δ and Omicron.

[0229] Fig. 27 - Immunoglobulin G (IgG) titers against SARS-CoV-2 Spike-RBD2α and SARS-CoV-2 Spike-RBD2δ in serum and bronchoalveolar lavage (BAL). Animals received two doses of low-dose (5μg Spike + 10μg polyIC:LC, LD) or high-dose (20μg Spike + 10μg polyIC:LC, HD) test article via intranasal (in) or intratracheal (it) administration.

[0230] Fig.28- Spike-specific IFNγ after two intranasal (in) or intratracheal (it) administrations of low-dose (5 μg Spike + 10 μg polyIC:LC, LD) or high-dose (20 μg Spike + 10 μg polyIC:LC, HD) test articles + T cell percentage (mean ± SEM). Kruskal-Wallis nonparametric ANOVA analysis followed by Dunn's multiple comparison post hoc test, p < 0.01.

[0231] Fig.29 - Robust anti-Spike IgA in BAL of the high dose in group is shown, with weak induction in the sc and it groups. Anti-Spike S1 IgA was analyzed from BAL fluid harvested at endpoint. BAL was diluted 1:30 and the optical density (OD) of individual mice is shown.

[0232] Fig.30 - Neutralizing antibodies in BAL fluid at endpoint are shown. BAL was then diluted starting at 1 / 4 (LoD) and tested for neutralization of SARS-CoV-2 infection in Vero E6 cells. Results for each individual are plotted.

[0233] Fig.31 -The presence of SARS-CoV-2 RNA in BAL and lung tissue at euthanasia is shown. Bronchoalveolar lavage fluid (BAL) and organs were harvested from mice on the day of endpoint. SARS-CoV-2 RNA in BAL was detected from mice that died during infection, including control mice and 4 mice from the low-dose sc group. At the same time, low to undetectable viral RNA (Ct>35) was found in surviving mice. Similar results were obtained for lung tissue, although fewer animals overall had quantifiable SARS-CoV-2 RNA. These results indicate that, with the exception of the low-dose sc group, vaccinated animals had cleared the infection by day 11 post-infection. SARS-CoV-2 RNA levels in BAL fluid and lung tissue at endpoint. 1 mL of BAL fluid was collected from each mouse on the day of euthanasia. Of this fluid, 90 μL was subjected to RNA extraction and SARS-CoV-2E gene RT-qPCR. The Ct values ​​for each vaccine group are plotted on the left y-axis. At the endpoint, a portion of lung tissue was harvested for RNA, and 5 ng of RNA was subsequently analyzed by RT-qPCR for E gene copy number (as shown on the right y-axis).

[0234] Fig.32- Shown, histopathological analysis revealed inflammation and necrosis in brain tissue in the unvaccinated (8 / 8) and low-dose (5 / 7) and high-dose (2 / 7) subcutaneously vaccinated groups; no similar observations were made for animals vaccinated by the respiratory route. These results suggest that both in and it administration of ISR52 protect the hACE2 mouse model from signs of neuronal damage, even at low doses. Histopathological scoring of perivascular inflammatory cell infiltration of meningeal tissue at the striatal level of the brain of challenged mice at the endpoint.

[0235] Fig.33 SEQ ID NO:3, ISR52 is shown

[0236] Fig.34 SEQ ID NO:7, ISR52-SD Specific implementation plan

[0237] 1. A vaccine composition comprising one or more proteins expressed on the surface of a respiratory virus or bacterium and one or more pharmaceutically acceptable excipients, wherein the composition is in the form of particles having an average particle size ranging from 2 to 50 μm.

[0238] 2. A vaccine composition according to claim 1, wherein the protein is present in its three-dimensional structure.

[0239] 3. A vaccine composition according to claim 1 or 2, comprising one or more pharmaceutically acceptable excipients to ensure fluidity, ensure protein structure, ensure protein stability, avoid cohesion within particles and / or avoid aggregation.

[0240] 4. A vaccine composition according to any of the preceding items, wherein the respiratory virus is selected from influenza virus, respiratory syncytial virus, parainfluenza virus, metapneumovirus, rhinovirus, coronavirus, adenovirus and bocavirus.

[0241] 5. A vaccine composition according to any of the preceding items, wherein the respiratory virus is a coronavirus.

[0242] 6. A vaccine composition according to any of the preceding items, wherein the one or more proteins are spike proteins of a coronavirus, such as the full-length spike protein of COVID-19 or a variant or fragment thereof.

[0243] 7. The vaccine composition according to any one of items 1 to 3, wherein the respiratory bacteria is selected from Streptococcus pneumoniae, Mycoplasma pneumoniae, Haemophilus influenzae, Chlamydia pneumoniae, Chlamydia psittaci, Moraxella catarrhalis, Mycobacterium tuberculosis, Mycobacterium avium and Mycobacterium marinum.

[0244] 8. A vaccine composition according to any preceding claim, designed for nasal administration.

[0245] 9. A vaccine composition according to any preceding claim, wherein the average particle size is in the range of 20 to 50 μm, such as 30 to 40 μm, and the particle size distribution shows that less than 10% of the particles have a particle size of 10 μm or less.

[0246] 10. The vaccine composition according to any one of items 1 to 7, which is designed for inhalation.

[0247] 11. A vaccine composition according to any one of items 1-7 and 10, wherein the average particle size is 10 μm or less, such as at most 8 μm, at most 6 μm, at most 5 μm, or in the range of 1 μm to 5 μm, such as in the range of 3 μm to 5 μm.

[0248] 12. A vaccine composition according to any preceding claim, having suitable flowability when measured according to the method described in European Pharmacopoeia 10.0, 2.9.16, using a stemless funnel with a diameter of 10±0.01 mm and a nozzle 1.

[0249] 13. A vaccine composition according to any of the preceding items, wherein the one or more pharmaceutically acceptable excipients are selected from cellulose, cellulose derivatives, methylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, sugars including monosaccharides, disaccharides, oligosaccharides, polysaccharides, amino acids including peptides, and mixtures thereof.

[0250] 14. A vaccine composition according to any of the preceding claims, wherein the one or more pharmaceutically acceptable excipients are selected from disaccharides, oligosaccharides, amino acids, peptides and polypeptides.

[0251] 15. A vaccine composition according to claim 14, wherein the disaccharide is selected from trehalose, sucrose, and lactose.

[0252] 16. A vaccine composition according to claim 15, wherein the disaccharide is trehalose.

[0253] 17. A vaccine composition according to claim 14, wherein the oligosaccharide is a cyclodextrin.

[0254] 18. A vaccine composition according to claim 17, wherein the cyclodextrin is β-cyclodextrin, such as hydroxypropyl β-cyclodextrin.

[0255] 19. A vaccine composition according to claim 14, wherein the amino acid is selected from lysine, and / or the peptide is selected from trilysine, and / or the polypeptide is selected from polylysine.

[0256] 20. The vaccine composition according to any of the preceding claims, further comprising an adjuvant.

[0257] 21. The vaccine composition according to any of the preceding claims, further comprising a TLR agonist.

[0258] 22. The vaccine composition of claim 21, wherein the TLR agonist is a TLR2 agonist and / or a TKR3 agonist.

[0259] 23. The vaccine composition of item 21 or 22, wherein the TLR agonist is a TLR3 agonist.

[0260] 24. The vaccine composition according to any one of items 21-23, wherein the TLR agonist is a TLR3 agonist selected from poly-IC and poly-IC:LC.

[0261] 25. The vaccine composition according to any of the preceding items, further comprising vitamin A and / or vitamin D, or in combination with vitamin A and / or D.

[0262] Materials and methods

[0263] ISR52

[0264] The ISR52 vaccine is based on the SARS-CoV-2 spike S1α protein and the adjuvant polyIC:LC. Different spike mutants were evaluated during the development of the vaccine presented in this article. Each spike protein was manufactured by Icosagen (Tartu, Estonia). In the first challenge study, SARS-CoV-2 trimeric spike (catalog number P-309-100) was used; in the second challenge study, monomeric SARS-CoV-2 spike S1 VOC 202012 / K(α) (catalog number P-310-100) and monomeric SARS-CoV-2 spike S1 VOC 501.V2(β) (catalog number P-319-100) were used. In the T cell response study, monomeric SARS-CoV2 spike S1 B.1.17 (similar to catalog number P-310-100, but without the His tag) was used. For the first challenge, all-trans retinoic acid (Sigma-Aldrich) was used as supporting substance, 40 μg per mouse, with 10 μg polyIC (Invivogen) as adjuvant. For the rest of the studies, 10 μg polyIC:LC (Hiltonol, Oncovir) was used as adjuvant.

[0265] Virus

[0266] SARS-CoV-2 strain SARS-CoV-2 / 01 / people / 2020 / SWE (Monteil et al., 2020) is described as the founding strain herein. SARS-CoV-2 strain hCoV-19 / Sweden / 21-51217 / 2021 (lineage B.1.351) (Normark et al., 2021) is described as a β strain herein. SARS-CoV-2 strain SARS-CoV-2 / hu / DK / SSI-H13 is provided by Dr. Charlotta Polacek Strandh of the Serum Institute of Statums in Copenhagen, Denmark, and is a δ strain as described herein. All SARS-CoV-2 strains are grown on VeroE6 cells in a BSL-3 facility and titrated by plaque assay (Becker et al., 2008; Monteil et al., 2020) or TCID50 (Wulff et al., 2012) with the presence of cytopathic effect (CPE) as the endpoint.

[0267] Animal experiments

[0268] Female AC70 hACE2 mice (Tseng et al., 2007) were purchased from Taconic, Denmark. The handling of mice was governed by ethical permit No. 16765-2020 approved by the Regional Committee for Ethical Experimentation in Animals of Stockholm. Animals that reached humane endpoints were euthanized according to the approved ethical application. Blood, bronchoalveolar lavage fluid, and tissues were sampled from these animals and analyzed according to the study plan. All animal experiments were performed under BSL-3 conditions in the Astrid Fagraeus Laboratorium. Isoflurane anesthesia was used for intranasal vaccination, intranasal infection, euthanasia, and bronchoalveolar lavage. Ketamine (Ketaminol) and Rompun anesthesia were used for intratracheal vaccination. Once the mice were fully anesthetized, they were placed in the supine position. A curved 19G steel gavage tube was used to administer 25 μL of the vaccine between the vocal cords. The adjuvants poly(I:C)(HMW) (Catalog No. vac-pic, Invivogen), ATRA (Catalog No. R2625, Sigma Aldrich) and / or polyIC:LC (Hiltonol, Oncovir Inc) were mixed with the antigen immediately before immunization. Mice were infected with the specified infectious dose of SARS-CoV-2 in a volume of 25 μL intranasally. Health status was recorded on the day of vaccination and every day after infection according to the Irwin screen.

[0269] cell

[0270] VeroE6 cells were obtained from ATCC (CRL-1586) and maintained at 37° C. in a humidified atmosphere of 5% CO 2 in DMEM medium supplemented with 10% fetal calf serum (FCS; Gibco), 1% non-essential amino acids (Gibco), and 10 mM HEPES (Gibco).

[0271] Microneutralization assay

[0272] One day before infection, VeroE6 cells were plated at 2×10 4 The inoculation density of 10 cells was inoculated on a 96-well plate. BAL or serum was heat inactivated at 56°C for 30 minutes and then diluted in DMEM medium supplemented with 2% FCS, 100 units / mL penicillin and 100 μg / mL streptomycin. The diluted BAL / serum was then divided into three parts and placed in a 96-well round-bottom plate, each well was mixed with 500 PFU (plaque forming units) of SARS-CoV-2, and incubated at 37°C / 5% CO2 for 1 hour. The culture medium of VeroE6 cells was aspirated and replaced with a virus: BAL / serum mixture. Including virus only, BAL / serum only and convalescent patient serum controls. After incubation at 37°C / 5% CO2 for 3 days, the presence of CPE was checked. Neutralization activity was assigned to wells showing no CPE at all. The neutralization titer was then calculated as a dilution factor, with >50% of the wells showing neutralization activity.

[0273] ELISA

[0274] Transparent flat-bottomed immunonon-sterile 96-well polystyrene plates (Thermo Scientific) were coated with 50 μl / well of 5 μg / ml in PBS1X buffer pH 7.2 purchased from Icosagen (Tartu, Estonia) of the founder strain spike S1, α variant RBD2, β variant RBD2, δ variant RBD2 or Omicron variant RBD2. The plate was covered with sealing tape and incubated overnight at 4°C with a transparent flat-bottomed immunonon-sterile 96-well polystyrene plate (Thermologist) coated with 5 μg / ml (50 μl / well) in PBS1X (pH 7.2) buffer. The plate was then washed with PBS+0.05% Tween 20 and incubated with 150 μl / well of blocking solution (diluent, Mabtech) at room temperature for 1 hour after coating. The plate was washed and then 100 μl of the required diluted serum was incubated in diluent (Mabtech) for 2 hours at room temperature and then washed. Add detection antibody diluted 1:1000 in diluent, 100 μl / well, and incubate at room temperature for 1 hour. For IgG, use coupled anti-mouse IgG alkaline phosphatase (ALP) (Catalog No. 3310-4, Mabtech), for IgA, first add biotinylated anti-mouse IgA (100 μl / well, diluted 1:1000 in diluent) (Catalog No. 3865-6, Mabtech), then add streptavidin ALP (100 μl / well, diluted 1:1000 in diluent) (Catalog No. 3310-8, Mabtech), and incubate at room temperature for 1 hour. After washing, add 100 μl pNPP substrate (Mabtech) to each well, perform enzyme reaction for 30 minutes, and measure analyte absorbance (410nm) and background absorbance (620nm) with BMG LABTECH FLUOstar omega ELISA plate reader. Results were considered positive when the optical density (OD) of mAb obtained by ELISA was three times greater than that of the negative control.All antibodies, diluents and pNPP substrate were from Mabtech.

[0275] IL-2 and IFN-γ ELISpot

[0276] IL-2 and IFN-γ ELISpot reagents were purchased from Mabtech and the assays were performed according to the manufacturer's instructions. Mabtech's mouse IL-2 ELISpot PLUS kit (ALP) and mouse IFN-γ ELISpot PLUS kit (ALP) were used to detect IL2 and IFN-γ, respectively. The pre-coated plates were washed 4 times with sterile PBS pH 7.2 (Gibco Life Technologies Limited) and blocked with 10 / 90% FBS / RPMI 1640Glutamax (Gibco Life Technologies Limited) for at least 30 minutes at room temperature for conditioning. The SARS CoV2 S1 scanning pool antigen stimulation stock solution (Mabtech) was prepared from the lyophilized peptide pool by adding 40 μL DMSO and 85 μL PBS, and then further diluted in cell culture medium to obtain a peptide concentration of 2 μg / ml, 200 μg / ml. Conditioned medium was removed from the plates, 100 μL of peptide pool was added to each well, followed by 100 μL of cell suspension, whereby 250,000 mouse splenocytes were stimulated per well. Incubate at 37°C, 5% CO2 for 15-18 hours for IL2 plates and at 37°C, 5% CO2 for 32-35 hours for IFNγ plates. The next day, cells were removed, plates were washed five times, and then incubated at room temperature for 2 hours with 100 μl / well of detection antibody (5H4-biotin) diluted to 1 μg / ml in PBS containing 0.5% FBS for IL-2 detection and detection antibody R4-6A2-biotin for IFN-γ. Plates were then washed five times with PBS and then incubated with 100 μl / well of streptavidin-ALP diluted 1:1000 in PBS containing 0.5% FBS. After incubation for 1 hour at room temperature, the plates were washed as before, 100 μl / well of substrate (BCIP / NBT-plus) was added, and the plates were incubated for 15 minutes at room temperature in the dark. After extensive washing in tap water, the plates were dried overnight and then the spot forming units were detected using an IRIS or ASTOR ELISpot instrument.

[0277] In vitro proliferation and intracellular cytokine staining (ICS) analysis by flow cytometry

[0278] According to the manufacturer's instructions (ThermoFisher Scientific, MA, USA), prepare the spleen cells from the mice vaccinated and the control mice, and use CellTrace Violet dyeing.Then stimulate 1 million spleen cells or do not process in the hole of flat-bottom 96-well plate, stimulate 4 days, duplicate.After 4 days, stimulate the cells again for 24 hours with antigen.Before harvesting 6-8h, protein transport inhibitor mixture is added to cells (ThermoFisher Scientific).Harvest cells, merge the duplicate wells into the 96-well plate at the bottom of V, to reduce the cell loss in the intracellular staining process.Then use T cell surface markers (CD3 FITC, CD8 PerCp-Cy5.5, CD4 APC, all from ThermoFisher Scientific) to dye the cell sample, then use intracellular fixation / perm kit (ThermoFisher Scientific) according to the manufacturer's instructions intracellular staining IFN-γ (IFNg PE clone XMG1.2.ThermoFisher Scientific). Samples were analyzed using a MACSQuant 16 instrument (Miltenyi Biotech).

[0279] SARS-CoV-2 RT-qPCR

[0280] An equal volume of BAL from each mouse was mixed with Trizol (Thermo Fisher). RNA was extracted using the Direct Zol RNA Mini Kit (Zymo research) and analyzed for SARS-CoV-2 RNA content by RT-qPCR using the following primers / probes as previously described (Monteil et al., 2020). SARS-CoV-2 E gene:

[0281] Forward:ACAGGTACGTTAATAGTTAATAGCGT;

[0282] Reverse:ATATTGCAGCAGTACGCACACA;

[0283] Probe: FAM-ACACTAGCCATCCTTACTGCGCTTCG-MGB

[0284] Lung tissue was lysed in Trizol and RNA was extracted using the Direct Zol RNA Mini Kit (Zymo research). The copy number of SARS-CoV-2 RNA was determined by analyzing 5 ng RNA from each lung tissue sample and generating a standard curve using E gene RNA transcripts with a defined copy number (EDX SARS-CoV-2 Standard, Biorad). Primers and probes were as described above.

[0285] Histopathology

[0286] Lung and brain tissues were harvested, fixed with 4% formaldehyde and sectioned (between 4-6 μm). Sections were stained with hematoxylin-eosin and histopathological changes were scored based on distribution, severity (1 to 5, minimal, mild, moderate, marked and severe, or P for presence, and morphological features).

[0287] Summary and conclusions of the conducted experiments

[0288] Based on the available immunogenicity data and the cross-reactivity of IgG and IgA antibodies observed in nonclinical studies, immunization with SARS-CoV-2 Spike S1α as the sole antigen is expected to have comparable efficacy to immunization with other Spike mutants. The full-length Spike S1 protein used as the antigen in the ISR52 vaccine is able to generate a broad immune response to different Spike mutants. The COVID-19 epidemiology is constantly changing with the emergence of new SARS-CoV-2 variants. These SARS-CoV-2 variants may carry mutations in antigenic regions, which poses a challenge to vaccine developers. The SARS-CoV-2α variant carries a mutation in the RBD of the Spike protein that increases the binding affinity to the ACE2 receptor, which may at least partially explain the higher infectivity of this strain compared to the original Jiangcheng strain (Zahradnik et al., 2021). The spike α protein shares the N501Y mutation with the β, γ and Omicron (B.1.1.529) variants in the RBD, and shares the D614G mutation with the β, γ, δ and Omicron (B.1.1.529) variants.

[0289] Sequence Listing

[0290]

[0291] Example

[0292] Example 1 - Vaccine Composition

[0293] Table: Composition of SARS-CoV-2 Spike Protein Powder for Nasal Administration, 30 μg

[0294]

[0295]

[0296] Batch Recipe

[0297] The drug, SARS-CoV-2 spike protein powder, is for nasal administration and is produced in two stages.

[0298] First, the drug substance is used to produce a SARS-CoV-2 spike protein feed solution, which is then spray-dried to produce a bulk drug product. This bulk drug product is then filled into the device to produce a finished drug product.

[0299] The batch formulation of a typical batch of SARS-CoV-2 Spike Protein Feed Solution is shown below.

[0300] Batch Formulation of SARS-CoV-2 Spike Protein Feed Solution

[0301]

[0302] Batch Formulation of SARS-CoV-2 Spike Protein Bulk Drug Product

[0303]

[0304]

[0305] Description of the manufacturing process and process controls

[0306] The manufacturing process consists of producing a SARS-CoV-2 spike protein feed solution, which is then dried via a spray drying process to produce the final SARS-CoV-2 spike protein bulk drug product. This bulk drug product is then filled and sealed in a device to produce the final drug product.

[0307] The desired amount of trehalose dihydrate and hydroxypropyl beta-cyclodextrin are dissolved in the desired amount of water for injection (solution A). The desired amount of poly IC:LC is distributed in a bulk container (bulk container) (from a 1.2mL vial) and ultrasonicated to mix. The poly IC:LC bulk suspension is added to solution A under gentle stirring until mixed, and then the desired amount of SARS-CoV-2 spike protein is added to form a SARS-CoV-2 spike protein feed solution. The SARS-CoV-2 spike protein feed solution is then spray dried to produce a SARS-CoV-2 spike protein bulk drug. Bulk drugs are subjected to IPC testing (IPC 1-IPC 2).

[0308] The bulk drug product is then filled into the devices using an automatic precision balance (fill by weight). The devices are sealed with foil using a heat sealer, sealed and labeled. IPC testing (IPC 3-IPC 4) is performed during the filling and sealing process. Acceptable devices are packaged in suitable foil bags containing desiccant. Batch release testing is performed on representative samples of SARS-CoV 2 spike protein powder for nasal administration.

[0309] Production process and control of SARS-CoV 2 spike protein powder for nasal administration

[0310]

[0311]

[0312] Control of key steps and intermediates

[0313] Conducted according to EMA / CHMP / QWP / 545525 / 2017, no data provided.

[0314] Process validation and / or evaluation was performed according to EMA / CHMP / QWP / 545525 / 2017; no data were provided.

[0315] Controlled pharmacopoeial excipients for excipients are shown in the table below.

[0316] Pharmacopoeia excipients

[0317] excipient Pharmacopoeia Standards Trehalose dihydrate European Pharmacopoeia Hydroxypropyl-β-cyclodextrin European Pharmacopoeia

[0318] Non-pharmacopoeial excipients A non-pharmacopoeial excipient was included in the formulation: poly IC:LC.

[0319] Excipients of animal or human origin

[0320] IMP formulations do not include excipients of animal or human origin.

[0321] Novel excipients

[0322] No novel excipients were used.

[0323] Example 2 - Overview of Nonclinical Studies

[0324] Table 1 - Overview of nonclinical studies

[0325]

[0326]

[0327] hACE2: human angiotensin-converting enzyme 2. IgA: immunoglobulin A; IgG: immunoglobulin G; in: intranasal; it: intratracheal; RBD: receptor binding domain; sc: subcutaneous. TCID50: median tissue culture infectious dose.

[0328] 1 : The spike protein used in the initial nonclinical studies (AB21-04, AB21-31, AB21-33) contained two additional amino acids to enhance protein secretion and a polyhistidine tag (His tag) to facilitate purification. Subsequent studies (i.e., AB21-64 and later) used the native form of the protein.

[0329] Example 3-AB21-04-Study to evaluate the efficacy of COVID-19 vaccines against SARS-CoV-2 infection in hACE2 transgenic mice

[0330] Study AB21-04 evaluated the efficacy of candidate Covid-19 vaccines against SARS-CoV-2 infection in transgenic mice expressing human ACE2, where expression of human ACE2 renders the mice susceptible to infection with the virus. The test substance used in this study was based on the SARS-CoV-2 trimeric spike protein S1 (original strain), the adjuvant polyIC VacciGrade (10 μg), and the supporting substance vitamin A (0.4 mg / mL). For each route of administration (sc, in, or it), the LD (10 μg) and HD (80 μg for in and it administration, 100 μg for sc administration) of the spike protein were evaluated. Fifty-five female AC70 hACE2 transgenic mice were included in this study and divided into seven groups. Seven animals (group 2) were not vaccinated with any vaccine and served as the control group. The remaining 48 animals (groups 1 and groups 3-7) received different doses of antigen as well as adjuvant and vitamin A (sc, in, or it) on day 0 and day 14 or 15 (Table 2).

[0331] Table 1: Treatment Groups in Study AB21-04

[0332]

[0333] HD: high dose. in: intranasal; it: intratracheal. LD: low dose. sc: subcutaneous.

[0334] Two weeks after the second dose (i.e., day 28), animals were given 1.875 x 10 5TCID50 SARS-CoV-2 inoculation. Following infection with SARS-CoV-2, animals were weighed daily and monitored for changes in health status until endpoint (day 38 or 39). The Irwin screen was modified to specifically include body posture (lying flat, limb extension, hunching, rigidity, asymmetry), autonomic signs (miosis, mydriasis, ptosis, sweating, piloerection, salivation), central signs (tremor, head shaking, wet-dog shakes, aggression), and gross behavior (locomotor activity and stereopsis scores -2 to +2). Health status and weight records were summarized descriptively and analyzed i) to determine if treatments elicited any adverse effects, ii) to assess the impact of SARS-CoV-2 infection, and iii) to determine if treatments altered responses to SARS-CoV-2.

[0335] Blood samples were collected for serum separation before vaccination, on day 14, day 28, and at the end point. At the end point, BAL was performed using 1 mL of sterile PBS for determination of viral RNA. The spleen, lungs, and trachea were removed, and a section of the lung (lower respiratory tract) and trachea (upper respiratory tract) were preserved for analysis of viral titers. Histopathological analysis was performed on the lungs and skull (for brain and nasopharyngeal tissue).

[0336] One animal in Group 3 received an incomplete first dose of the test item; one animal in Group 6 did not receive the first immunization due to lack of test item. Three animals in Group 7 died after the first immunization (one animal died due to anesthesia overdose, and the remaining two animals were euthanized due to complications caused by administration technique). In addition, one animal in Group 3 was found dead after the second immunization due to lack of oxygen caused by failure to properly insert the cage into the rack.

[0337] Weight and health

[0338] Administration of the test article did not unduly affect the body weight of the animals. Animals in Group 7 showed a slight decrease in body weight between Day 0 and Day 14; however, all groups generally gained weight after the second vaccination ( Figure 2 ).

[0339] Challenge of unvaccinated animals with SARS-CoV-2 resulted in a significant loss of body weight. There were significant differences in the relative body weight of animals in all vaccinated groups compared to unvaccinated animals, especially on day 32. By day 32, the body weight of unvaccinated animals had dropped to 85.7 ± 0.7% of their original body weight, while the body weight of vaccinated animals remained between 97.0% and 101.7% of their original body weight. The body weight of one animal in group 6 (LD, it) showed a similar decline as that of unvaccinated animals, reaching 83.1% of its original body weight on day 32. This was an animal that had been vaccinated only once (day 14).

[0340] The differences in body weight between the vaccinated groups were additionally significant. The relative body weights of Groups 1 (LD, sc) and 4 (LD, in) were significantly lower than those of Groups 5 (HD, in), 6 (LD, it), and 7 (HD, it). One animal in Group 3 (HD, sc) also showed a dramatic decline and dropped to 84.7% of its initial body weight; however, this animal received an incomplete first dose of the test article.

[0341] Vaccine administration did not significantly affect the health status of the animals, and no effects on respiratory function were observed. Administration of the test substance did not significantly affect the health status of the animals, and no effects on respiratory function were observed when the animals were visually examined. However, vaccination with SARS-CoV-2 was associated with a severe deterioration in health status four days after vaccination, especially in the unvaccinated group (Group 2). Animals developed hunched posture, erect hair, and reduced movement. Two animals showed signs of aggression, and two animals had abnormal motor behavior. Animals in the unvaccinated control group (Group 2) were euthanized on day 32 due to a sharp deterioration in health status and weight loss. Vaccinated animals showed little change in obvious health status. Three animals in Group 1 (LD, sc) were euthanized on days 32 or 34 due to the development of hunched posture, erect hair, increased movement, rigidity, and tremors. Two animals showed increased movement, indicating infection of the central nervous system (CNS) with SARS-CoV-2. In addition, one animal in Group 6 (LD, it) developed symptoms on day 32. These three animals were subsequently euthanized. The remaining vaccinated animals had no obvious symptoms.

[0342] Survival after a viral attack

[0343] Administration of the test substance statistically significantly improved animal survival after SARS-CoV-2 challenge (p<0.0001) ( Figure 3 The median survival of unvaccinated animals was 4 days, which was significantly lower than the survival of animals in Group 1 (LD, sc; p = 0.0002, median survival: 6 days), Group 3 (HD, sc; p = 0.0002, median survival: undefined), Group 4 (LD, in; p = 0.0001, median survival: undefined), Group 5 (HD, in; p = 0.0001, median survival: undefined), Group 6 (LD, it; p = 0.0002, median survival: undefined), and Group 7 (HD, it; p = 0.0005, median survival: undefined).

[0344] Antibody response (serum)

[0345] At day 28, circulating IgG titers against the Spike (from the original strain) and RBD (α and β) were detected in all immunized groups; the increase was dose-dependent, with animals receiving the HD Spike showing a stronger immune response ( Figure 4 ). In contrast, anti-Spike and anti-RBD IgA titers were detected only in the groups vaccinated by either the in or it route. In particular, in administration was associated with a significant increase in IgA titers. In contrast to IgG, there was no clear dose-dependency ( Figure 5 ).

[0346] Total immunoglobulin titers against RBD in serum at endpoint were assessed using a bridging ELISA. Antibodies were detected in all vaccinated groups, with the highest titers after in administration. The immune response was dose-dependent ( Figure 6 ).

[0347] Antibody response (BAL)

[0348] IgG titers against spike (from the original strain) and RBD (α and β) were detected to some extent in the BAL of all vaccination groups. However, the highest titers were clearly found in the groups vaccinated by either the in or it route, especially in the HD group (80 μg spike). The strongest IgG responses were against spike and RBD (α) ( Figure 7 ). IgA titers, particularly against the spike (from the original strain) and RBD(α), were detected in animals vaccinated by the in route and to a lesser extent in those vaccinated by the it route. A dose-dependent response was evident, with animals receiving the HD spike showing a stronger immune response at higher doses ( Figure 8 ).

[0349] Neutralizing antibodies

[0350] Varying levels of neutralizing antibody titers were observed in the BAL of vaccinated animals but not in control animals. Among the immunized animals, sc administration was associated with the lowest levels of neutralizing antibodies, with only three animals showing low or partial titers. Intranasal administration was associated with higher neutralizing antibody titers. The response was dose-dependent, with three animals in the LD group showing low titers (1:4 to 1:16) and six animals in the HD group showing moderate to high titers (1:4 to 1:32). Intratracheal administration was also associated with detectable neutralizing antibodies in the BAL fluid. However, this effect was not as pronounced as that seen after in administration. Two animals in the LD group showed low titers (1:4), and five animals in the HD group showed low to moderate titers (1:4 to 1:8).

[0351] Virus titer

[0352] Viral titers were determined by quantitative polymerase chain reaction (qPCR). SARS-CoV-2 virus was detectable in the BAL fluid of all non-immunized control animals (1-2000 copies / mL), indicating successful infection. Low viral titers (C[t] values ​​between 32-35) were detected in three animals that received sc vaccination; these animals also showed low antibody responses. Viral titers were undetectable in animals vaccinated by in or it administration, indicating that they were fully protected from SARS-CoV-2 infection.

[0353] Histopathology

[0354] No macroscopic lesions associated with pathological changes were observed. However, morphological changes were detected in the nasopharynx, lower respiratory tract, and brain.

[0355] All groups, including the non-immunized control group, showed respiratory inflammatory changes such as intraluminal fluid and debris in the nasopharynx, probably due to viral infection. However, inflammatory cell infiltration of the lower respiratory tract was not detected or was detected to a lower extent in non-immunized animals compared with the other groups. In addition, a higher degree of inflammatory cell infiltration was observed in the perivascular to parabronchial and alveolar to interstitial regions in group 1 (LD, sc), and slightly higher infiltration in groups 5 (HD, in) and 7 (HD, it). Only minimal changes were observed in the non-immunized controls.

[0356] In contrast, the highest extent of inflammatory cell infiltration and reduction of arteriolar lumen and bronchiolar fragmentation was observed in animals immunized by sc administration. These changes were observed to a lesser extent in animals immunized by in or it and were not observed in the non-immunized control group. Since inflammation was minimal in the non-immunized control group, the inflammatory changes may be evidence of a vaccine-driven antiviral immune response. Inflammatory changes were also observed in the CNS (i.e., striatum); this may explain the abnormal motor behavior observed in some animals. Piriform cortex neuronal necrosis and perivascular inflammatory cell infiltration were observed in the meninges and parenchyma of animals immunized by sc administration and non-immunized animals. These changes were not observed in groups 4-7, suggesting that it and in administration of the test article prevent CNS infiltration of the virus.

[0357] Summary and Conclusion

[0358] In short, with 1.875x 10 5TCID50i.n. inoculation with SARS-CoV-2 resulted in weight loss and deterioration in health status of animals, which necessitated pre-term euthanasia within four days post infection. This was associated with increased viral titers in the lower respiratory tract. Intranasal and IT administration of trimeric spike (10-80 μg), poly IC (10 μg), and vitamin A (40 μg) had no overall effect on health status.

[0359] Vaccinated animals demonstrated dose-dependent serological responses with systemic and local production of anti-Spike and anti-RBD IgG and IgA antibodies, as well as local production of neutralizing antibodies. This was associated with lack of viral replication in the lungs, suppression of SARS-CoV-2-driven encephalitis, and protection against Covid-19 disease progression.

[0360] In conclusion, this study showed that two in and it administrations of SARS-CoV-2 trimeric spike protein (10-80 μg), polyIC (10 μg), and vitamin A adequately protected against 1.875 x 10 5 TCID50 of SARS CoV 2 infection.

[0361] Example 4-AB21-33, a study to determine the immunogenicity of a novel Covid-19 vaccine in mice

[0362] This study aimed to evaluate the immunogenicity of different antigen variants with polyIC or polyIC:LC as adjuvant in C57BL / 6J wild-type mice. In addition, the results of this study were used to optimize the conditions for subsequent studies and the formulation of clinical candidate vaccines. This study was approved by the Regional Committee for Ethical Experiments on Animals in Stockholm (North), Sweden.

[0363] 48 mice were divided into 8 treatment groups and received different combinations of antigens (20 μg monomeric or trimeric spike protein (original strain from Jiuzhou Jiangcheng), RBD mixture [a mixture of four antigens including the original strain, α, β and γ variants]) and adjuvant (10 μg polyIC or 3-40 μg polyIC:LC) with or without 40 μg vitamin A (Table 3). Animals were immunized by in administration on days 0 and 14.

[0364] Blood samples were collected for serum preparation on days 0 and 14 (before vaccination). On day 28 (i.e., two weeks after the second dose), BAL was performed and endpoint blood samples were collected before animal euthanasia. Spleens were collected for T cell analysis. Animals were monitored for health changes and their body weights were measured on the vaccination day and at the endpoint. Animals that showed severe health deterioration were terminated early.

[0365] Table 2: Treatment Schedule in Study AB21-33

[0366]

[0367] RBD: receptor binding domain.

[0368] Comparison of polyIC and polyIC:LC

[0369] The applicant's first nonclinical study AB21-04 used polyIC as an adjuvant. However, polyIC has not yet been approved for clinical use in humans. Therefore, study AB21-33 evaluated whether polyIC preparations for clinical use, i.e., polyIC:LC, could replace polyIC variants in candidate vaccine formulations.

[0370] Animals in both Group 1 and Group 2 received 20 μg of trimeric SARS-CoV-2 spike and 40 μg of vitamin A. In Group 1, poly-IC was used as an adjuvant, and in Group 2, poly-IC:LC was used as an adjuvant. Comparable serum IgG and IgA levels were detected in Group 1 and Group 2 two weeks after administration of the first and second doses of the test substance (i.e., on days 14 and 28, respectively). In addition, comparable IgG and IgA titers were detected in BAL fluid on day 28. This suggests that the two adjuvants induced comparable systemic and local antibody responses ( Fig. 9 ).

[0371] Therefore, poly IC:LC is considered to be a suitable adjuvant for developing Applicants' clinical vaccine candidate.

[0372] Selection of polyIC:LC dosage

[0373] Study AB21-33 also evaluated different doses of adjuvant polyIC:LC (3 μg, 10 μg and 40 μg, respectively) and administration of the test article without polyIC:LC ( Fig.10 , Fig.11 and Fig.12 Based on the observed dose response, a dose of 10 μg of polyIC:LC per administration was considered appropriate.

[0374] Vitamin A

[0375] Study AB21-33 also evaluated the immunogenicity of vaccination with or without vitamin A. It is hypothesized that the addition of vitamin A would enhance IgA production and generally elicit a stronger immune response. Animals in Group 4 were immunized with 20 μg of monomeric SARS-CoV-2 spike along with 10 μg of poly-IC:LC and 40 μg of vitamin A; animals in Group 8 also received 20 μg of monomeric SARS-CoV-2 spike along with 10 μg of poly-IC:LC, but without vitamin A. Serum IgG and IgA titers were compared two weeks after the first and second administration of the test article (i.e., days 14 and 28, respectively), and IgG and IgA titers in BAL fluid were compared on day 28. The results showed that the addition of vitamin A did not further increase local or systemic IgA titers compared to immunization with spike and poly-IC:LC alone. In addition, the addition of vitamin A did not affect IgG levels ( Fig.13 ). Therefore, vitamin A was omitted in subsequent studies and clinical formulations of vaccine candidates.

[0376] Comparison of monomeric and trimeric SARS-CoV-2 spikes

[0377] The applicant's first nonclinical study (AB21-04) used a trimeric SARS-CoV-2 spike as an antigen. However, the production of a monomeric SARS-CoV-2 spike would facilitate large-scale production. Therefore, the applicant evaluated the immune response after stimulation with a trimeric SARS-CoV-2 spike S1 (Group 2) and a monomeric SARS-CoV-2 spike S1 (Group 4). In addition, the immune response after immunization with a mixture of four SARS-CoV-2RBD2 variants (the original strain as well as α, β and γ variants; Group 3) was analyzed. Serum IgG and IgA were analyzed two weeks after the first and second administration of the test substance (i.e., days 14 and 28, respectively). In addition, IgG and IgA titers were measured in BAL fluid on day 28. The study showed that the immune response induced by immunization with monomeric spike protein was comparable to that immunization with trimeric spike protein. The use of different SARS-CoV-2RBD2 variants as antigens did not further enhance the antibody response ( Fig.14 ). Therefore, the applicant decided to further develop the vaccine candidate using monomeric SARS-CoV-2 Spike S1.

[0378] Summary and Conclusion

[0379] This study evaluated the immunogenicity of the candidate vaccine in C57BL / 6J wild-type mice and provided information to support the following nonclinical study design and clinical candidate vaccine formulation. This study also evaluated the effects of using different antigens and adjuvants and the effect of adding vitamin A (40 μg).

[0380] The study detected antibody responses when using polyIC:LC as an adjuvant that were comparable to polyIC. Furthermore, the addition of vitamin A did not further increase local or systemic IgA titers compared to immunization with spike and polyIC:LC alone. Similarly, the addition of vitamin A did not affect IgG levels.

[0381] Immunization with monomeric SARS-CoV-2 spike elicited an immune response comparable to that with trimeric SARS-CoV-2 spike. Using a SARS-CoV-2 RBD mixture as an antigen did not further enhance the antibody response.

[0382] Based on the results of this study, subsequent studies were conducted using monomeric SARS-CoV-2 spike and the adjuvant polyIC:LC. Vitamin A was omitted from the following studies and clinical formulations of the vaccine candidate.

[0383] Example 5-AB21-31, Second Study to Evaluate the Efficacy of COVID-19 Vaccines Against SARS-CoV-2 Infection in hACE2 Transgenic Mice

[0384] This study aimed to evaluate the efficacy of the candidate vaccine in hACE2 transgenic mice. This study has been approved by the Regional Committee for Ethical Experiments on Animals in Stockholm (North), Sweden.

[0385] Fifty-five female AC70 hACE2 transgenic mice were divided into five groups of 11 mice each. One group served as a control group and received no treatment. The remaining mice received a 50:50 mixture of monomeric SARS-CoV-2 Spike S1α and SARS-CoV-2 Spike S1β at LD (5 μg) or HD (20 μg) on ​​days 0 and 14, along with 10 μg of adjuvant, administered by either the in or it route (Table 4). While the previous study AB21-04 used polyIC as an adjuvant, study AB21-31 and subsequent studies were conducted using polyIC:LC, a polyIC analog that has been developed for use in clinical settings.

[0386] Table 3: Processing schedule in Study AB21-31

[0387]

[0388]

[0389] HD: high dose. LD: low dose. in: intranasal; it: intratracheal.

[0390] On day 28, animals were challenged with SARS-CoV-2 (1.05 x 106 TCID50) by in administration. Blood samples were collected for serum separation before vaccination, on days 14, 28, and at endpoint. At endpoint, animals were euthanized and BAL was performed. Spleens were harvested and splenocytes were isolated for T cell analysis. Lungs (including trachea) and skulls (for brain and nasopharyngeal tissues) were collected for histopathological analysis. Animals were weighed daily and monitored for changes in health status until day 39 (i.e., 11 days post infection [pi]) according to the modified Irwin screen described in detail in study AB21-04.

[0391] Four animals in Group 3 died unexpectedly on day 31, most likely due to failure to properly insert the cage back into the rack. These animals were excluded from the PI analysis.

[0392] Weight and health

[0393] Vaccination itself did not significantly affect the weight of the animals. Animals in all groups generally gained weight after the second vaccination.

[0394] After vaccination with SARS-CoV-2, the weight of unvaccinated animals dropped to 80.88 ± 0.97% of their pre-infection weight by day 32. However, vaccinated animals remained between 86.16% and 95.07% (mean) of their original weight. Vaccination itself did not significantly affect the weight of the animals. Animals in all groups generally gained weight after the second vaccination.

[0395] After SARS-CoV-2 inoculation, the body weight of unvaccinated animals dropped to 80.88 ± 0.97% of their pre-infection body weight by day 32. However, vaccinated animals remained between 86.16% and 95.07% (mean) of their original body weight ( Fig.15 ). On day 32, the relative body weight of the non-immunized control group was significantly lower than that of the immunized group.

[0396] Body weight differences between immunized groups were also evident. A dose-dependent effect was observed, with the HD group showing slower weight loss. By day 32, 63% of animals in group 2 (LD, in) had lost >15% body weight, compared to only 14% of animals in group 3 (HD, in). Similar effects were observed with it administration, with 45% of animals in group 4 (LD, it) losing >15% body weight, compared to only 27% of animals in group 5 (HD, it).

[0397] Administration of the test article did not significantly affect the health status of individual animals, nor did it produce any effects on respiratory function. Vaccination with 1.05x 106TCID50 SARS-CoV-2 was associated with a severe decline in the health status of unvaccinated animals. Unvaccinated animals showed clear signs of deteriorating health status 3 days after infection, with a rapid loss of body weight.

[0398] By day 32 (day 4 post infection), all animals had a hunchback. Ten of the animals also had moderate to severe decreases in mobility, and five animals showed stiffness, asymmetry, and difficulty coordinating movements. One animal also showed hyperexcitability, which may be a sign of viral invasion of the central nervous system. One animal was lying on its side, appearing to be seizing. After a severe decline in health, all unvaccinated animals were euthanized prematurely on day 32. There was a more severe impact on the health of the animals compared to the previous study AB21-04, in which the animals were vaccinated with 1.875x 105TCID50 (passage 3).

[0399] Symptoms associated with SARS-CoV-2 infection were also observed in a subset of vaccinated animals, particularly between days 32 and 34 (4-6 days after infection). In general, the health of vaccinated animals deteriorated more slowly, with an initial phase of hyperexcitement followed by overt signs of illness. 54% of animals in group 2 (LD, in) developed hunchbacks, and some animals also showed stiffness, asymmetry, hyperexcitement, and / or reduced mobility. One animal in this group was found dead on day 33. 42% of animals in group 3 (HD, in) showed particularly severe symptoms, including one animal that showed complete loss of coordination and one animal that was unable to right itself. In group 4 (LD, it), 72% of animals developed adverse symptoms. In two animals, these symptoms were mild and resolved. For the remaining animals in this group (63%), symptoms were severe enough to require early euthanasia. Group 5 (HD, it) had the fewest number of animals (36%) showing SARS-CoV-2-associated symptoms such as hunchback, decreased mobility, rigidity, asymmetry and / or hyperexcitability, leading to premature euthanasia.

[0400] Survival after a viral attack

[0401] Administration of the test substance significantly improved survival after viral challenge (p = 0.0007; Error! Reference source not found). The median survival of unvaccinated animals was 4 days, which was significantly shorter than that of animals in Group 2 (LD, in; median survival: 5 days, p = 0.005), Group 3 (HD, in; median survival: undefined, p = 0.0003), Group 4 (LD, it; median survival: 6 days, p = 0.005) and Group 5 (HD, it; median survival: undefined, p = 0.0001).

[0402] Antibody response (serum)

[0403] By day 14, circulating IgG titers against the spike (from the original strain) were detected in all vaccinated groups and increased after the second vaccination. At the endpoint, no further increase was evident ( Fig.17 ). For all groups, titers were significantly higher than those in unvaccinated control animals. The increase was dose-dependent, with animals in the HD group showing more consistent and higher antibody titers compared to animals in the LD group. A similar pattern was evident for IgG titers against RBD(α) and RBD(β). IgG antibody titers against S1 RBD2δ and S1 RBD2κ were also detectable in sera at day 28, at levels significantly higher than in control animals. A dose-dependent effect was evident; no differences could be seen between routes of administration ( Fig.17 ).

[0404] At day 14, IgA titers against the spike (from the original strain) were evident mainly in group 5 (HD, it); by day 28, they were detectable in all vaccinated groups. At the endpoint, a further increase was evident ( Fig.18 ). Compared with animals in the control group, animals in the HD groups (groups 3 and 5) had significantly increased anti-Spike IgA titers at day 28 and in animals of all groups at the endpoint. In contrast, IgA titers against RBD (α and β) increased significantly only in samples from animals vaccinated in day 28 (groups 2 and 3), but all groups had a significant increase at the endpoint. At day 28, IgA antibody titers against S1RBD2δ and S1 RBD2κ were detectable in the serum. For the δ variant, only the levels in the in group were significantly higher than the control; for the κ variant, a significant increase was evident in the HDi.n. group (group 3) ( Fig.18 ).

[0405] Antibody response (BAL)

[0406] IgG and IgA titers against Spike (from the original strain), RBD(α), and RBD(β) were detected in all vaccinated groups at levels significantly higher than those in control animals. No significant or observable differences were evident between the vaccinated groups ( Fig.19 and Fig. 20 ).

[0407] Neutralizing antibody titer

[0408] No neutralizing antibodies against the Jiuzhou Jiangcheng original strain SARS-CoV-2 spike were detected in the BAL of control animals. In contrast, neutralizing antibodies were detected in a subset of vaccinated animals (titers ranging from <1.4 to 1:8): 3 animals in Group 2, 4 animals in Group 3, and 4 animals in Group 4 and 6 animals in Group 5. A dose-dependent response was evident, and neutralizing antibodies were more frequently detected in animals in the HD group. A statistically significant correlation between neutralization titers and survival was evident (r=0.8811, p<0.0001)

[0409] Neutralizing antibody titers against SARS-CoV-2 β and δ variants were assessed in pooled serum samples collected on day 28. Neutralizing antibodies against the SARS-CoV-2 β variant were detected in all immunized groups, whereas neutralizing antibodies against the δ variant were detected only in the HDi.n. group and in animals immunized by the it route (LD and HD). A dose response was evident, with higher titers in animals in the HD group: neutralizing antibody titers against SARS-CoV-2 β were detected in pooled sera of 1:128 in the HDi.t. and HD.in groups, respectively, compared to 1:32 in the LDi.t. group and 1:32 to 1:64 in the LDi.n. group. In the same analysis, titers detected in immunized animals were similar or higher than those measured in sera from convalescent Covid-19 patients. In contrast, no neutralizing antibodies were detected in control animals.

[0410] T cell response

[0411] The T cell assay failed because the viability of the cells was very low when the experiment was performed. No signal was detected in the fluorescent spot assay.

[0412] Virus titer

[0413] Virus titers in BAL fluid were assessed by qPCR. As expected, virus was detectable in unvaccinated control animals. However, in one control animal, virus was not detected; the reason for this is unclear.

[0414] In vaccinated animals, viral replication was generally low or undetectable. However, in a subgroup of animals in each group, C(t) values ​​similar to those in control animals were measured. The number of animals with low or undetectable viral titers was generally higher in the HD group and in animals vaccinated by the it route. Like neutralizing titers, viral load was significantly correlated with survival (r=0.7696, p<0.0001).

[0415] Histopathology

[0416] Inflammatory changes were observed in the respiratory tract in all groups. Perivascular and peribronchial inflammatory cell infiltration was evident in the lungs. The severity was slightly higher in the vaccinated group; this may be evidence of a vaccine-driven antiviral immune response.

[0417] Summary and Conclusion

[0418] Intranasal inoculation 1.05 x 10 6 TCID50 SARS-CoV-2 caused rapid weight loss and severe deterioration in health status, leading to premature euthanasia within four days of infection. This was associated with increased viral titers in the lower respiratory tract. Intranasal and IT administration of monomeric spike protein (LD: 5μg or HD: 20μg) and polyIC:LC (10μg) had no overall effect on health status.

[0419] Vaccinated animals demonstrated a progressive and dose-dependent serological response with systemic and local production of IgG and IgA antibodies against the spike and RBD, as well as modest local production of neutralizing antibodies. This was associated with reduced viral replication in the lungs and partial protection against Covid-19 disease progression. Histopathology data will also be evaluated in this study but are not yet available.

[0420] In summary, the data from this study indicate that two in and it administrations of 20 μg monomeric spike S1 (a 50:50 mixture of α and β variants) and 10 μg polyIC:LC provided a dose-dependent anti-vaccination effect of 1.05 x 10 6 Protection against severe infection after TCID50 SARS-CoV-2.

[0421] Example 6-AB21-73, Follow-up study to determine the immunogenicity of a novel anti-Covid-19 vaccine in wild-type mice

[0422] Study AB21-73 evaluated the immunogenicity of the antigen (5 μg or 20 μg monomeric SARS-CoV-2 spike S1α) and adjuvant (10 μg polyIC:LC) of the clinical formulation of the Covid-19 vaccine candidate in C56BL / 6J wild-type mice. The study focused primarily on evaluating the potential CD4 + and CD8+ T cell response (T cell immunogenicity). One or two doses of the test substance were administered by in and it routes, respectively. In this study, 60 female C57BL / 6J mice were divided into two cohorts (A and B), with 30 mice in each cohort. Each cohort was subdivided into five treatment groups, with 6 animals in each group (Table 5).

[0423] Table 4: Processing schedule in AB21-73

[0424]

[0425] in: intranasal; it: intratracheal.

[0426] Animals in Group 1 of both cohorts remained naive; all other groups were vaccinated on day 0. Animals in Groups 2-5 of Cohort B received a second dose of the candidate vaccine on day 14. Blood samples were collected for serum separation on days 0 and 17 (Cohort A) or days 0, 14, and 28 (Cohort B). The animals in Cohort A had endpoints on day 17 and those in Cohort B had endpoints on day 28. At endpoint, BAL was performed and spleens were harvested. IgG and IgA titers against Spike RBD2(α) and Spike RBD2(δ) were measured in serum and BAL fluid. CD4 and CD8 T cell responses in splenocytes were determined by fluorescence-activated cell sorting (FACS). Body weight and health status were recorded on the day of vaccination and at endpoint.

[0427] T cell immunogenicity

[0428] Both immunizations (in and it) resulted in strong SARA-CoV-2-specific T cell responses measured by IL-2 and IFNg ELISpot and intracellular IFNg flow cytometric analysis. T cell responses measured by ELISpot were observed after a single immunization, and a stronger response was observed after the second dose. CD4 + and CD8 + T cell IFNg response. CD8 + -T cell response than CD4 + -T cell response was more pronounced. The strongest response was observed in the HDi.n. group; this was the case both after one dose and after two doses ( Fig.21 ).

[0429] Similarly, intracellular flow cytometry staining showed that IFNg + T cells increased significantly. CD4 + and especially CD8+ The increase in T cells was evident ( Fig. 22 ).

[0430] Weight and health

[0431] Administration of the test article was well tolerated, and except for a slight transient decrease in body weight in one group receiving in administration, the animals showed normal weight gain ( Fig.23 ). No significant changes in the animals' overall health or respiratory function were observed after administration of the test substance.

[0432] Antibody response (serum)

[0433] After two immunizations with the HD preparation, high IgG titers against SARS-CoV-2 RBD2α were detected. Administration of the LD test substance triggered an enhanced response only when two doses were administered by the in route. After the first immunization, only very low IgG responses were generally observed. However, two animals in the HDi.n. group developed high antibody levels after the first immunization. Cross-reactivity of IgG antibodies to SARS-CoV-2 Spike RBD2δ (as determined by ELISA measurements) was observed ( Fig.24 ).

[0434] Antibody response (BAL)

[0435] Two weeks after the second dose, intranasal administration of the HD test article also triggered IgG and IgA secretion in the lungs. Cross-reactivity of immunoglobulins was observed because these immunoglobulins targeted SARS-CoV-2 Spike RBDα and SARS-CoV-2 Spike RBDβ. Administration of HD by the it route resulted in weaker responses that were only evident in some animals. After administration of the LD test article, only weak antibody responses were observed, and these responses were only evident in some animals (mainly those immunized by the in route) ( Fig.25 ).

[0436] Fig.26A -J shows ELISA results showing cross-reactivity with spike protein, α, δ, and Omicron.

[0437] in conclusion

[0438] In summary, data from this study demonstrate that two doses of 5 μg or 20 μg SARS-CoV-2 Spike S1α (5-20 μg) and 10 μg poly IC:LC administered together elicited broad humoral and cell-mediated immune responses against the antigenic spike and RBD components of SARS-CoV-2 without adversely affecting animal health.

[0439] The test substance induced CD4 + and CD8+ The strongest and most robust immune response was elicited after administration of in. In addition, immunization induced local and systemic production of IgG antibodies.

[0440] Example 7-AB21-74, Follow-up study to determine the long-term immunogenicity of a novel anti-Covid-19 vaccine in wild-type mice

[0441] The sponsor is currently conducting an additional nonclinical study with the vaccine candidate’s antigen and adjuvant; the study began in September 2021 and is expected to be completed in March 2022.

[0442] Study AB21-74 is designed to evaluate the long-term immunogenicity of 5 μg or 20 μg of monomeric SARS-CoV-2 spike S1α and 10 μg of polyIC:LC in wild-type mice. Two doses of the test article will be administered by in and it routes, respectively. In this study, 40 female C57BL / 6J mice were divided into four treatment groups of 10 animals each (Table 6).

[0443] Table 5: Processing schedule in AB21-74

[0444]

[0445] in: intranasal; it: intratracheal.

[0446] Animals will be vaccinated on days 0 and 14. Blood samples will be collected for serum separation before vaccination, on days 14, 28, 42, and 98, and at the end point (day 182, 24 weeks after the second vaccination). At the end point, BAL will be performed for determination of anti-Spike and anti-RBD IgG and IgA titers; spleens will be harvested for T cell (CD4 and CD8) analysis. Body weight and health status will be recorded every 14 days.

[0447] Safety Pharmacology

[0448] Nonclinical independent studies on safety pharmacology have not been conducted. However, safety pharmacology observations are part of the nonclinical in vivo studies conducted to date. The results of these studies did not show any adverse effects of the candidate vaccine on vital organs or functions.

[0449] Pharmacological Discussion and Conclusions

[0450] The sponsor's non-clinical studies have shown the immunogenicity of different antigens (monomer or trimer SARS-CoV-2 spike S1 of the original strain, SARS-CoV-2 spike S1α or β, and SARS-CoV-2 spike-RBD of the original strain as well as α, β and γ). In these studies, immunogenicity was assessed by ELISA measurements to obtain an indication of the production of local (BAL fluid) and systemic (serum) IgG and IgA levels, as well as the ability of antibodies to neutralize different SARS-CoV-2 strains by virus neutralization assays (VNA). In addition, cellular immunity was assessed after immunization with SARS-CoV-2 spike S1α (i.e., the antigen used in the clinical formulation of the candidate vaccine). The results of these assessments are summarized below.

[0451] ELISA

[0452] The presence of IgG and IgA after immunization was determined using ELISA. Plates were coated with the respective antigens (Spike S1, Spike RBDα, Spike RBDβ, Spike RBD2δ, or Spike RBD2κ of the original strain) and different dilutions of serum or BAL samples were evaluated.

[0453] 1. In the study Error! No reference source found, after immunization with trimeric SARS-CoV-2 Spike S1 (original strain) by the in and it routes, anti-Spike S1 (original strain), anti-RBDα and anti-RBDβ IgG and IgA antibodies were detected in the serum and BAL fluid of vaccinated animals, indicating cross-reactivity. Local and systemic IgG production was dose-dependent, and animals receiving higher doses of Spike showed stronger immune responses. For IgA, local but not systemic reactions were dose-dependent. In the study Error! No reference source found, immunization with monomeric or trimeric Spike S1 (original strain) or with a mixture of RBDs showed similar results.

[0454] 2. Cross-reactivity of IgA and IgG was also observed in study AB21-31. In this study, animals were immunized with monomeric SARS-CoV-2 spike S1 (50:50 α and β) by in and it administration. This resulted in a dose-dependent production of circulating anti-spike S1 (original strain), anti-RBDα, and anti-RBDβ IgG in all vaccinated groups. In addition, anti-spike S1 (original strain), anti-RBDα, and anti-RBDβ IgA and IgG were detected in the BAL fluid of all vaccinated groups. The presence of IgG and IgA antibodies against S1 RBD2δ and S1 RBD2κ in the sera of immunized mice further re-emphasized the cross-reactivity.

[0455] 3. Immunization with SARS-CoV-2 Spike S1α (i.e., the antigen used in the clinical vaccine candidate) in study AB-21-73 induced the production of anti-SARS-CoV-2 Spike RBD2α and δ IgG in serum and BAL fluid. After two doses, both it and in administration induced dose-dependent increases in circulating IgG titers against Spike RBD2α and δ. In the HD group that received the test substance by the it route, a single dose administration only resulted in a significant increase in IgG titers. In addition, two doses of the test substance (in and it) were also associated with locally increased anti-Spike RBD2(α) and anti-Spike RBD2(δ) IgG titers in BAL fluid. The increase in IgG titers in the HD group was significant and was most obvious after in administration (error! No reference source found).

[0456] VNA

[0457] In the VNA assay, VeroE6 cells were plated on 96-well plates at a seeding density of 2x104 cells per well one day before infection. BAL or serum was heat inactivated at 56°C for 30 minutes and then diluted in Dulbecco's modified Eagle's medium supplemented with 2% fetal bovine serum, 100 units / mL penicillin, and 100μg / mL streptomycin. The diluted BAL or serum was then divided into triplicates and placed in 96-well round-bottom plates, mixed with 500 plaque-forming units (PFU) of SARS-CoV-2 per well, and incubated for 1 hour at 37°C / 5% CO2. The medium of the VeroE6 cells was aspirated and replaced with a virus: BAL / serum mixture. Virus only, BAL / serum only, and convalescent patient serum controls were included. After incubation for 3 days at 37°C / 5% CO2, the presence of cytopathic effect (CPE) was examined. Neutralization activity was assigned to wells that showed a complete absence of CPE. Neutralization titers were then calculated as the dilution factor where >50% of the wells showed neutralizing activity.

[0458] 1. In AB21-04, virus neutralization was assessed in BAL fluid after immunization with trimeric SARS-CoV-2 Spike S1 (original strain) by different routes of administration (sc, in and it). After sc administration, only three animals showed the presence of neutralizing antibodies; the titers were low (1:4), and partial neutralization was evident in two animals. Intranasal administration was associated with higher neutralizing antibody titers. The response was dose-dependent, with low titers (1:4 to 1:16) in three animals in the LD group and medium to high titers (1:4 to 1:32) in six animals in the HD group. Intratracheal administration was also associated with detectable neutralizing antibodies. Two animals in the LD group showed low titers (1:4), and five animals in the HD group showed low to medium titers (1:4 to 1:8).

[0459] 2. In addition, study AB-21-31 evaluated neutralizing antibodies against SARS-CoV-2 spikes of the original strain from Jiuzhou Jiangcheng after immunization with monomeric SARS-CoV-2 spike S1 (50:50 α and β) by in and it. Neutralizing antibodies were not detectable in the BAL of control animals, but were present in a subset of vaccinated animals with titers ranging from <1.4 to 1:8. The dose-dependent response was obvious, and neutralizing antibodies were more frequently detected in animals in the HD group. Neutralizing antibody titers were significantly correlated with survival (r=0.8811, p<0.0001). The study also evaluated neutralizing antibody titers against SARS-CoV-2β and δ in pooled serum samples collected on day 28. Neutralizing antibodies against the SARS-CoV-2 β variant were detected in all immunized groups; neutralizing antibodies against the δ variant were detected in the HDi.n. group and animals immunized by the it route (LD and HD), but not in the LDi.n. group. A dose response was evident, with higher titers in animals in the HD group: titers of 1:128 against SARS-CoV-2 β neutralizing antibodies were detected in the pooled sera of the HDi.t. and HD.in groups, respectively, compared with 1:32 in the LD it group and 1:32 to 1:64 in the LD in group. Similarly, higher titers against SARS-CoV-2 δ neutralizing antibodies were detected in the pooled serum samples of the HDi.t. group (1:64) and HDi.n. groups (1:32 to 1:64), respectively, compared with the LD it group (1:16 to 1:32). The titers detected in immunized animals were similar or higher than those measured in the sera of convalescent Covid-19 patients in the same analysis. In contrast, no neutralizing antibodies were detected in control animals. These data provide evidence that immunization with SARS-CoV-2 Spike S1 (50:50 α and β) induces cross-reactive neutralizing antibodies in both BAL and serum.

[0460] T cell immunity

[0461] Study AB21-73 evaluated the T cell immunogenicity of 5 μg (LD) or 20 μg (HD) monomeric SARS-CoV-2 spike S1α (5 μg and 20 μg) and 10 μg polyIC:LC in C56BL / 6J wild-type mice. The study showed that both in and it administration of antigen and adjuvant were associated with SARS-CoV-2-specific CD4 + and CD8 + A significant increase in IFNγ-secreting splenocytes was observed after in, but not it, administration of the test substance. This increase was dose-dependent, and the administration of HD resulted in a more pronounced response ( Figure 3 ). After a single administration of the test substance, the animals in the HDi.n. group showed an increase in IFNγ+ T cells increased significantly. In addition, in administration resulted in a significant and dose-dependent increase in IL-2-secreting splenocytes after two administrations of the test article. Intratracheal administration of the HD test article resulted in a significant increase in IL-2-secreting splenocytes after a single administration. After the second dose, a further increase was evident; however, the increase was not statistically significant ( Fig.28 ).

[0462] In conclusion, this study showed that in vitro and in vitro administration of two doses of 5 μg or 20 μg SARS-CoV-2 spike S1α (5 μg-20 μg) and 10 μg polyIC:LC induced, in addition to humoral immune responses, cell-mediated immune responses against the antigenic spike and RBD components of SARS-CoV-2, with SARS-CoV-2-reactive CD8 + This was particularly evident after in administration of 20 μg of spike S1α and adjuvant polyIC:LC.

[0463] In addition to the immunogenicity data presented above, the ongoing long-term immunogenicity study AB21-74 will also generate long-term data for ISR52 with the spike protein alpha variant as the active substance.

[0464] Summary and Conclusion

[0465] Based on the available immunogenicity data and the cross-reactivity of IgG and IgA antibodies observed in nonclinical studies, immunization with SARS-CoV-2 Spike S1α as the sole antigen is expected to have comparable efficacy to immunization with other Spike mutants. The full-length Spike S1 protein used as the antigen in the ISR52 vaccine is able to generate a broad immune response to different Spike mutants. Covid-19 epidemiology is constantly changing with the emergence of new SARS-CoV-2 variants. These variants may carry mutations in antigenic regions, which poses a challenge to vaccine developers. SARS-CoV-2α variants carry mutations in the RBD of the Spike protein that increase the binding affinity to the ACE2 receptor, which may at least partially explain the higher infectivity of this strain compared to the original Jiangcheng strain (Zahradnik et al., 2021). The spike α protein shares the N501Y mutation in the RBD with the β, γ, and Omicron (B.1.1.529) variants, and shares the D614G mutation with the β, γ, δ, and Omicron (B.1.1.529) variants.

[0466] Example 8 - Clinical Studies

[0467] A multicenter, double-blind, randomized, placebo-controlled, dose-finding FIH study (Phase 1 / 2; C-Vac-052-005) is planned to evaluate the safety, tolerability, and immunogenicity of the ISR52 vaccine with adjuvant poly-IC:LC. The study will be conducted in Bangladesh; a total of 90 healthy subjects aged 18-59 years will be enrolled and randomized (1:1:1) to one of three dose groups (LD: 30μg Spike + 15μg Poly-IC:LC, ID: 60μg Spike + 30μg Poly-IC:LC, HD: 120μg Spike + 60μg Poly-IC:LC). Subjects in each dose group will be assigned to the clinical formulation of the vaccine candidate (ISR52) and placebo in a 2:1 ratio.

[0468] Alternatively, the following would be used:

[0469] Queue 1

[0470] -10 μg Spike and 10 μg PolyIC:LC

[0471] -10 μg Spike and 50 μg PolyIC:LC

[0472] -50 μg Spike and 10 μg PolyIC:LC

[0473] -50 μg Spike and 50 μg PolyIC:LC

[0474] -Control

[0475] Queue 2

[0476] -120 μg Spike and 10 / 50 μg PolyIC:LC

[0477] The starting dose in the Phase 1A FIH study will contain 30 μg of SARS-CoV-2 Spike S1-α protein, and the Phase 1B study will evaluate two additional dose levels:

[0478] Low dose (LD): 30 μg SARS-CoV-2 Spike S1α and 15 μg polyIC:LC

[0479] Intermediate dose (ID): 60 μg SARS-CoV-2 Spike S1α and 30 μg poly IC:LC

[0480] High dose (HD): 120 μg SARS-CoV-2 Spike S1α and 60 μg poly IC:LC

[0481] Two doses of ISR52 or placebo will be administered by the in route on days 0 and 28, respectively. Initially, only subjects assigned to the LD group will receive the study treatment (Phase 1A). The Data Safety Monitoring Board (DSMB) will review the safety data collected from the first six subjects to day 7. If the DSMB does not raise safety issues, 30 more subjects will be recruited. The DSMB will then review the safety data of the remaining 24 subjects in the group to day 7. If there are no safety issues, the ID group will recruit the first six subjects, and the DSMB will review the safety data to day 7. If no problems arise, the remaining subjects in the group will be dosed, and the DSMB will meet with 30 subjects to review the data on the 24 additional subjects. If no safety issues are detected again, the first six subjects in the HD group will be dosed. The DSMB will meet on day 7 after these six subjects are dosed. If there are no safety issues, the remaining subjects will be administered, and the DSMB will meet with 30 subjects, a total of 90 subjects in the study, and draw conclusions on the safety assessment.

[0482] The primary endpoint of this study is to evaluate the frequency of adverse events (AEs) and serious AEs (SAEs) after the first dose of ISR52 vaccine (Day 1 to Day 27) and after the second dose (Day 28 to Day 56). The study will also evaluate the immunogenicity of ISR52 up to 4 weeks after the second dose (Day 56).

Claims

1. A carrier composition in the form of particles for use as a carrier of an antigenic material derived from a respiratory virus or respiratory bacteria, wherein the carrier composition comprises one or more pharmaceutically acceptable excipients and an adjuvant, wherein the one or more pharmaceutically acceptable excipients comprise i) a disaccharide selected from trehalose, sucrose and lactose, ii) a polysaccharide selected from cyclodextrins, and wherein the adjuvant is a TLR agonist.

2. A vector composition for use according to claim 1, used as a carrier of antigenic material derived from a virus.

3. The carrier composition for use according to claim 1 or 2, wherein the disaccharide is trehalose, the polysaccharide is hydroxypropyl-β-cyclodextrin, and the TLR agonist is a TLR3 agonist.

4. A carrier composition for use according to any preceding claim, wherein the concentration of the disaccharide is in the range of 10% to 60% w / w, such as 30% to 55% w / w or 40% to 50% w / w.

5. A carrier composition for use according to any preceding claim wherein the concentration of the polysaccharide is in the range of 10% to 60% w / w, such as 30% to 55% w / w or 40% to 50% w / w.

6. A vector composition for use according to any preceding claim wherein the adjuvant is present in a concentration of 0.1% to 5% w / w.

7. A vaccine composition for preventing infection by pathogenic respiratory viruses or pathogenic respiratory bacteria by administering the composition intranasally or pulmonary to a subject, wherein the composition comprises antigenic material from a pathogenic respiratory virus or pathogenic bacteria, and wherein the composition comprises one or more sugars and a TLR agonist.

8. A composition for use according to claim 7, in the form of particles having an average particle size ranging from 2 to 50 μm.

9. The composition for use according to claim 7 or 8, wherein the one or more sugars are selected from trehalose and cyclodextrin, or mixtures thereof.

10. A composition for use according to any one of claims 7 to 9 comprising hydroxypropyl-β-cyclodextrin.

11. The composition for use according to any one of claims 7 to 10, wherein the TLR agonist is a TLR3 agonist selected from poly IC and poly IC:LC.

12. A composition for use according to any one of claims 7 to 11, wherein the composition comprises a vector composition and an antigenic material derived from a pathogenic respiratory virus or pathogenic respiratory bacteria.

13. A vaccine composition comprising an antigenic material derived from a pathogenic respiratory virus or pathogenic respiratory bacteria and one or more pharmaceutically acceptable excipients, wherein the composition is in the form of particles having an average particle size in the range of 2 to 50 μm, and wherein the composition comprises one or more sugars and a TLR agonist.

14. The composition according to claim 13, wherein the one or more sugars are selected from trehalose and cyclodextrin, or mixtures thereof.

15. The composition according to claim 13 or 14, comprising hydroxypropyl-β-cyclodextrin.

16. The composition for use according to any one of claims 13 to 15, wherein the TLR3 agonist is selected from poly IC and poly IC:LC.

17. The vaccine composition according to any one of claims 13 to 16, comprising one or more pharmaceutically acceptable excipients to ensure fluidity, ensure protein structure, ensure protein stability, avoid cohesion within particles and / or avoid aggregation.

18. The vaccine composition of any one of claims 13-17, wherein the respiratory virus is selected from influenza virus, respiratory syncytial virus, parainfluenza virus, metapneumovirus, rhinovirus, coronavirus, adenovirus and bocavirus.

19. The vaccine composition of any one of claims 13-18, wherein the respiratory virus is a coronavirus.

20. The vaccine composition of any one of claims 13-17, wherein the respiratory bacteria is selected from Streptococcus pneumoniae, Mycoplasma pneumonia, Haemophilus influenza, Chlamydophilia pneumoniae, Chlamydia Psittaci, Moraxella catarrhalis, Mycobacterium tuberculosis, Mycobacterium avis, and Mycobacterium marinum.

21. The vaccine composition of any one of claims 13-20 designed for nasal administration.

22. The vaccine composition according to any one of claims 13-21, wherein the average particle size is in the range of 20 to 50 μm, such as 30 to 40 μm, and the particle size distribution shows that less than 10% of the particles have a particle size of 10 μm or less.

23. The vaccine composition according to any one of claims 13 to 20, which is designed for inhalation.

24. The vaccine composition according to any one of claims 13-20, 23, wherein the average particle size is 10 μm or less, such as at most 8 μm, at most 6 μm, at most 5 μm, or in the range of 1 μm to 5 μm, such as in the range of 3 μm to 5 μm.

25. The vaccine composition according to any one of claims 13 to 24, having suitable flowability when measured according to the method described in 2.9.16 of European Pharmacopoeia 10.0 using a stemless funnel with a diameter of 10 ± 0.01 mm and nozzle 1.

26. A vaccine composition according to any one of claims 13-25, wherein the one or more pharmaceutically acceptable excipients are selected from cellulose, cellulose derivatives, methylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, sugars including monosaccharides, disaccharides, oligosaccharides, polysaccharides, amino acids including peptides, and mixtures thereof.

27. The vaccine composition according to any one of claims 13 to 26, wherein the one or more pharmaceutically acceptable excipients are selected from disaccharides, oligosaccharides, amino acids, peptides and polypeptides.

28. The vaccine composition according to claim 27, wherein the disaccharide is selected from trehalose, sucrose, lactose.

29. The vaccine composition of claim 28, wherein the disaccharide is trehalose.

30. The vaccine composition of claim 27, wherein the oligosaccharide is a cyclodextrin.

31. The vaccine composition of claim 30, wherein the cyclodextrin is β-cyclodextrin, such as hydroxypropyl-β-cyclodextrin.

32. The vaccine composition according to claim 27, wherein the amino acid is selected from leucine or lysine and / or the peptide is selected from trileucine or trilysine, and / or the polypeptide is selected from polyleucine or polylysine.

33. The vaccine composition according to any one of claims 13-32, further comprising an adjuvant.

34. The vaccine composition of any one of claims 13-33, further comprising a TLR agonist.

35. The vaccine composition of claim 35, wherein the TLR agonist is a TLR2 agonist and / or a TLR3 agonist.

36. The vaccine composition of claim 34 or 35, wherein the TLR agonist is a TLR3 agonist.

37. The vaccine composition according to any one of claims 33-36, wherein the TLR agonist is a TLR3 agonist selected from poly-IC and poly-IC:LC.

38. A composition according to any one of claims 13-37, wherein the composition comprises a vector composition according to any one of claims 1-6 and an antigenic material derived from a pathogenic respiratory virus or pathogenic respiratory bacteria.

39. The vaccine composition according to any one of claims 13-38, further comprising vitamin A and / or vitamin D, or in combination with separate compositions of vitamin A and / or D.

Images