Application of circAGO3 related reagent in regulation and control of growth and development of chicken skeletal muscle

Abstract

The invention relates to the technical field of poultry breeding, and particularly provides application of circAGO3 related reagents in regulation and control of growth and development of chicken skeletal muscles. The research finds that circAGO3 is highly expressed in chicken muscle tissues, and the pectoral muscle rate is inversely proportional to the expression quantity of circAGO3. In vivo chicken pectoral muscle lentivirus injection circAGO3, pectoral muscle growth and development can be inhibited; in in-vitro chicken skeletal muscle satellite cells, circAGO3 can inhibit cell differentiation and promote inflammatory response and myotubular atrophy of the in-vitro chicken skeletal muscle satellite cells. The circAGO3 can mediate an NF-kappa B signal channel through a miR-34b-5p axis and inhibit the growth and development of chicken breast muscle and skeletal muscle satellite cells. The excavation of the circAGO3 can provide a potential target and a new research direction for subsequent molecular breeding of chickens.

Description

Technical Field

[0001] The present invention relates to the technical field of poultry breeding, and in particular to the application of circAGO3-related reagents in regulating the growth and development of chicken skeletal muscle. Background Art

[0002] In meat animals, the most important edible part is skeletal muscle, and its quality and quantity characteristics will affect the economic value. Myofibers are the core elements of muscle, and their number is basically determined during the animal embryonic period, while muscle development after birth mostly depends on the proliferation and hypertrophy of muscle fibers. And skeletal muscle progenitor cells will determine the depth of development of muscle fibers, that is, the proliferation and differentiation of satellite cells. The development of animal embryonic muscles and the regeneration of muscles after birth are both complex biological processes, which are regulated by epigenetics, specific genes, signaling pathways, transcription factors, etc. Circular RNA (circRNA), as an emerging type of endogenous non-coding RNA, is not easily degraded by exonucleases due to its special closed ring structure. It has higher stability than linear RNA and can more effectively play an expression regulation role.

[0003] There are many studies that have shown the biological functions of circular RNA (circRNA) in medical diseases and muscle growth, namely, sponging miRNA, regulating the expression level of mRNA, regulating protein expression, etc. Although researchers have made some progress in these areas, the study of circRNA is still in the exploratory stage and there are few reports. There are still many new biological functions to be explored. Therefore, it is crucial to further study the effects of circRNA on the development and atrophy of skeletal muscle. Summary of the invention

[0004] The purpose of the present invention is to further explore the new biological functions of circAGO3, and then provide the application of circAGO3-related reagents in regulating the growth and development of chicken skeletal muscle.

[0005] In order to achieve the above object, the technical solution of the present invention is: In a first aspect, the present invention provides the use of an agent for reducing or inhibiting the expression of the circAGO3 gene in the preparation of a product for promoting the growth and development of chicken skeletal muscle, wherein the agent has a sequence as shown in SEQ ID NO.11.

[0006] The product includes, but is not limited to, a reagent, a composition or a medicine.

[0007] Preferably, the full-length nucleotide sequence of the circAGO3 gene is as shown in SEQ ID NO.47, and the target miRNA of the circAGO3 gene is miR-34b-5p.

[0008] In a second aspect, the present invention provides the use of an agent for enhancing or promoting the expression of miR-34b-5p or an agent for reducing the adsorption of miR-34b-5p in the preparation of an agent, composition or medicine for promoting the growth and development of chicken skeletal muscle.

[0009] Preferably, the reagent has the sequence shown in SEQ ID NO.11.

[0010] The product includes, but is not limited to, a reagent, a composition or a medicine.

[0011] In a third aspect, the present invention provides a method for promoting the growth and development of chicken skeletal muscle, comprising: transfecting a sequence as shown in SEQ ID NO. 11 into chicken skeletal muscle satellite cells.

[0012] Compared with the prior art, the present invention has the following beneficial effects: This study used in vitro cultured skeletal muscle satellite cells and pectoral muscles as experimental subjects to explore the effects of circAGO3 on the growth and development of chicken skeletal muscle. The establishment of a ceRNA network helps reveal the molecular mechanism of circAGO3 in regulating the growth and development of chicken skeletal muscle. This research result provides a theoretical basis for further exploring the important role of circAGO3 in the growth and development of chicken skeletal muscle, and provides important theoretical reference value for improving the growth performance of chickens through molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings: Figure 1 Figures 1 to 3 are the relative tissue expression levels of circAGO3 at different stages in Example 1 of the present invention, wherein Figures A to C are the relative tissue expression levels of circAGO3 at E13, D4 and D300. ac P < 0.05 indicates a significant difference.

[0014] Figure 2 Figure 1 is the relationship between the breast muscle rate and the expression level of circAGO3 in chickens at different stages in Example 1 of the present invention, wherein Figure A is the breast muscle rate at E10-E20; Figure B is the expression level of circAGO3 at E10-E20; Figure C is the breast muscle rate at D1, D7, D15, D30, D60, D90, D150, D360, D720, and D900; Figure D is the expression level of circAGO3 at D1, D7, D15, D30, D60, D90, D150, D360, D720, and D900.

[0015] Figure 3The overexpression and interference efficiency of cricAGO3 in Example 1 of the present invention, wherein Figure A is the overexpression efficiency of circAGO3 in chicken skeletal muscle satellite cells; Figure B is the interference efficiency of circAGO3 in chicken skeletal muscle satellite cells. **P<0.01 indicates that the difference is extremely significant.

[0016] Figure 4 The pectoral muscle development of chicks regulated by circAGO3 in Example 1 of the present invention, wherein Figure A is the overexpression efficiency after LV-ov-circAGO3 mediation; Figure B is the change in the weight of chicks after LV-ov-circAGO3 mediation; Figure C is the change in the pectoral muscle weight of chicks after LV-ov-circAGO3 mediation; Figure D is the change in the pectoral muscle rate of chicks after LV-ov-circAGO3 mediation. **P<0.01 indicates a very significant difference.

[0017] Figure 5 The effect of circAGO3 on the expression of related genes and proteins in the pectoral muscle of chicks in Example 1 of the present invention, wherein Figure A shows the changes in the expression of myogenic differentiation-related genes mediated by LV-ov-circAGO3; Figure B shows the changes in the expression of muscle atrophy-related genes mediated by LV-ov-circAGO3; Figure C shows the expression of MyHC and MyoD proteins and the calculation of grayscale values ​​after LV-ov-circAGO3; Figure D shows the expression of TRIM63 protein and the calculation of grayscale values ​​after LV-ov-circAGO3. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0018] Figure 6 The circAGO3 in Example 1 of the present invention regulates the development of muscle fibers in chicks, wherein Figure A is a comparison of the pectoral muscles of chicks mediated by LV-ov-circAGO3; Figure B is a comparison of the cross-sectional area of ​​the pectoral muscles of chicks mediated by LV-ov-circAGO3; Figure C is the effect of LV-ov-circAGO3 on the cross-sectional area of ​​the pectoral muscles of chicks. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0019] Figure 7 This is the RNA sequencing analysis after overexpression of circAGO3 in chicken skeletal muscle satellite cells in Example 1 of the present invention, wherein A~B are volcano plots of up-regulated or down-regulated genes after transcriptome analysis; C is transcriptome analysis of genes related to skeletal muscle development; D is a GO enrichment bar chart analysis of differentially expressed genes. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0020] Figure 8The functional enrichment results of circAGO3-regulated genes in Example 1 of the present invention are shown in Figure A, where Figure A is the pathway related to KEGG enrichment analysis; Figure B is the inflammation-related genes after transcriptome analysis; and Figure C is the genes related to the NF-κB signaling pathway after transcriptome analysis. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0021] Fig. 9 The effect of overexpression of circAGO3 on the differentiation of chicken skeletal muscle satellite cells in Example 2 of the present invention, wherein Figure A shows the mRNA expression of myogenic differentiation-related genes after circAGO3 overexpression; Figure B shows the effect of circAGO3 overexpression on myogenic differentiation-related proteins; Figure C shows the immunofluorescence analysis of MyHC after circAGO3 overexpression (100 times); Figure D shows the relative myotube area of ​​skeletal muscle satellite cells after circAGO3 overexpression. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0022] Fig.10 The effect of overexpression of circAGO3 on cellular inflammatory response in Example 2 of the present invention, wherein Figure A shows the mRNA expression of inflammatory response-related genes after circAGO3 overexpression; Figure B shows the concentration of IL-1β, TNF-α, CCL4 and CCL19 detected by ELISA after circAGO3 overexpression. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0023] Fig.11 The effect of circAGO3 overexpression on myotube atrophy in Example 2 of the present invention, wherein Figure A shows the mRNA expression of muscle atrophy-related genes after circAGO3 overexpression; Figure B shows the expression and grayscale statistics of TRIM63 protein after circAGO3 overexpression; Figure C shows the immunofluorescence analysis of MyHC after circAGO3 overexpression (100 times); Figure D shows the relative myotube diameter of SMSCs after circAGO3 overexpression. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0024] Fig.12This is the verification of the target relationship between circAGO3 and miR-34b-5p in Example 2 of the present invention, wherein Figure A shows the expression level of miR-34b-5p overexpressed after circAGO3 in chicken skeletal muscle satellite cells; Figure B shows the binding site of circAGO3 and miR-34b-5p; Figure C shows the construction of circAGO3 wild-type and mutant plasmids; Figure D shows the effect of co-transfection of circAGO3-WT / MT and miR-34b-5p mimic / mimic NC with dual luciferase reporter genes. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0025] Fig.13 ] are the overexpression efficiency and interference efficiency of miR-34b-5p in Example 3 of the present invention, **P<0.01 indicates that the difference is extremely significant.

[0026] Fig.14 The effect of miR-34b-5p on the mRNA and protein of myogenic differentiation of chicken skeletal muscle satellite cells in Example 3 of the present invention, wherein, Figure A shows the mRNA expression of myogenic differentiation-related genes after overexpression of miR-34b-5p; Figure B shows the mRNA expression of myogenic differentiation-related genes after interference with miR-34b-5p; Figure C shows the effect of miR-34b-5p overexpression on myogenic differentiation-related proteins; Figure D shows the effect of miR-34b-5p interference on myogenic differentiation-related proteins. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0027] Fig.15 The effect of miR-34b-5p on the differentiation of chicken skeletal muscle satellite cells in Example 3 of the present invention, wherein Figure A is the immunofluorescence analysis of MyHC after miR-34b-5p overexpression (100 times); Figure B is the relative myotube area of ​​chicken skeletal muscle satellite cells after miR-34b-5p overexpression; Figure C is the immunofluorescence analysis of MyHC after miR-34b-5p interference (100 times); Figure D is the relative myotube area of ​​chicken skeletal muscle satellite cells after miR-34b-5p interference. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0028] Fig.16The effect of miR-34b-5p on the inflammatory response of chicken skeletal muscle satellite cells in Example 3 of the present invention, wherein Figure A shows the mRNA expression of inflammatory response-related genes after miR-34b-5p overexpression; Figure B shows the mRNA expression of inflammatory response-related genes after miR-34b-5p interference; Figure C shows the effect of ELISA on the concentration of IL-1β, TNF-α, CCL4 and CCL19 after miR-34b-5p overexpression; Figure D shows the effect of ELISA on the concentration of IL-1β, TNF-α, CCL4 and CCL19 after interfering with miR-34b-5p. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0029] Fig.17 The effect of miR-34b-5p on muscle atrophy-related mRNA and protein in Example 3 of the present invention, wherein Figure A shows the mRNA expression of muscle atrophy-related genes after miR-34b-5p overexpression; Figure B shows the mRNA expression of muscle atrophy-related genes after miR-34b-5p interference; Figure C shows the effect of miR-34b-5p overexpression on muscle atrophy-related proteins; Figure D shows the effect of miR-34b-5p interference on muscle atrophy-related proteins. **P<0.01 indicates an extremely significant difference.

[0030] Fig.18 The effect of miR-34b-5p on myotube diameter in Example 3 of the present invention, wherein Figure A is the immunofluorescence analysis of MyHC after miR-34b-5p overexpression (100 times); Figure B is the relative myotube diameter after miR-34b-5p overexpression; Figure C is the immunofluorescence analysis of MyHC after miR-34b-5p interference (100 times); Figure D is the relative myotube diameter after miR-34b-5p interference. **P < 0.01 indicates a very significant difference.

[0031] Fig.19 This is a validation of the target relationship between miR-34b-5p and TRAF3 in Example 3 of the present invention, wherein Figure A shows the relative mRNA expression of TRAF3 after LV-ov-circAGO3 in vivo; Figure B shows the relative mRNA expression of TRAF3 after miR-34b-5p interference; Figure C shows the 3'UTR sequence of TRAF3 and the splicing site of TRAF3 WT / MT and miR-34b-5p; Figure D shows the change in luciferase activity after co-transfection of TRAF3-WT / MT and miR-34b-5p mimic / mimic NC. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0032] Fig. 20is the interference efficiency of TRAF3 in Example 4 of the present invention, wherein **P<0.01 indicates an extremely significant difference.

[0033] Fig.21 The effect of interfering with TRAF3 on the differentiation of chicken skeletal muscle satellite cells in Example 4 of the present invention, wherein Figure A shows the mRNA expression of myogenic differentiation-related genes after TRAF3 interference; Figure B shows the effect of TRAF3 interference on myogenic differentiation-related proteins; Figure C shows the immunofluorescence analysis of MyHC after TRAF3 interference (100 times); Figure D shows the relative myotube area of ​​chicken skeletal muscle satellite cells after TRAF3 interference. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0034] Fig. 22 The effect of interfering with TRAF3 on the inflammatory response of chicken skeletal muscle satellite cells in Example 4 of the present invention, wherein Figure A shows the expression of mRNA of inflammatory response-related genes after TRAF3 interference; Figure B shows the changes in the concentrations of IL-1β, TNF-α, CCL4 and CCL19 after TRAF3 interference detected by ELISA. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0035] Fig.23 The effect of interfering with TRAF3 on myotube atrophy in Example 4 of the present invention, wherein Figure A shows the mRNA expression of muscle atrophy-related genes after TRAF3 interference; Figure B shows the effect of TRAF3 interference on TRIM63 protein abundance expression; Figure C shows the immunofluorescence analysis of MyHC after TRAF3 interference (100 times); Figure D shows the relative myotube diameter after TRAF3 interference. **P<0.01 indicates extremely significant difference.

[0036] Fig.24 This is the Western Blot analysis of TRAF3 regulating the NF-κB signaling pathway in Example 5 of the present invention, wherein Figures A to C are the protein expression and gray value calculation of TRAF3, TAK1, IκBα, p-IκBα and NFκB1 after si-TRAF3 treatment. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0037] Fig.25Western Blot analysis of circAGO3 regulating the NF-κB signaling pathway through the circAGO3 / TRAF3 axis in Example 5 of the present invention, wherein Figures A to C are the protein expression and gray value calculation of TRAF3, TAK1, IκBα, p-IκBα and NFκB1 after co-transfection of ov-NC and si-NC and co-transfection of ov-circAGO3 and si-NC / si-TRAF3. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0038] Fig.26 The RT-qPCR and Western Blot analysis of circAGO3 regulating the NF-κB signaling pathway through the circAGO3 / miR-34b-5p axis in Example 5 of the present invention, wherein Figure A shows the mRNA level of TRAF3 after co-transfection of ov-NC and mimic NC and co-transfection of ov-NC / circAGO3 and miR-34b-5p mimic; Figures B to D show the protein expression and gray value calculation of TRAF3, TAK1, IκBα, p-IκBα and NFκB1 after co-transfection of ov-NC and mimic NC and co-transfection of ov-NC / circAGO3 and miR-34b-5p mimic. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0039] Fig. 27 This is the Western Blot analysis of the regulation of NF-κB signaling pathway by overexpression of circAGO3 in vivo in Example 5 of the present invention, wherein Figures A to C are the protein expression and gray value calculation of TRAF3, TAK1, IκBα, p-IκBα and NFκB1 mediated by LV-ov-circAGO3 in vivo. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference. DETAILED DESCRIPTION

[0040] In the description of the present invention, it should be noted that, if the specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0041] In the following examples, the experimental animals used were: ROSS 308 broilers (from the Poultry Breeding Experimental Field of Sichuan Agricultural University, Ya'an City, Sichuan Province) as the experimental subjects, 136 (17 times, 8 / time) 4-day-old broilers in good health, similar weight, and consistent feeding and management were selected for the isolation and in vitro culture of skeletal muscle satellite cells, and 12 (2 groups, 6 / group) 1-day-old broilers were selected for in vivo lentivirus injection. The feeding method was free feeding, and strict feeding management and immune health care procedures were implemented throughout the process. The chicks were anesthetized by intravenous injection of 30 mg / kg sodium pentobarbital reagent and killed, and then their tissue samples were collected.

[0042] In the following examples, the test reagents mainly include: fetal bovine serum (FBS, Gibco, USA, item number 10099-141), basic culture medium DMEM / F12 (Gibco, USA, item number 11320033), penicillin-streptomycin double antibody solution (Gibco, USA, item number 15140-122), 0.25% trypsin digestion solution (Gibco, USA, item number 25200-056), type I collagenase (BioFroxx, Germany, item number 1904MG100), etc. At the same time, the experiment also involves a total RNA extraction reagent (Takara, Japan, item number 9108Q) for extracting RNA from tissues and cells. For subsequent gene expression analysis, an mRNA reverse transcription kit (Takara, Japan, item number RR047A) and a miRNA reverse transcription reagent (Xinhai Gene Biology, China, item number D1801) are available to convert RNA into cDNA. Real-time fluorescence quantitative reagent (Takara, Japan, catalog number RR420A) was used to quantitatively detect gene expression levels. To detect gene functional activity, a dual-luciferase reporter gene detection kit (FuNeng Gene Biology, China, catalog number LF001) was used. Gel electrophoresis analysis used a rapid gel preparation kit (YaZyme Biotechnology, China, catalog number PG212) for gel preparation and protein band separation.

[0043] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] The embodiment of the present invention provides a circular RNA circAGO3 and its application in regulating the growth and development of chicken skeletal muscle or pectoral muscle. The specific experimental method includes: 1. Tissue collection: Dissect 3 broilers at embryonic day 13, 4 days after birth, and 300 days after birth (E13, D4, D300), and collect appropriate tissue samples (such as brain, breast muscle, leg muscle, heart, liver, spleen, lung, kidney, stomach, fat) from each broiler. After washing with PBS, put them into 1.5 mL centrifuge tubes, and then store them in a liquid nitrogen tank for a short period of time, and then transfer them to a -80℃ refrigerator for long-term storage, in preparation for RNA extraction and expression profile analysis later. During the embryonic period E10-E20 and postnatal D1, D7, D15, D30, D60, D90, D150, D360, D720, and D900, 3 broilers were randomly selected in each period for weighing and breast muscle tissue collection. In addition, after in vivo injection of lentivirus, breast muscle of the experimental chicken was collected for tissue sectioning and muscle fiber comparison and analysis (storage conditions: 4% formaldehyde).

[0045] 2. Cell culture and treatment (1) Collection and culture of skeletal muscle satellite cells After 4-day-old broilers were anesthetized to death, an appropriate amount of breast muscle tissue was cut. Then it was resuspended in type I collagenase (3 times the volume) and digested in a water bath (37°C, the same below) for 1 hour. After centrifugation (1000 r / min 10 min), the upper impurities were removed and only the cell pellet in the lower layer was kept. It was then resuspended in 0.25% trypsin (3 times the volume) and placed in a water bath for 20 minutes of digestion. To end the trypsin digestion process, an equal volume of complete culture medium must be added, and then filtered in sequence through 70 μm and 40 μm cell sieves. Subsequently, only the cell pellet in the lower layer was retained and resuspended in complete culture medium. After being blown evenly with a Pasteur pipette, it was added to a 25 cm 3 Place the cells in a cell culture flask and place it in a constant temperature incubator. After 3 hours, the culture dish needs to be replaced and the operation is repeated twice to remove impurity cells. After completing the purification and counting of satellite cells, they are inoculated onto the required cell culture plates and replaced with complete culture medium after 24 hours. When the cell density reaches 70-80%, it needs to be replaced with differentiation medium to promote further differentiation of satellite cells.

[0046] (2) Cultivation of chicken embryonic fibroblast cell line DF-1 DF-1 was taken out of liquid nitrogen, packaged and thawed in a water bath. A small amount of complete medium was injected into the cell tube, evenly blown and transferred to a 15 mL centrifuge tube, and centrifuged (1000 r / min, 10 min, the same below). When the cells grew to about 70% confluency, they were transferred to a 48-well cell culture plate for culture in preparation for subsequent transfection operations. When the cell density in the culture flask reached about 80%, the culture medium was removed and washed once with PBS. Next, 5 mL of pre-prepared trypsin was added to each culture flask and placed in a constant temperature incubator for digestion for 2 min. After that, an equal volume of complete medium was added to terminate the digestion, and the adherent cells were completely detached by gently blowing. The digested cells were collected into a centrifuge tube, centrifuged, and the supernatant was removed. Serum-free cell freezing solution was added, gently blown and divided into two cryopreservation tubes (1.2~1.5 mL per tube). After recording relevant information, seal the cryovials and perform gradient cooling at 4°C, -20°C, and -80°C (20 min, 30 min, and 16-18 h, respectively). Finally, place the cells in liquid nitrogen for long-term storage.

[0047] (3) Cell transfection To ensure the transfection effect, the cell density needs to be about 80%. And 1~2 h before transfection, the medium without double antibodies should be replaced to ensure the purity of the transfection environment; similarly, 8~10 h after transfection, the medium without double antibodies needs to be replaced to maintain the stable growth environment of the cells. The cultured cells are inoculated on 6-well, 12-well, 24-well and 96-well plates. When the cell density reaches an appropriate fusion state, the transfection operation can be performed. In this process, Lipofectamine®3000 reagent is first diluted in Opti-MEM® medium, and then siRNA, miRNA inhibitor / mimic agent and plasmid vector are diluted with an equal amount of Opti-MEM® medium. In particular, for plasmid vectors, P3000 reagent needs to be added to assist the transfection process. After that, the DNA premix should be gently pipetted to evenly mix, and then the diluted Lipofectamine® 3000 is mixed with DNA. After incubation at room temperature for 15 min, the formed DNA-liposome complex can be added to the cells. Samples at different time points were collected according to subsequent differential tests for later analysis.

[0048] 3. Dual luciferase reporter The specific sequence containing the binding sequence of miR-34b-5p and TRAF3, as well as 100 bases before and after the sequence, was searched on the miRDB website and named as the wild type (WT). When the base sequence of the binding site mutates, a mutant type (MT) is formed. Both wild-type and mutant vectors were synthesized by Shanghai Sangon Biotechnology Co., Ltd. After DF-1 cells were revived, they were passaged once before subsequent experiments. After cells were inoculated in 48-well plates, four different combinations of miR-34b-5p mimic NC / mimic and TRAF3-WT / MT vectors were co-transfected into DF-1 cells with Lipofectamine 3000 according to the established method. 48 h after transfection, dual luciferase activity was detected. The specific operation followed the instructions of the kit, and the results were expressed as firefly luciferin / sea renilla luciferin values. Each sample was set up with 3 independent replicates.

[0049] 4. Vector Construction Overexpression and interference vectors of circAGO3 and miR-34b-5p, as well as interference vector of TRAF3 were constructed. For details, see Table 1. The overexpression plasmid of circAGO3 was constructed using the commercial vector pcD25-ciR, which was provided by Guangzhou Jisai Biotechnology Co., Ltd. The construction of siRNA, miR-34b-5p mimic and miR-34b-5p inhibitor was completed by Shanghai Jima Biotechnology Co., Ltd., while the construction of overexpression plasmid was entrusted to Beijing Qingke Biotechnology Co., Ltd.

[0050] Table 1 Experimental interference, vector sequence

[0051] Note: 'u' is represented by 't' in the sequence listing.

[0052] 5. Western Blot 72 h after transfection, cells were collected and lysed with protein lysis buffer, then placed in an ice box and gently shaken for 30 min, centrifuged at 12000 r / min for 15 min, and the supernatant was collected to obtain total cell protein. The protein concentration was determined using a BCA protein quantification kit, and the amount of lysis buffer was adjusted to synchronize the sample concentration. Refer to the instructions for operation. After that, 1 / 4 volume of loading buffer was added and denatured (100°C, 5 min). The gel was prepared using an SDS-PAGE gel kit, and the electrophoresis system was assembled. Electrophoresis was performed at 90 V for 20 min and then at 110 V for 80 min. The gel strip near the target band was selected according to the position of the marker protein, and a wet transfer device was constructed. The membrane was transferred to a PVDF membrane at 400 mA for 30 min. After the PVDF membrane was incubated with a rapid blocking solution (4°C, 30 min), washed with PBST, incubated with primary antibodies (4°C, 12 h) and secondary antibodies (4°C, 1 h), the antibody reaction band was detected using an ECL developer, and the gel imaging system was used to observe and record the reaction. Each sample was set up with 3 independent replicates.

[0053] 6. Lentiviral vector construction and lentiviral infection The linear sequence of circAGO3 and its flanking circular elements were cloned into the plv4lr-puro-cmv-nc vector (named LV-ov-circAGO3), and the resulting vector was co-transfected with psPAX2 and pMD2 into HEK293T cells to generate lentivirus. After purification, the lentivirus titer was adjusted to 5×108 transduction units (TU) / mL. Subsequently, 12 1-day-old broilers were randomly divided into two groups (LV-ov-NC and LV-ov-circAGO3), and injected once a day with a total volume of 100 uL of 1×10 7 A mixture of TU lentivirus, 0.1 μL 4 mg / mL Polybrene and an appropriate amount of PBS should be injected three times at 8 days of age, and then transferred to a cage of the same specifications, and fed with the same amount of feed on a regular basis every day for another 7 days. The method of injecting lentivirus into the breast muscle of chicks is multi-point injection. Five points are injected into the left and right breast muscles, three points are injected on the side close to the keel, and two points are injected on the side away from the keel. The used microinjector is soaked in 1% SDS overnight.

[0054] 7. Total RNA extraction, reverse transcription and RT-qPCR First, RNAiso Plus Reagent was used to extract total RNA from the cultured cell samples according to the steps in its instructions. Subsequently, the total RNA was reverse transcribed using the EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix Reverse Transcription Kit. In order to optimize the reaction system and reaction conditions, the selected fluorescent quantitative PCR reagent SsoFastTM EvaGreen® supermix was adjusted (see Table 2). The final optimized reaction conditions were as follows: pre-denaturation at 98°C for 2 min; then denaturation at 98°C for 2 s, followed by annealing at X°C for 15 s (where X is related to the target gene, and the annealing temperatures of these target genes belong to conventional technical means in this field, which will not be explained in detail here), and finally extension at 72°C for 10 s, 40 cycles; during the melting curve generation stage, the temperature was increased from 65°C to 95°C (at a rate of 0.5°C / s).

[0055] Table 2 qPCR reaction system

[0056] According to the above reaction system and conditions, β-actin was used as the internal reference gene for mRNA and circRNA quantification, and U6 was used as the internal reference gene for miRNAs quantification. The specific information of the required primers is shown in Table 3. Each sample was set up with 3 independent replicates.

[0057] Table 3 Primer information

[0058] 8. Sequencing and identification of circAGO3 After the circAGO3 primer sequences were determined, circAGO3 in chicken tissue samples was amplified using PCR technology, and its accuracy was verified by Sanger sequencing.

[0059] 9. Immunofluorescence 72 h after cell transfection, cells were first fixed with 4% paraformaldehyde for 30 min and then washed three times with PBS. Next, cells were permeabilized in 0.5% Triton X-100 for 20 min and washed three times with PBS. After that, cells were blocked with goat serum for 30 min, and after removing the serum, MyHC primary antibody diluted 2000 times was added and incubated at 4°C for 12 h. Then, cells were washed three times with PBS, and fluorescently labeled secondary antibodies were added and incubated at 37°C for 1 h. After that, cells were washed three times with PBS again, and DAPI was added to stain the cell nuclei and incubated for 5 min (37°C). Finally, images were randomly captured and analyzed using a fluorescence microscope. Three independent replicates were set for each sample.

[0060] 10. Tissue sectioning, HE staining and muscle fiber number statistics Broilers injected with lentivirus circAGO3 were selected, and the fascia on the surface of the pectoral muscle was peeled off after dissection. A small piece of pectoral muscle tissue was cut with scissors. Then, the tissue was fixed with 4% paraformaldehyde for 48 h and then rinsed with running water. Next, the tissue was dehydrated with different concentrations of alcohol, starting from 30%, gradually increasing to 50%, 70%, 85%, and 90%, and the last time was 100% alcohol, each dehydration for 30 min. Subsequently, the sample was placed in a mixture of pure ethanol and xylene (1:1) for 15 min, and then decolorized twice with xylene, each for 15 min. Next, the sample was placed in a mixture of paraffin and xylene (1:1) for 1 h, and then paraffin infiltration and embedding were performed twice, each for 1 h. The treated samples were sliced ​​using a microtome, and appropriate slices were selected and fixed on slides. Subsequently, the slices were unfolded in a 44°C water bath and heated to 60°C for dewaxing. Next, the samples were rehydrated with alcohol from high to low concentrations. After that, hematoxylin and eosin were added for staining. Finally, the samples were sealed with neutral gum and photographed using a high-resolution microscope. At least three different fields of view were taken for each sample. When the results were statistically analyzed, the ratio of the number of muscle fibers within the selected cross-sectional area to the total number of muscle fibers was calculated. Each sample was repeated 9 times.

[0061] 11.ELISA Select an ELISA kit, dilute the specific antibody globulin to 1~10 ug / mL and add the coating buffer, inject 0.3 mL into each well, and refrigerate at 4℃ overnight or 37℃ water bath for 3 hours. After removing the coating solution, wash the wells 3 times with washing buffer, 5 minutes each time. Then, add the specimen to be tested and the dilution buffer containing the antigen, and act at 37℃ for 12 hours. After washing the wells again, add the enzyme-labeled specific antibody solution and act at 37℃ for 1~2 hours. After washing again, add the substrate solution and act at room temperature for 30 minutes (set up a blank control at the same time). Finally, add 2 mol citric acid and use an enzyme-labeled colorimeter to measure the optical density value. Each sample has 9 independent replicates.

[0062] 12. Transcriptome sequencing and analysis Broilers injected with lentivirus circAGO3 were selected, breast muscles were dissected and samples were ground. Subsequently, tissue RNA was carefully extracted, and its concentration and purity were accurately determined using a nucleic acid protein analyzer to ensure the quality of RNA. Then, the RNA integrity was fully tested by the Agilent analyzer to lay a solid foundation for subsequent sequencing analysis. With the help of the TruSeq RNA sample preparation kit, a high-quality sequencing library was successfully constructed, and accurate sequencing analysis was performed on the Illumina HiSeq X Ten sequencer. The raw data was strictly quality controlled by SeqPrep and Sickle software to remove low-quality reads to ensure data purity. Through accurate alignment with the chicken genome by HISAT2 software, transcript annotation was performed using StringTie software. The transcript expression was accurately calculated using the TPM correction method, and in-depth differential expression analysis was performed with the help of DESeq2 software. Finally, strict screening conditions were set, that is, the expression difference was greater than 1.2 times and the significant P value was less than 0.05, and the genes with accurate differential expression were accurately expressed.

[0063] 13. Data Statistical Analysis (1) Using Excel software, according to the 2-△△t algorithm, the relative expression of the target gene was accurately calculated to provide an accurate data basis for subsequent analysis. (2) In order to further explore the expression differences of each gene in different experimental groups, data analysis was performed with the help of IBMSPSS 20 software, especially independent sample t test and one-way analysis of variance to evaluate the significance of these differences. The significance level was set at P < 0.05 for significant differences and P < 0.01 for extremely significant differences. (3) GraphPad Prism 8.0 software was used to display the results, and all data were presented in the form of mean ± standard error (SEM). (4) Image Lab software was used to process and draw Western Blot images. (5) Image Pro Plus software was used to process and calculate immunofluorescence and HE staining images to ensure the accuracy and reliability of the data.

[0064] Furthermore, the present invention divides the research contents corresponding to the above experimental process into the following five embodiments, and performs detailed result analysis in combination with the above experimental process.

[0065] Example 1: This example investigates the expression of circGO3, as follows: 1. Sequencing results of circAGO3 The sequencing results showed that circAGO3 originated from the AGO3 gene on chicken chromosome 23. Online software analysis showed that circAGO3 was spliced ​​and spliced ​​from exons 5, 6, 7, and 8 of the AGO3 gene, with a total length of 508 nt, as shown in SEQ ID NO. 47. We compared the full-length sequence obtained by sequencing circAGO3 with the exon 5 to 8 sequence of the AGO3 gene in the genome in the Ensembl database (Gallus_gallus5.0), and the results clearly showed that the two were completely consistent.

[0066] SEQ ID NO.47: GTATACCCCTGTGGGCCGCTCCTTCTTCTCAGCTCCAGAAGGCTATGATCACCCCTTGGGGGGGGGGCAGGGAGGTCTGGTTTGGGTTCCATCAGTCTGTCCGGCCTGCCATGTGGAAGATGATGCTC AAATTGATGTTTCTGCCACTGCCTTCTACAAAGCACAACCTGTGATTCAGTTCATGTGTGAAGTTCTTGACATTCATAATATTGATGAACAACCAAGACCTCTGACTGATTCTCATCGGGTAAAAT TCACCAAAGAGATAAAGGGTCTGAAGGTAGAAGTGACTCATTGTGGAACGATGAGGCGGAAATACCGTGTTTGTAACGTAACCAGGAGGCCTGCAAGTCATCAAACCTTTCCTTTACAGTTAGAAAA TGGCCAGACTGTGGAGAGAACAGTAGCACAGTACTTCAGAGAGAAATACAACCTCCAGCTGAAGTATCCTCATCTGCCTTGCCTGCAAGTGGGACAGGAACAGAAACACACCTACCTGCCTTTAGAA 2. Expression of circAGO3 The tissue expression profiles of circAGO3 at embryonic stage E13, postnatal D4, and postnatal D300 were detected by RT-qPCR. The results showed that circAGO3 was expressed in the brain, heart, liver, spleen, lung, kidney, pectoral muscle, leg muscle, stomach, and adipose tissue at different stages, and circAGO3 was highly expressed in pectoral muscle and leg muscle. In addition, the expression of circAGO3 in pectoral muscle and leg muscle at D4 was significantly higher than that in other stages ( Figure 1 ).

[0067] like Figure 2 As shown in the figure, in the middle and late stages of the chicken embryonic period, E10-E20, the study found that with the increase of time, the breast muscle rate first increased and then decreased, but the breast muscle rate decreased rapidly in the later stage, and the breast muscle rate in the E20 period was lower than that in the E10 period ( Figure 2 At the same time, the expression level of circAGO3 gradually increased ( Figure 2 In addition, during the periods of D1, D7, D15, D30, D60, D90, D150, D360, D720, and D900 after birth, the pectoral muscle rate continued to increase and stabilized after D90 ( Figure 2 The expression level of circAGO3 decreased first and then increased, and the expression level was the lowest around D60 ( Figure 2 In general, the breast muscle rate and the expression level of circAGO3 showed an opposite trend, indicating that circAGO3 may inhibit the breast muscle rate of chickens and thus affect the growth and development of skeletal muscle.

[0068] 3. circAGO3 inhibits the growth and development of breast muscle in chicks In order to study the effect of circAGO3 on the growth and development of pectoral muscle, the present invention first constructed an overexpression vector of circAGO3 (pcDNA25-circAGO3) and two siRNAs across the splicing site (as shown in Table 1, circAGO3-1 and circAGO3-1, respectively) to verify the efficiency of circAGO3 in chicken skeletal muscle satellite cells. The results showed that compared with the control group, the mRNA expression level of circAGO3 after overexpression of the circAGO3 vector was significantly increased (P<0.01, Figure 3 However, after transfection with si-circAGO3-1 and si-circAGO3-2, the mRNA expression level of circAGO3 was not significant (P>0.05, Figure 3 The results showed that only the constructed circAGO3 overexpression vector successfully overexpressed circAGO3, and the interference effect was poor because circAGO3 was an inhibitory factor and its expression level was low in normal growing and differentiated skeletal muscle satellite cells. Therefore, the present invention only constructed an overexpression vector for subsequent experiments.

[0069] In order to study the specific role of circAGO3 in the pectoral muscle of chicks, the present invention constructed a lentivirus-coated circAGO3 overexpression vector (LV-ov-circAGO3) based on the overexpression vector sequence of circAGO3 and injected it into the pectoral muscle of chicks by intramuscular injection. Compared with the control group, the expression of circAGO3 in the pectoral muscle of chicks injected with LV-ov-circAGO3 showed a significant downward trend (P<0.01, Figure 4 Then, the breast muscle tissue was collected and measured, and it was found that the breast muscle weight and breast muscle rate of chicks were significantly reduced after injection of LV-ov-circAGO3 (P<0.01, Figure 4 (middle B~D).

[0070] Subsequently, the present invention used RT-qPCR and Western Blot technology to detect changes in mRNA and protein levels related to myogenic differentiation and myotube atrophy. The results showed that after LV-ov-circAGO3-mediated, the mRNA expression levels of myogenic differentiation-related genes MyoD1, MyoG, Myf5 and MyHC were significantly decreased (P<0.01, Figure 5 Middle A); the mRNA expression levels of atrophy-related genes TRIM63, FBXO32, FOXO1, and FOXO3 were significantly increased (P<0.01, Figure 5 From the perspective of protein analysis, the protein levels of MyHC and MyoG were significantly reduced (P<0.01, Figure 5 Middle C); TRIM63 protein level increased significantly (P<0.01, Figure 5 Middle D).

[0071] At the same time, the present invention uses skeletal muscle sections and HE staining test steps to calculate the cross-sectional area of ​​muscle fibers. It was found that after overexpression of circAGO3 in vivo, the cross-sectional area of ​​the pectoral muscle fibers of chicks showed a significant decrease trend (P<0.01, Figure 6 ). In summary, the results showed that circAGO3 could inhibit the growth and development of skeletal muscle in chicks.

[0072] 4. Transcriptional analysis of circAGO3 Subsequently, RNA-seq analysis was performed on chicken breast muscles of the lentivirus-overexpressed circAGO3 and the control group. The results showed that there were 734 differentially expressed genes between the two groups, of which 508 genes were upregulated and 226 genes were downregulated ( Figure 7 In the circAGO3 overexpression group, the expression of eight genes related to skeletal muscle development were found to be significantly decreased: MyoD1, MyoG, Rbm24, ACTC1, CSRP3, Mettl21c, SMYD1, and Unc45b (P<0.05, Figure 7 (C), which is consistent with the previous results that circAGO3 injection with lentivirus inhibited the growth and development of breast muscle in chicks. GO analysis showed that overexpression of circAGO3 could enhance inflammation-related functions ( Figure 7 Middle D).

[0073] At the same time, the KEGG signaling pathway results also showed that these differentially expressed genes were significantly enriched in the four pathways of TNF, TLR, RLR and NLR ( Figure 8 In addition, 12 inflammation-related genes were found in the circAGO3 overexpression group: CCL4, CCL19, CCL20, CX3CL1, PXK, IL1β, IL15, IL2Rα, NFκB2, TLR3, TLR1B, and TLR15 had significantly increased expression levels (P<0.05, Figure 8 According to literature research, the NF-κB signaling pathway was identified, and 7 genes related to the NF-κB signaling pathway were found: TRAF3, NFκB2, TRIM25, SPI1, CTH, STAT1, and TLR3 expression levels increased significantly (P<0.05, Figure 8 C). It can be inferred that circAGO3 regulation of chicken skeletal muscle growth and development may be related to the NF-κB inflammatory signaling pathway.

[0074] Example 2: This example investigates the mechanism by which circAGO3 regulates the growth and development of chicken skeletal muscle satellite cells, as follows: 1. circAGO3 inhibits the differentiation of chicken skeletal muscle satellite cells In order to explore the effect of circAGO3 on the differentiation of chicken skeletal muscle satellite cells, the present invention first used RT-qPCR technology to detect the changes in the mRNA levels of cell differentiation-related genes MyoD1, MyoG, Myf5 and MyHC. The results showed that after overexpression of circAGO3, the mRNA expression levels of the above genes showed a significant downward trend (P<0.01, Fig. 9 Next, Western Blot results also showed that when circAGO3 expression increased, the protein levels of MyHC and MyoG decreased significantly (P<0.01, Fig. 9 In order to more clearly observe the effect of circAGO3 on myotube differentiation, immunofluorescence staining of MyHC was performed in cells. The results confirmed that overexpression of circAGO3 significantly weakened the relative myotube area (P<0.01, Fig. 9 The above data indicate that circAGO3 inhibits the differentiation of chicken skeletal muscle satellite cells.

[0075] 2. circAGO3 promotes inflammatory response in chicken skeletal muscle satellite cells To verify the effect of circAGO3 on the inflammatory response of chicken skeletal muscle satellite cells, the study used RT-qPCR and found that when circAGO3 was overexpressed in cells, the expression levels of inflammatory-related genes IL-1, IL-6, TNF-α, CCL4 and CCL19 were significantly increased (P<0.01, Fig.10ELISA assays further showed that overexpression of circAGO3 increased the concentrations of IL-1β, TNF-α, CCL4, and CCL19 in cell culture fluid (P<0.01, Fig.10 The above data confirmed that circAGO3 exacerbated the inflammatory response of chicken skeletal muscle satellite cells.

[0076] 3. circAGO3 promotes chicken myotube atrophy To study the effect of circAGO3 on chicken myotube atrophy, RT-qPCR, Western Blot and immunofluorescence experiments were used. From the RNA level, the expression levels of atrophy-related genes TRIM63, FBXO32, FOXO1 and FOXO3 were significantly increased after circAGO3 overexpression (P<0.05, Fig.11 At the protein level, the abundance of TRIM63 increased significantly after transfection with pcD25-circAGO3 (P<0.01, Fig.11 Middle B). MyHC immunofluorescence detection showed that the diameter of myotubes with overexpressed circAGO3 vector increased significantly (P<0.05, Fig.11 The above results prove that circAGO3 aggravates the atrophy of chicken skeletal muscle myotubes.

[0077] 4. Prediction and validation of circAGO3-targeted miRNAs In order to verify whether circAGO3 can play a regulatory role through the ceRNA competition mechanism, the present invention predicted the miRNA that circAGO3 may target by using RNAhybird software, and found that miR-34b-5p is a miRNA that has the opposite effect to circAGO3. RT-qPCR results also verified this possibility. After overexpression of circAGO3 in chicken skeletal muscle satellite cells, the expression level of miR-34b-5p was significantly decreased (P<0.01, Fig.12 Middle A). Subsequently, analysis on the RNAhybird website revealed that circAGO3 was tightly bound to miR-34b-5p ( Fig.12 To further test whether cicAGO3 can function as a molecular sponge for miR-34b-5p, we constructed circAGO3 wild-type (circAGO3-WT) and mutant (circAGO3-MT) plasmids ( Fig.12In Figure C, circAGO3-WT / MT and miR-34b-5p mimic / mimic NC were combined and transfected into the chicken DF-1 cell line cultured in vitro. The results showed that the expression level of miR-34b-5p mimic in the circAGO3-WT group showed a significant downregulation trend (P<0.01, Fig.12 The expression levels in the circAGO3-MT group did not show significant differences (P>0.05, Fig.12 Thus, circAGO3 can function as a miR-34b-5p molecular sponge.

[0078] Example 3: This example investigates the mechanism by which miR-34b-5p regulates the growth and development of chicken skeletal muscle satellite cells, as follows: 1. miR-34b-5p promotes skeletal muscle satellite cell differentiation The present invention specifically designs and synthesizes the overexpression sequence mimics and interference sequence inhibitor for the gene sequence of miR-34b-5p. Subsequently, these sequences were transfected into chicken skeletal muscle satellite cells cultured in vitro, and samples were collected 24 hours after transfection. By applying RT-qPCR technology, it was observed that the expression level of miR-34b-5p increased by about 2400 times after adding miR-34b-5p mimics (P<0.01, Fig.13 ); while the addition of miR-34b-5p inhibitor decreased the expression of miR-34b-5p by about 60% (P<0.01, Fig.13 ). In summary, mimics and inhibitors of miR-34b-5p can effectively regulate its expression level, providing a direction for subsequent functional verification.

[0079] The miR-34b-5p mimics and inhibitors were transfected into chicken skeletal muscle satellite cells to study the regulatory effect of miR-34b-5p on the differentiation function of skeletal muscle satellite cells. From the RNA level, after overexpression of miR-34b-5p, the expression levels of myogenic differentiation-related genes MyoD1, MyoG, Myf5 and MyHC were significantly increased (P<0.01, Fig.14 Inhibition of miR-34b-5p expression significantly decreased the expression of these genes (P<0.01, Fig.14 At the protein level, the abundance of MyHC and MyoG proteins increased significantly after transfection with miR-34b-5p mimics (P<0.05, Fig.14 The protein abundance was significantly decreased after transfection with miR-34b-5p inhibitor (P<0.05, Fig.14 Middle D).

[0080] At the same time, MyHC immunofluorescence staining of cells also confirmed the above results. The addition of miR-34b-5p mimics could significantly increase the relative myotube area (P<0.01, Fig.15 A-B), while the miR-34b-5p inhibitor was just the opposite (P<0.01, Fig.15 C~D), the study showed that miR-34b-5p has a positive effect on the formation of myotubes. In summary, these data support that miR-34b-5p can promote the differentiation process of chicken skeletal muscle satellite cells.

[0081] 2. miR-34b-5p inhibits inflammatory response of skeletal muscle satellite cells To verify the effect of miR-34b-5p on the inflammatory response of chicken skeletal muscle satellite cells. The present invention transfected miR-34b-5p mimics and inhibitors into skeletal muscle satellite cells, and performed RT-qPCR detection 24 h after transfection. The data showed that when miR-34b-5p was overexpressed, the mRNA expression levels of IL-1, IL-6, TNF-α, CCL4 and CCL19 were significantly downregulated (P<0.01, Fig.16 Interference with miR-34b-5p could significantly up-regulate the mRNA expression of IL-1, IL-6, TNF-α, CCL4 and CCL19 (P<0.01, Fig.16 At the same time, ELISA experiments also verified the above conclusions. Overexpression of miR-34b-5p reduced the concentrations of IL-1β, TNF-α, CCL4 and CCL19 in cell culture medium (P<0.01, Fig.16 After the interference, the opposite trend was observed (P<0.01, Fig.16 Middle D). The results showed that miR-34b-5p could alleviate the inflammatory response of chicken skeletal muscle satellite cells.

[0082] 3. miR-34b-5p inhibits myotube atrophy The present invention further explored the effect of miR-34b-5p on chicken myotube atrophy. From the RNA level, the expression levels of muscle atrophy-related genes TRIM63, FBXO32 and FOXO1 were significantly decreased after overexpression of miR-34b-5p (P<0.05, Fig.17 However, after interfering with miR-34b-5p, the mRNA expression levels of TRIM63, FBXO32, FOXO1, and FOXO3 showed a significant upward trend (P<0.05, Fig.17 At the protein level, after transfection with miR-34b-5p mimics, the protein expression of TRIM63 showed a significant downward trend (P<0.01, Fig.17 After transfection with miR-34b-5p inhibitor, the protein expression of TRIM63 was significantly increased (P<0.01, Fig.17 Middle D).

[0083] Subsequently, MyHC immunofluorescence detection showed that the diameter of myotubes increased significantly after adding overexpressed miR-34b-5p (P<0.05, Fig.18 (A-B), the diameter of myotubes decreased significantly after interference with miR-34b-5p (P<0.05, Fig.18 The above data indicate that miR-34b-5p can alleviate the degree of myotube atrophy in chickens.

[0084] 4. Prediction and verification of miR-34b-5p target genes According to the sequencing results, 7 genes related to the NF-κB signaling pathway were screened. Among them, the relative mRNA expression of TRAF3 increased after overexpression of circAGO3 (P<0.05, Fig.19 Middle A), the study inferred that TRAF3 may be the target gene of miR-34b-5p. RT-qPCR results also verified this possibility. After interfering with miR-34b-5p in chicken skeletal muscle satellite cells, the expression level of TRAF3 was significantly increased (P<0.01, Fig.19 Subsequently, the present invention uses the pmirGLO vector as a basis to construct the wild-type and mutant vectors of the 3'UTR region of TRAF3 ( Fig.19 C). TRAF3-WT / MT and miR-34b-5pmimic / mimic NC were co-transfected into DF-1 cell lines in vitro, and the relative luciferase activities of firefly and Renilla were calculated. According to the dual luciferase reporter gene data, compared with the control group, the addition of miR-34b-5p mimics significantly downregulated the luciferase activity of the TRAF3-WT treatment group (P<0.05, Fig.19 The luciferase activity of the TRAF3-MT group showed no significant change trend (P>0.05, Fig.19 The above results indicate that miR-34b-5p can directly target TRAF3 to exert negative regulatory effects.

[0085] Example 4: This example investigates the mechanism by which TRAF3 regulates the growth and development of chicken skeletal muscle satellite cells, as follows: 1. Interference with TRAF3 promotes skeletal muscle satellite cell differentiation Since the CDS region of TRAF3 is relatively long, the present invention only constructs the interference siRNA sequence of TRAF3. The three interference siRNAs constructed (TRAF3-1, TRAF3-2, and TRAF3 in Table 1) were detected by RT-qPCR technology, and it was found that when si-TRAF3-3 (TRAF3) was used to treat skeletal muscle satellite cells, the relative expression of TRAF3 mRNA in the cell body decreased most significantly (P<0.01, Fig. 20 ). The results showed that the constructed siRNAs could reduce the expression of TRAF3, and si-TRAF3-3 (hereinafter referred to as si-TRAF3) was used to interfere with TRAF3 in subsequent experimental studies.

[0086] Then, the effect of si-TRAF3 transfection on the differentiation of chicken skeletal muscle satellite cells was investigated. RT-qPCR results showed that the mRNA levels of MyoD1, MyoG, Myf5 and MyHC were significantly increased (P<0.01, Fig.21 In addition, Western Blot results also showed that when TRAF3 expression was reduced, the protein levels of MyHC and MyoG increased significantly (P<0.05, Fig.21 Middle B), indicating that interference with TRAF3 can promote the differentiation of skeletal muscle satellite cells. Immunofluorescence was used to observe the myotube area, and the results showed that the relative myotube area of ​​cells increased significantly after knocking down TRAF3 (P<0.01, Fig.21 In conclusion, TRAF3 negatively regulates the differentiation of chicken skeletal muscle satellite cells.

[0087] 2. Interference with TRAF3 inhibits inflammatory response of skeletal muscle satellite cells TRAF3 siRNA was transfected into chicken skeletal muscle satellite cells cultured in vitro to detect the effect of TRAF3 on cellular inflammatory response. RT-qPCR results showed that the expression levels of IL-1, IL-6, TNF-α, CCL4 and CCL19 were significantly decreased after TRAF3 interference (P<0.01, Fig. 22 The results of ELISA also confirmed the above conclusions. After interfering with TRAF3, the concentrations of IL-1β, TNF-α, CCL4 and CCL19 in skeletal muscle satellite cells decreased significantly (P<0.01, Fig. 22 (B) This indicates that TRAF3 has a positive regulatory effect on the inflammatory response of chicken skeletal muscle satellite cells.

[0088] 3. Interference with TRAF3 inhibits myotube atrophy The effect of si-TRAF3 transfection on myotube atrophy was further tested. RT-qPCR results showed that when TRAF3 was interfered in skeletal muscle myotubes, the expression levels of genes TRIM63, FBXO32, FOXO1 and FOXO3 were significantly reduced (P<0.01, Fig.23 Western Blot results showed that when TRAF3 was knocked down in cells, the expression of protein TRIM63 was significantly decreased (P<0.01, Fig.23 Middle B). MyHC immunofluorescence detection showed that the diameter of myotubes increased significantly after the addition of TRAF3 interference (P<0.05, Fig.23 These results indicate that TRAF3 has a positive regulatory effect on the atrophy of chicken skeletal muscle myotubes.

[0089] Example 5: This example investigates the mechanism by which the circAGO3 / miR-34b-5p / TRAF3 axis regulates the growth and development of chicken skeletal muscle, as follows: 1. circAGO3 / TRAF3 mediates NF-κB signaling pathway to inhibit satellite cell growth and development To explore the regulatory role of TRAF3 in the NF-κB signaling pathway. The Western Blot data of the present invention showed that after transfection of si-TRAF3 in skeletal muscle satellite cells, the protein level of TRAF3 showed a significant downregulation trend (P<0.01, Fig.24 Meanwhile, transfection of si-TRAF3 induced a significant decrease in the protein levels of TAK1 and p-IκBα / IκBα (P<0.01, Fig.24 In A-C, the protein level of NFκB1 increased significantly (P<0.05, Fig.24 The above results indicate that TRAF3 may play a regulatory role through the NF-κB signaling pathway.

[0090] To further test whether circAGO3 can regulate the growth and development of skeletal muscle satellite cells through TRAF3-mediated NF-κB signaling pathway. The present invention set up three experimental groups, in which skeletal muscle satellite cells were co-treated with empty vector and si-NC as blank controls, and the other two groups were co-transfected with ov-circAGO3 and si-NC / TRAF3. Western Blot results showed that compared with the control group, the protein level of TRAF3 was significantly increased after ov-circAGO3 and si-NC co-treated skeletal muscle satellite cells (P<0.05, Fig.25 The protein levels of TAK1 and p-IκBα / IκBα were also significantly increased (P<0.05, Fig.25In A-C, the protein level of NFκB1 was significantly decreased (P<0.05, Fig.25 When ov-circAGO3 and si-TRAF3 were co-transfected into skeletal muscle satellite cells, the protein expression levels of TRAF3, TAK1, and p-IκBα / IκBα were significantly decreased compared with those of ov-circAGO3 and si-NC co-treated skeletal muscle satellite cells (P<0.05, Fig.25 A-C), while the protein level of NFκB1 increased significantly, revealing that circAGO3 can offset the effect of TRAF3 interference on skeletal muscle satellite cells. These results indicate that circAGO3 can inhibit the growth and development of chicken skeletal muscle satellite cells through TRAF3-mediated NF-κB signaling pathway.

[0091] 2. circAGO3 / miR-34b-5p mediates NF-κB signaling pathway to inhibit satellite cell growth and development To further verify whether circAGO3 can regulate the growth and development of skeletal muscle satellite cells through the NF-κB signaling pathway mediated by miR-34b-5p. The present invention also set up three experimental groups, two empty vectors were used as blank controls to co-transfect skeletal muscle satellite cells, and the other two groups were ov-NC / ov-circAGO3 and miR-34-5p mimic co-treated skeletal muscle satellite cells. RT-qPCR results showed that compared with the empty vector group, the mRNA expression of TRAF3 in the ov-NC and miR-34b-5p mimic groups was significantly decreased (P<0.01, Fig.26 Compared with the co-overexpression of circAGO3 and miR-34b-5p, the mRNA expression of TRAF3 in the ov-NC and miR-34b-5p mimic groups was significantly increased (P<0.01, Fig.26 Western Blot results showed that compared with the empty group, the protein level of TRAF3 was significantly decreased after ov-NC and miR-34b-5p mimic co-treated skeletal muscle satellite cells (P<0.05, Fig.26 The protein levels of TAK1 and p-IκBα / IκBα were also significantly decreased (P<0.05, Fig.26 In middle B-D, the protein expression of NFκB1 increased significantly (P<0.01, Fig.26 When circAGO3 and miR-34b-5p were co-overexpressed in skeletal muscle satellite cells, compared with the co-treatment of ov-NC and miR-34b-5p mimic, the protein expression levels of TRAF3, TAK1 and p-IκBα / IκBα were significantly upregulated (P<0.05, Fig.26The protein expression of NFκB1 showed a significant down-regulation trend (P<0.01, Fig.26 Figures B-C) ​​revealed that circAGO3 has the ability to counteract the effects of miR-34b-5p mimic on skeletal muscle satellite cells. In summary, circAGO3 can inhibit the growth and development of chicken skeletal muscle satellite cells through the miR-34b-5p-mediated NF-κB signaling pathway.

[0092] 3. circAGO3 mediates NF-κB signaling pathway to inhibit pectoral muscle growth and development To further verify whether circAGO3 regulates the growth and development of pectoral muscles through TRAF3-mediated NF-κB signaling pathway in vivo. After injecting lentivirus to overexpress circAGO3, the protein level of TRAF3 in pectoral muscles was significantly increased after injecting lentivirus to overexpress circAGO3 compared with the control group (P<0.01, Fig. 27 The protein levels of TAK1 and p-IκBα / IκBα were also significantly increased (P<0.05, Fig. 27 A-C), the protein level of NFκB1 decreased significantly (P<0.01, Fig. 27 The results showed that circAGO3 could also inhibit the growth and development of chicken breast muscle through TRAF3-mediated NF-κB signaling pathway in vivo.

[0093] In summary, the circAGO3 mined by the present invention is a circular RNA formed by reverse splicing of exons 5-8 of the AGO3 gene. It is highly expressed in chicken muscle tissue, and the breast muscle rate is inversely proportional to the expression of circAGO3. In vivo, lentiviral injection of circAGO3 into the breast muscle of chicks can inhibit the growth and development of breast muscles; in vitro, circAGO3 in chicken skeletal muscle satellite cells can inhibit cell differentiation, promote their inflammatory response and myotube atrophy. CircAGO3 can target and bind to miR-34b-5p, and miR-34b-5p can promote the differentiation of chicken skeletal muscle satellite cells, inhibit their inflammatory response and myotube atrophy; TRAF3 is the target gene of miR-34b-5p, and TRAF3 can inhibit the differentiation of chicken skeletal muscle satellite cells, promote their inflammatory response and myotube atrophy. CircAGO3 can mediate the NF-κB signaling pathway through the miR-34b-5p / TRAF3 axis, inhibiting the growth and development of chicken breast muscle and skeletal muscle satellite cells. The discovery of circAGO3 can provide potential targets and new research directions for subsequent molecular breeding of chickens.

[0094] Although the embodiments of the present invention have been shown and described, it is understood that a person of ordinary skill in the art may make various changes, modifications, substitutions and variations to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the attached claims and their equivalents. The above-described embodiments only express several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that a person of ordinary skill in the art may make several variations and improvements without departing from the concept of the present invention, and these all belong to the scope of protection of the present invention. Therefore, the scope of protection of the patent of the present invention shall be based on the attached claims.

Claims

1. Use of an agent for reducing or inhibiting the expression of circAGO3 gene in the preparation of a product for promoting the growth and development of chicken skeletal muscle, wherein the agent has a sequence as shown in SEQ ID NO.

11.

2. The use according to claim 1, characterized in that: The full-length nucleotide sequence of the circAGO3 gene is shown in SEQ ID NO.47, and the target miRNA of the circAGO3 gene is miR-34b-5p.

3. Use of an agent that enhances or promotes the expression of miR-34b-5p or an agent that reduces the adsorption of miR-34b-5p in the preparation of a product that promotes the growth and development of chicken skeletal muscle.

4. The use according to claim 3, characterized in that: The reagent has the sequence shown in SEQ ID NO.

11.

5. A method for promoting the growth and development of chicken skeletal muscle, characterized in that: include: The sequence shown in SEQ ID NO. 11 was transfected into chicken skeletal muscle satellite cells.

Images