Construction method and application of animal model for selectively deleting tissue resident NK cells

Abstract

The invention provides a construction method and application of an animal model for selectively deleting tissue resident NK cells. The Gpx4fl / flCD122Cre mouse provided by the invention selectively lacks liver, uterus and kidney resident NK cells, and the steady state of cNK cells in the tissues and NK cells in peripheral lymphatic organs is not influenced. A practical and available experimental animal model is provided for studying the functions of the NK cells residing in the liver, the uterus and the kidney, and an ideal experimental tool is provided for development of NK biology and even histoimmunology.

Description

Technical Field

[0001] The present invention relates to the field of experimental animals, and in particular to a method for constructing an animal model selectively lacking tissue-resident NK cells and an application thereof. Background Art

[0002] In mice, NK cells are usually phenotypically identified based on the expression of surface markers such as NK1.1, NKp46, or CD49b (DX5), or CD56 and CD16 (FcγRIII) in humans, coupled with the lack of lineage markers CD3 and CD19. Early studies found that NK cells exhibit heterogeneous expression of multiple cell surface molecules, and NK cells from different tissues show unique phenotypic characteristics. However, most previous studies were performed using mouse spleen or human peripheral blood NK cells, which are now called cNK cells. Until recently, trNK cells, which are different from cNK cells in multiple tissues, have received close attention. trNK cells were first identified in the mouse liver and then quickly expanded to various other tissues, such as skin, uterus, salivary glands, fat, and kidney. The heterogeneity between trNK cells and cNK cells in these different tissues needs to be explored.

[0003] In the resting state, a lot of evidence shows that liver NK cells are composed of two completely different subsets, including liver cNK cells and liver-resident NK (LrNK) cells, the latter of which are also often referred to as liver ILC1 cells. Liver cNK cells are usually defined as NK1.1 + NKp46 + CD49a - CD49b + cells, while LrNK / ILC1 cells are usually defined as NK1.1 + NKp46 + CD49a + CD49b - Cells. Liver cNK cells and LrNK / ILC1 cells show significant differences in phenotype, gene expression profile and developmental pathways. In addition, liver cNK cells and LrNK / ILC1 cells also play different roles in liver metastases, chronic persistent liver viral infection and contact hypersensitivity reactions. These functional and phenotypic differences between liver cNK cells and LrNK / ILC1 cells under physiological and pathological conditions have aroused great interest among many scholars. Similar to the liver, uterine NK cells of non-pregnant mice also contain CD49a + and CD49a -Subgroups. The difference is that the population division of uterine NK cells is more diverse. According to the difference in the expression of CD49a and Eomes, uterine NK cells can be divided into three groups, which are: CD49a + Eomes - ILC1 cells, CD49a + Eomes + trNK cells and CD49a - Eomes + cNK cells. It is worth noting that ILC1 cells and trNK cells are NK cells that reside in the uterus, while cNK cells reach the uterus through the blood circulation. Uterine NK cells are the main white blood cells in early human and mouse decidual tissues and make a significant contribution to the basic physiological processes of pregnancy. Studies have shown that IFN-γ secreted by uterine NK cells plays an important role in the remodeling of spiral arteries during pregnancy. In addition, uterine NK cells can also inhibit inflammatory Th17 cells by producing IFN-γ and by interacting with CD14 + The interaction of cells induces the production of Treg cells, thereby maintaining immune tolerance at the maternal-fetal interface and preventing maternal rejection of the fetus. More importantly, uterine NK cells can produce angiogenic factors such as vascular endothelial growth factor (VEGF) and placental growth factor (PLGF), which are also important for normal pregnancy. Although the importance of uterine NK cells during pregnancy is now known, the role of different subsets of uterine NK cells still needs further study. In mouse kidneys, CD49a + CD49b-NK cells, although only a small fraction (15-20%), are easily detected and represent the kidney-resident NK cell population, while CD49a-NK cells, which are present in a larger proportion in the kidney, - CD49b + NK cells are considered cNK cells. In T-bet-deficient mice, the number of kidney-resident NK cells was reduced by about 50% compared with wild-type mice, indicating that kidney-resident NK cells contain T-bet-dependent and -independent populations. More interestingly, the absence of E4BP4 leads to an expansion in the proportion and number of renal trNK cells, while the effect on cNK cells is the opposite. In-depth exploration of the phenotypic and functional differences of different subsets of renal NK cells may provide reliable data references for the advancement and development of renal immunology and pathology. Therefore, finding more and more suitable experimental animal models with selective deficiency of tissue cNK cells or trNK cells has also become a prerequisite for studying the phenotypes and functions of cNK cells or trNK cells in different tissues.

[0004] At present, there are mainly the following experimental animal models used to study tissue NK cells:

[0005] 1. Tbx21 - / - Mice. This experimental animal model not only destroyed the homeostasis of liver cNK cells, but also completely lost LrNK / ILC1 cells to a greater extent. In addition, T-bet - / - Uterine trNK cells and kidney trNK cells are also retained in mice.

[0006] 2. Nfil3 - / - Mice. Although this experimental animal model only destroyed the homeostasis of liver cNK cells in the liver and did not affect the homeostasis of LrNK / ILC1 cells, the loss of E4BP4 led to an increase in the number of kidney trNK cells and a decrease in kidney cNK cells.

[0007] 3. Eomes - / - Mice. Although this animal model does not affect the homeostasis of LrNK / ILC1 cells, some liver cNK cells still remain in the liver. In addition, the loss of Eomes leads to a decrease in both uterine cNK cells and trNK cells.

[0008] 4. γc - / - Mice. This animal model is not specific and affects the homeostasis of all NK cells in the body. It is a tool mouse for NK cell deficiency.

[0009] 5. Rag1 - / - Tbx21 - / - Mice. Although this animal model is a good recipient mouse, the mice lack T, B and LrNK / ILC1 cells, but also lack a lot of liver cNK cells. In addition, the mice also retain uterine trNK cells and kidney trNK cells.

[0010] 6. Rorα fl / fl Ncr1 Cre Mice. Although this animal model specifically destroys the homeostasis of LrNK / ILC1 cells without affecting the homeostasis of liver cNK cells, many LrNK / ILC1 cells still remain in the mouse liver. In addition, the effect of Rorα deficiency on uterine and kidney NK cells remains unclear.

[0011] 7. Zfp683 fl / fl Ncr1 Cre Although this animal model specifically disrupts the homeostasis of LrNK / ILC1 cells without affecting the homeostasis of liver cNK cells, the effect of Hobit deficiency on uterine and kidney NK cells remains unclear.

[0012] Therefore, constructing and utilizing a more appropriate experimental animal model with selective deletion of tissue-resident NK cells is of great significance for revealing the biological functions and phenotypic changes of trNK cells in different tissues under normal physiological conditions and even under pathological conditions. It can also provide practical experimental tools for the development of tissue pathology and tissue immunology. Summary of the invention

[0013] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a method for constructing an animal model that selectively lacks tissue-resident NK cells.

[0014] Another object of the present invention is to provide an application of the above method.

[0015] The purpose of the present invention is achieved through the following technical solutions:

[0016] A method for constructing an animal model with selective lack of tissue-resident NK cells comprises the following steps:

[0017] Gpx4 fl / fl Mice and CD122 Cre Crossbreeding of mice to obtain Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Mice were then screened for the Gpx4 fl / fl CD122 Cre This mouse is an animal model with selective deficiency of tissue-resident NK cells.

[0018] The animal model with selective lack of tissue-resident NK cells is an animal model specifically lacking liver LrNK / ILC1 cells, uterine ILC1 cells, uterine trNK cells and kidney trNK cells.

[0019] In the animal model with selective deficiency of tissue-resident NK cells, the homeostasis of liver cNK cells, other liver immune cells, uterine cNK cells, kidney cNK cells, spleen and bone marrow NK cells is not affected.

[0020] The screening is performed using PCR screening.

[0021] The primers used in the PCR are:

[0022] Gpx4-flox-F:AAAGTCCTAGGAAACGCCCG;

[0023] Gpx4-flox-R:GGCACTAGGTGGAGGAGTCT;

[0024] CD122-Cre-1:CAGAGCAGCTTTGACAACCCAAACG;

[0025] CD122-Cre-2:TGCTTCACAGAAAAACCCACCCCAG;

[0026] CD122-Cre-3: CATACAATGGGGTACCTTCTGGGC.

[0027] The mice are C57BL / 6J mice.

[0028] The application of the animal model with selective deficiency of tissue-resident NK cells in histopathology and histoimmunology research.

[0029] Compared with the prior art, the present invention has the following advantages and effects:

[0030] The present invention aims to provide an experimental animal model with selective lack of tissue-resident NK. Unlike previous animal models, the animal model only specifically lacks liver LrNK / ILC1 cells, uterine ILC1 cells and trNK cells (all NK cells resident in the uterus), and kidney trNK cells, without affecting the homeostasis of liver cNK cells, other liver immune cells, uterine cNK cells, kidney cNK cells, spleen and bone marrow NK cells. Therefore, the present invention provides an ideal model for studying the biological functions of liver LrNK / ILC1 cells, uterine ILC1 cells and trNK cells and kidney trNK cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 For Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Mouse construction strategy and knockout efficiency results.

[0032] Figure 2 For Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre The ratio and number of mouse liver NK cells (A, B), liver cNK cells, and LrNK / ILC1 cells (C, D) are shown in Figure 2.

[0033] Figure 3 For Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 CreThe ratio and number of mouse uterine cNK cells, trNK cells and ILC1 cells (A, B), and the ratio and number of kidney cNK cells and trNK cells (C, D) result diagram.

[0034] Figure 4 For Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Graphs showing the proportion and number of neutrophils (A, B), monocytes (C, D), dendritic cells (E, F), and macrophages (G, H) in mouse liver.

[0035] Figure 5 For Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Mouse liver CD3 + T cells (A, B), CD4 + T cells, CD8 + The proportion and number of T cells (C, D), regulatory T (Treg) cells (E, F) and natural killer T (NKT) cells (G, H).

[0036] Figure 6 For Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre The results of the development of NK cells in the spleen and bone marrow of mice; A and B are the proportion and number of NK cells, and C and D are the subpopulation distribution of NK cells. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0038] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0039] Example 1 Construction of an animal model with selective deletion of tissue-resident NK cells

[0040] 1. Experimental Animals

[0041] CD122 CreThe mice were constructed in our laboratory based on C57BL / 6J according to the methods of public literature (reference literature: He J, Wang Y, Liu T, Liu G, Chen S, Li Q, et al. Stage-specific requirement of kinase PDK1 for NK cells development and activation. Cell Death Differ. 2019; 26: 1918-28). The CD122 molecule is the β subunit of the IL-15 and IL-2 receptors and begins to be expressed in the NK cell progenitor (NKp) cell stage during NK cell development. When this mouse is crossed with a mouse containing a Loxp site sequence, the offspring will specifically delete the target gene in cells expressing the CD122 molecule under the action of Cre recombinase. Gpx4 fl / fl Mice were purchased from Guangdong Nanmo Biotechnology Co., Ltd. (Cat. No.: NM-CKO-200097). After hybridization of these mice with mice expressing Cre recombinase, the offspring will specifically lack the Gpx4 gene in tissues that specifically express Cre recombinase. After introduction, the two types of mice were raised in a specific pathogen-free environment (SPF grade) at the Experimental Animal Center of Jinan University.

[0042] 2. Construction method

[0043] Use Gpx4 over 8 weeks of age fl / fl Mice and CD122 over 8 weeks of age Cre Mice mating to obtain Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Mouse ( Figure 1 A). The offspring mice were tail-cut and DNA was extracted for genotyping around 20 days after birth to distinguish the two genotypes of mice. The primer sequences used for genotyping are as follows:

[0044] Gpx4-flox-F:AAAGTCCTAGGAAACGCCCG;

[0045] Gpx4-flox-R:GGCACTAGGTGGAGGAGTCT;

[0046] CD122-Cre-1:CAGAGCAGCTTTGACAACCCAAACG;

[0047] CD122-Cre-2:TGCTTCACAGAAAAACCCACCCCAG;

[0048] CD122-Cre-3: CATACAATGGGGTACCTTCTGGGC.

[0049] Meanwhile, qPCR was used to verify Gpx4 fl / fl CD122 Cre The knockout efficiency of mice ( Figure 1 B) Adult Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre After the mice were sacrificed, NK cells from the spleen, bone marrow, and liver of the mice were sorted, RNA was extracted and prepared into cDNA, and Gpx4 was detected by qPCR. fl / fl CD122 Cre The efficiency of knocking out the Gpx4 gene in mouse spleen, bone marrow and liver NK cells. The primer sequence information used for qPCR is as follows:

[0050] Gpx4-F:GTCTGCCTGGATAAGTACAG;

[0051] Gpx4-R:AGGATTCGTAAACCACACTC;

[0052] Gapdh-F:CCAGCTTAGGTTCATCAGGT;

[0053] Gapdh-R:TTGATGGCAACAATCTCCAC.

[0054] Offspring mice of the same sex, age, and day born in the same cage were used for subsequent flow cytometry testing, and the genetic background of all mice was C57BL / 6J.

[0055] Example 2

[0056] 1. Prepare samples

[0057] Take the Gpx4 obtained in Example 1 fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre When mice were 6 to 8 weeks old, they were sacrificed and their spleen, bone marrow, liver, kidney and uterus were removed and prepared into single cell suspensions. After incubation with flow cytometry antibodies, the suspensions were detected on a flow cytometer. At least 4 samples were measured in each group and the experiment was repeated twice.

[0058] 2. Flow cytometry to detect the proportion and number of liver NK cells

[0059] Flow cytometry detection and statistics of Gpx4fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre Mouse liver total NK cells ( Figure 2 A, B), the proportion and number of cNK cells and LrNK / ILC1 cells in the liver ( Figure 2 C, D). The results showed that the loss of Gpx4 in NK cells led to a significant decrease in the proportion and number of LrNK / ILC1 cells in mouse liver, while the number of cNK cells in the liver remained unchanged.

[0060] 3. Flow cytometry to detect the proportion and number of uterine and kidney NK cells

[0061] Flow cytometry detection and statistics of Gpx4 fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre The proportion and number of cNK cells, trNK cells and ILC1 cells in mouse uterus ( Figure 3 A, B), the ratio and number of cNK cells and trNK cells in the kidney ( Figure 3 C, D). The results showed that the loss of Gpx4 in NK cells led to a significant decrease in the proportion and number of trNK cells and ILC1 cells in the mouse uterus, while the number of cNK cells in the uterus remained unchanged. At the same time, the loss of Gpx4 in NK cells led to a significant decrease in the proportion and number of trNK cells in the mouse kidneys, while the number of cNK cells in the kidneys remained unchanged.

[0062] 4. Flow cytometry to detect the proportion and number of other immune cells in the liver

[0063] Flow cytometry detection and statistics of Gpx4 fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre Mouse liver neutrophils ( Figure 4 A, B), monocytes ( Figure 4 C, D), dendritic cells ( Figure 4 E, F), macrophages ( Figure 4 The results showed that the loss of Gpx4 in NK cells did not affect the proportion and number of neutrophils, monocytes, dendritic cells, and macrophages in the liver.

[0064] 5. Flow cytometry to detect the proportion and number of various types of T cells in the liver

[0065] Flow cytometry detection and statistics of Gpx4 fl / + CD122 Cre Mice and Gpx4 fl / flCD122 Cre Mouse CD3 + T cells ( Figure 5 A, B), CD4 + T cells ( Figure 5 C, D), CD8 + T cells ( Figure 5 C, D), Treg cells ( Figure 5 E, F) and NKT cells ( Figure 5 The results showed that the loss of Gpx4 in NK cells did not affect the expression of CD3 + T cells, CD4 + T cells, CD8 + The proportion and number of T cells, Treg cells and NKT cells.

[0066] 6. Flow cytometry to detect the development of NK cells in spleen and bone marrow

[0067] Flow cytometry detection and statistics of Gpx4 fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre The proportion and number of NK cells in the spleen and bone marrow of mice ( Figure 6 A, B), Gpx4 fl / + CD122 Cre Mice and Gpx4 fl / fl CD122 Cre Distribution of NK cell subsets in mouse spleen and bone marrow ( Figure 6 C, D). The results showed that the loss of Gpx4 in NK cells did not affect the proportion, number and subset distribution of NK cells in the spleen and bone marrow of mice.

[0068] The experimental results show that Gpx4 fl / fl CD122 Cre The mouse is an ideal experimental animal model for selectively depleting tissue-resident NK cells. fl / fl CD122 Cre The mice specifically lacked liver LrNK / ILC1 cells, uterine ILC1 cells and trNK cells (both NK cells resident in the uterus), and kidney trNK cells, without affecting the homeostasis of liver cNK cells, other liver immune cells, uterine cNK cells, kidney cNK cells, spleen, and bone marrow NK cells. fl / fl CD122 Cre In the future, mice are likely to become an ideal experimental animal model for studying the function of NK cells resident in the liver, uterus, and even kidney. The present invention aims to provide a powerful experimental tool and theoretical basis for the advancement of NK cell biology and tissue immunology.

[0069] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for constructing an animal model with selective lack of tissue-resident NK cells, characterized in that The steps include: Gpx4 fl / fl Mice and CD122 Cre Crossbreeding of mice to obtain Gpx4 fl / fl CD122 Cre Mice and Gpx4 fl / + CD122 Cre Mice were then screened for the Gpx4 fl / fl CD122 Cre This mouse is an animal model with selective deficiency of tissue-resident NK cells.

2. The construction method according to claim 1, characterized in that: The animal model with selective lack of tissue-resident NK cells is an animal model specifically lacking liver LrNK / ILC1 cells, uterine ILC1 cells, uterine trNK cells and kidney trNK cells.

3. The construction method according to claim 1, characterized in that: In the animal model with selective deficiency of tissue-resident NK cells, the homeostasis of liver cNK cells, other liver immune cells, uterine cNK cells, kidney cNK cells, spleen and bone marrow NK cells is not affected.

4. The construction method according to claim 1, characterized in that: The screening is performed using PCR screening.

5. The construction method according to claim 4, characterized in that: The primers used in the PCR are: Gpx4-flox-F:AAAGTCCTAGGAAACGCCCG; Gpx4-flox-R:GGCACTAGGTGGAGGAGTCT; CD122-Cre-1:CAGAGCAGCTTTGACAACCCAAACG; CD122-Cre-2:TGCTTCACAGAAAAACCCACCCCAG; CD122-Cre-3: CATACAATGGGGTACCTTCTGGGC.

6. The construction method according to claim 1, characterized in that: The mice are C57BL / 6J mice.

7. Use of the animal model with selective lack of tissue-resident NK cells according to any one of claims 1 to 6 in histopathology and histoimmunology research.

Images