Gene taNAE capable of improving resistance to wheat scab and application thereof

By overexpressing the TaNAE gene in wheat and introducing the TaNAE protein using Agrobacterium-mediated genetic transformation, the resistance of wheat to Fusarium head blight was improved, solving the problems of yield and toxin exceeding standards caused by wheat Fusarium head blight, and achieving high-quality and stable wheat production and improved economic benefits.

CN119144628BActive Publication Date: 2025-12-12YANGZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411245244.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-06
Publication Date
2025-12-12
Estimated Expiration
2044-09-06

AI Technical Summary

Technical Problem

Fusarium head blight in wheat severely affects yield and causes excessive toxin levels in grains. Existing technologies are insufficient to effectively improve wheat's disease resistance.

Method used

By overexpressing the TaNAE gene, a nucleic acid molecule capable of expressing the TaNAE protein was introduced into wheat using Agrobacterium-mediated stable genetic transformation, thereby improving wheat's resistance to Fusarium head blight.

Benefits of technology

It significantly improves wheat's resistance to Fusarium head blight, ensures high-quality and stable wheat yields, increases farmers' economic income, and guarantees food quality and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119144628B_ABST
    Figure CN119144628B_ABST
Patent Text Reader

Abstract

The application discloses a gene TaNAE capable of improving the disease resistance of wheat scab and an application thereof, and relates to a gene TaNAE which is a specific expression gene of a disease-resistant variety Su Mai No.3. The gene is introduced into a popular variety Fielder by means of an agrobacterium infection method through construction of an overexpression vector, and stable transgenic plants are obtained, and the disease resistance of scab is significantly improved in three transgenic lines obtained. The application has important production significance for improving the disease resistance of wheat scab, and provides a new gene resource for cultivating new wheat varieties with high yield, stable yield and strong wide adaptability.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a gene TaNAE capable of improving the disease resistance of wheat scab and application thereof. BACKGROUND

[0002] Wheat scab (Fusarium head blight, FHB) is a fungal disease caused by Fusarium graminearum invading the wheat ear, which can cause the wheat ear to be bluish and the grain to be shriveled, and the grain to accumulate a large amount of deoxynivalenol toxin, resulting in a substantial reduction in wheat yield and grain toxin exceeding the standard. TaNAE (Neprosin activation endoprotease) protein is a selective proline endopeptidase and belongs to the glutamic acid protease family G3. In cells, proline endopeptidase participates in protein quality control, maintains cell homeostasis by degrading abnormal or damaged proteins. Proline endopeptidase also plays an important role in host defense against pathogens. Some proline endopeptidases secreted by microorganisms have antibacterial activity and can degrade the protein components of pathogens, thereby inhibiting their growth and infection. By specifically degrading the cell wall or other key proteins of pathogenic bacteria, proline endopeptidase can effectively kill or inhibit pathogenic bacteria. Therefore, this type of enzyme can enhance the immune response of the host and can work synergistically with other immune components to improve the anti-infection ability. SUMMARY

[0003] This section is intended to summarize some aspects of the embodiments of the application and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of the specification to avoid obscuring the purpose of this section, the abstract and the title, and such simplifications or omissions cannot be used to limit the scope of the application.

[0004] In view of the above and / or problems existing in the prior art, the present application is proposed.

[0005] To solve the above technical problems, the present application provides the following technical scheme: a gene TaNAE, characterized in that the nucleotide sequence of the gene is as shown in SEQ ID No. 1.

[0006] Another object of the present application is to overcome the deficiencies in the prior art and provide a TaNAE protein encoded by the gene TaNAE according to claim 1.

[0007] The protein is as shown in any one of (a) to (d):

[0008] (a) a protein with an amino acid sequence of SEQ ID NO. 2;

[0009] (b) a protein derived from SEQ ID NO. 1 with one or several amino acid residues being substituted and / or deleted and / or added in the amino acid sequence shown in SEQ ID NO. 2 and having the same function;

[0010] (c) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with any one of the amino acid sequences defined in (a) or (b) and having the same function;

[0011] (d) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (a) to (c).

[0012] As a preferred embodiment of the TaNAE gene according to the present application, the length of the TaNAE gene is 1242 bp, and the number of amino acids encoded in the TaNAE gene is 413 aa.

[0013] Still another object of the present application is to provide a recombinant vector of the TaNAE gene to overcome the deficiencies in the prior art.

[0014] The nucleotide sequence of the recombinant vector is shown in SEQ ID No. 3, which is obtained by inserting the nucleotide sequence of SEQ ID No. 1 between the restriction enzymes HindIII and BamHI of the polycloning site of pCambia3300 backbone vector.

[0015] Still another object of the present application is to provide overexpression of the TaNAE gene as a preferred embodiment of the TaNAE gene according to the present application, which comprises overexpressing the TaNAE gene.

[0016] The overexpression of the TaNAE gene is used for improving the resistance to wheat scab.

[0017] The last object of the present application is to provide a method for breeding plant varieties with improved resistance to wheat scab to overcome the deficiencies in the prior art.

[0018] The nucleic acid molecule capable of expressing the TaNAE protein is introduced into the recipient plant by using the stable genetic transformation method mediated by Agrobacterium to obtain a transgenic plant, and the transgenic plant has higher resistance to scab than the recipient plant.

[0019] The recipient plant is a plant in the family Poaceae.

[0020] The nucleic acid molecule capable of expressing the TaNAE protein is introduced into the recipient plant by introducing a recombinant expression vector containing the nucleic acid molecule capable of expressing the TaNAE protein into the recipient plant.

[0021] The present application has the following beneficial effects:

[0022] The present application can significantly improve the scab resistance of wheat by overexpressing TaNAE gene in wheat, which can ensure the high quality and stable yield of wheat in the high incidence area of scab, improve the economic income of farmers, and therefore has important significance and application prospect for ensuring the quality and safety of grain. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced as follows, and the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the premise of not paying creative labor. Among them:

[0024] Figure 1 It is a nucleic acid sequence alignment chart of Sumai 3 and TaNAE in Zhongguochun in embodiment 1 of the present application.

[0025] Figure 2 It is a chart of expression and tissue-specific expression of TaNAE between resistant and susceptible varieties in embodiment 1 of the present application. Figure 2 A is the specific expression of TaNAE in Sumai 3, Figure 2 B is the expression pattern of TaNAE in different tissues of Sumai 3.

[0026] Figure 3 It is a schematic diagram of vector construction in embodiment 1 of the present application.

[0027] Figure 4 It is a positive identification chart of transgenic in embodiment 1 of the present application. The band in the chart is the band of BAR gene.

[0028] Figure 5 It is an expression detection chart of positive strain in embodiment 1 of the present application.

[0029] Figure 6 It is a scab phenotype chart of TaNAE overexpression transgenic material in embodiment 1 of the present application.

[0030] Figure 7 It is the statistical result of scab spike rate of TaNAE overexpression transgenic material in embodiment 1 of the present application. DETAILED DESCRIPTION

[0031] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application will be described in detail in combination with the description of the embodiments.

[0032] In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. However, the present application can be practiced without the specific details. In other instances, well-known methods have not been described in detail in order not to unnecessarily obscure aspects of the present application. The present application is not limited to the embodiments described herein which can be practiced with or without the same.

[0033] It is also noted that, as used herein, "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the present application. The appearances of the phrase "in one embodiment" or "in an embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are the cited

[0034] The raw materials used in the embodiments of the present application are commercially available unless otherwise specified.

[0035] Taking the genome of wheat variety Zhonghun as a reference, the TaNAE gene is located on the 5A chromosome of wheat, but there are multiple allelic variations in the nucleic acid sequence of the gene that can cause amino acid changes (sequence alignment is shown in Figure 1 ). The gene is specifically expressed in the Su Mai No. 3 variety resistant to scab, and we found that TaNAE is expressed in the glume, inner glume, stem and leaf of wheat Figure 2 ) by sampling different tissues of Su Mai No. 3 and performing semi-quantitative analysis. These tissues are all the tissues invaded and expanded by Fusarium graminearum. Therefore, we extracted the RNA of Su Mai No. 3, performed reverse transcription to obtain cDNA, amplified the CDS sequence of TaNAE, and performed vector construction, genetic transformation and scab phenotype identification. The nucleotide sequence of the TaNAE gene is shown as SEQ ID NO: 1 in the sequence listing, and the protein amino acid sequence is shown as SEQ ID NO: 2.

[0036] Embodiment 1

[0037] (1) Wheat RNA extraction and reverse transcription:

[0038] I. RNA extraction:

[0039] ① Preparation: sample, 2 mL / 1.5 mL enzyme-free centrifuge tube, enzyme-free gun head, 75% alcohol (prepared with DEPC-treated water), isopropanol, 4°C pre-cooling centrifuge.

[0040] ② Use liquid nitrogen to pre-cool the mortar and pestle, quickly take the sample into the mortar, grind to powder, take an appropriate amount of powder into a 2 mL enzyme-free centrifuge tube, and place the centrifuge tube on ice, then add 1 mL Trizol, and then place it on a shaker for 30 s of full shaking to fully lyse, then add 400 μL of chloroform, place it on a shaker for full shaking for 15 s, stand for 3 min, then place it in a centrifuge, set 4°C, 12000 rpm, centrifuge for 15 min;

[0041] ③Take 400 μL of supernatant into a 1.5 mL enzyme-free centrifuge tube, add isopropyl alcohol at a ratio of 1:1, mix well by turning up and down 5-10 times, and then place in a -20°C refrigerator for 30 min to precipitate the RNA. After precipitation is complete, place in a centrifuge, set 4°C, 12000 rpm, and centrifuge for 15 min;

[0042]

[0043] ⑤Place the centrifuge tube in a clean bench and blow dry for 15-20 min until transparent. Add preheated 70°C DEPC water and dissolve for 5 min.

[0044]

[0045] II. Reverse transcription of cDNA using a reverse transcription kit (Novozyme, Nanjing):

[0046] ①Remove genomic DNA:

[0047] Table 1

[0048]

[0049] PCR program: 42°C, 2 min.

[0050] ②Reverse transcription of cDNA:

[0051] Table 2

[0052]

[0053] PCR program: 50°C for 15 min; 85°C for 2 min. Reverse transcription product is stored at -20°C.

[0054] (2) Real-time fluorescent quantitative PCR and semi-quantitative PCR:

[0055] ①Design primers for quantification and semi-quantification according to the genome of Chinese Spring, a wheat variety, as the reference genome. The sequences are as follows:

[0056] Forward primer: GGGGTTCCTACGAAGGCAATG (SEQ ID NO: 4);

[0057] Reverse primer: CCACCAGTTGCCCTCCTTTG (SEQ ID NO: 5); ​​

[0058] 2. Real-time fluorescent quantitative PCR: Prepare 10 μL of quantitative PCR system as follows:

[0059] Table 3

[0060]

[0061] PCR program: pre-denaturation: 95℃ 30s; cycle reaction: 95℃ 5s, 60℃ 34s, 40 cycles; melting curve: 95℃ 15s, 60℃ 60s, 95℃ 15s.

[0062] 3. Semi-quantitative PCR: Prepare 10 μL of quantitative PCR system as follows:

[0063] Table 4

[0064]

[0065]

[0066] PCR program: pre-denaturation: 95℃ 30s; cycle reaction: 95℃ 30s, 58℃ 30s, 72℃ 30s, 30 cycles; post-extension: 72℃ 5min After semi-quantitative, identify the product size with 2% agarose gel.

[0067] (3) Construction of transgenic vector:

[0068] Use Primer premier 5 primer design software to design the construction primer of transgenic overexpression vector, the primer sequence is: forward primer: CCAAGCTTATGGCCGCCACCCGAGC (SEQ ID NO: 6) reverse primer: CGGGATCCTGGGCAGTTAGAGTTCTTCCC (SEQ ID NO: 7); The primer is synthesized by Nanjing Kingsway company.

[0069] Use SM cDNA as template to amplify TaNAECDS sequence, the reaction system is as follows:

[0070] Table 5

[0071]

[0072] PCR program: 94℃ 3min; 94℃ 30s, 58℃ 30s, 68℃ 4min, 30 cycles; 68℃, 10min; product 4℃ preservation.

[0073] Agarose gel purification of PCR product:

[0074] 1. Prepare 2% agarose gel with TAE electrophoresis buffer solution, add 1% volume of 0.5mg / mL EB when preparing the gel;

[0075] 2. Add 5 μL 10x loading buffer to the PCR product, and load all samples into the gel hole. Point Trans2k DNA Marker in the empty hole, and electrophorese at 130 V for 15 min.

[0076] 3. Under the UV light (Bio-RAD), cut the gel block (the size of the band is consistent with the size of the target fragment) with a clean blade, and put it into a 2.0 mL centrifuge tube.

[0077] 4. According to the instructions of the gel recovery kit (Shenguo, China), recover the target fragment.

[0078] Connection cloning vector pEASY-Blunt3:

[0079] Preparation of the system:

[0080] Table 6

[0081]

[0082] PCR procedure: 25℃ for 30 min

[0083] Transformation of the ligation product into E. coli competent cells:

[0084] 1. After thawing the Fast-T1 competent cell suspension on ice, mix 50 μL of the competent cells with all the products of the previous step, and then mix and beat them on ice for 30 min.

[0085] 2. Place it in a metal bath for heat shock at 42℃ for 1 min 30 s. After heat shock, quickly put it in an ice bath for 3-5 min. Then add 1 mL of LB liquid medium, mix and beat them, and then put it in a shaker, set 37℃, 150 rpm, and culture for 1 h.

[0086] 3. After the culture ends, centrifuge at 5000 rpm for 5 min, discard the supernatant, and then gently mix and beat the precipitate with the residual liquid medium in the tube using a pipette gun. Then, spread it on LB solid medium with Amp resistance. After there is no obvious water stain on the plate, seal the plate with a sealing film, and then put it in a 37℃ incubator overnight.

[0087] 4. The next day, randomly select 10 bacterial spots from the LB solid medium, and perform PCR detection on the positive strains.

[0088] PCR reaction system:

[0089] Table 7

[0090]

[0091] PCR program: 95°C, 3 min; 95°C, 30 s, 58°C, 30 s, 72°C, 2 min, 28 cycles; 72°C, 5 min;

[0092] 5. Identification by 2% agarose gel. The gel imaging system (Bio-RAD) was observed under ultraviolet, and the positive clones were selected and placed in LB liquid medium (containing ampicillin) and cultured overnight at 37°C with shaking at 180 rpm.

[0093] 6. The identified positive strains were shaken and then sent to Jinweizhi Company (Suzhou, China) for sequencing.

[0094] 7. Alignment analysis of sequencing results. The sequencing results were aligned with the target sequence using DNAMAN software for verification.

[0095] The correct strain was selected according to the plasmid DNA extraction kit (China, Shengong) and the plasmid was extracted for enzyme digestion.

[0096] Prepare 50 μL enzyme digestion reaction system, and the components are as follows:

[0097] Table 8

[0098]

[0099] PCR program: 37°C for 2h

[0100] The PCR product was purified by agarose gel and the target fragment was recovered according to the instructions of the gel recovery kit (Shengong, China).

[0101] Link pCambia3300 vector:

[0102] Prepare 10 μL ligation system, and the components are as follows:

[0103] Table 9

[0104]

[0105]

[0106] The PCR program is 25°C for 2h.

[0107] The ligation product was transformed into E. coli Fast-T1 competent cells, and after overnight culture, 20 single colony spots were selected from each plate for PCR to detect positive strains. The positive strains were extracted for plasmid and then transferred into Agrobacterium EHA105 to create transgenic materials. The vector diagram of the constructed vector is as follows: Figure 3The nucleotide sequence of the recombinant vector is shown in SEQ ID NO: 3, wherein CaMV35S represents a tobacco mosaic virus 35S strong promoter, and the BAR gene can confer herbicide resistance to plants.

[0108] (4) Genetic transformation: the creation of transgenic materials was completed by Tianjin Genovo Biotechnology Co., Ltd.

[0109] (5) Transgenic positive identification:

[0110] DNA level identification:

[0111] Extraction of transgenic wheat DNA:

[0112] ① The wheat leaves were ground in a mortar with liquid nitrogen, and the fully ground powder was moved to a 1.5 mL centrifuge tube; 650 mL of CTAB extraction solution (100 mM, Tris-HCl (pH 8.0), 4 mol / L NaCl, 20 mmol / L EDTA (pH 8.0), 2% CTAB, 2 mL / 100 mL β-mercaptoethanol was added before use) was added and mixed well;

[0113] ② 65°C water bath for 30 min, with slight shaking several times in between;

[0114] ③ Place on ice for 5 min;

[0115] ④ Add 400 μL of chloroform and mix gently;

[0116] ⑤ Room temperature, stand for 10 min, centrifuge at 12000 rpm for 15 min, take the supernatant;

[0117] ⑥ Add 2 times the volume of ice ethanol, mix well, and stand at -20°C for 30 min;

[0118] ⑦ Centrifuge and discard the supernatant;

[0119] ⑧ 70% ethanol 1 mL rinse 2 times, and dry;

[0120] ⑨ Dissolve with 100 μL of sterile water and reserve.

[0121] Detection of BAR gene: the BAR gene detection primers are as follows:

[0122] Forward primer: CTACATCGAGACAAGCACGGTCAA (SEQ ID NO: 8)

[0123] Reverse primer: AGAAACCCACGTCATGCCAGTTC (SEQ ID NO: 9)

[0124] The following PCR program was used for detection, and the PCR reaction system was as follows:

[0125] Table 10

[0126]

[0127]

[0128] PCR program: 95℃, 3min; 95℃, 30s, 58℃, 30s, 72℃, 30s, 35 cycles; 72℃, 5min;

[0129] PCR products were identified by 2% agarose gel, and the results are shown in Figure 4 . Among them, the detection gene is BAR gene. #28, #39 and #46 represent three transformation lines respectively.

[0130] The expression level identification results are shown in Figure 5 .

[0131] Gibberella phenotypic analysis:

[0132] Experimental strains and bacterial liquid preparation:

[0133] The Fusarium graminearum used in this experiment is the sequenced strain PH-1, which is provided by Dr. Li Bing of Zhengzhou University. The strain and bacterial liquid preparation steps are as follows:

[0134] ① Activate the strain on PDA solid medium, and place the medium in a constant temperature incubator at 25℃ for culture, and the culture time is 5 days to ensure the growth and reproduction of the strain.

[0135] ② After the culture is completed, use a sterilized punch to take 4 fungal blocks from the culture medium, and transfer the obtained fungal blocks to 50mL mung bean soup liquid medium, set the shaking bed temperature and speed to 25℃ and 150r / min respectively, and culture for 3-5 days.

[0136] ③ After the culture is completed, take 1μL of spore liquid and drop it on a hemocytometer, and use a microscope to observe and count the spores to determine the concentration of the spores. When the concentration of the spores reaches 1×10 5 / mL, the spore liquid can be used for inoculation experiments.

[0137] Gibberella inoculation and phenotypic identification:

[0138] At the flowering stage of wheat, the double-flower dripping method is used to inject the bacterial liquid between the inner and outer glumes of the fifth floret on both sides of the wheat, and a label is attached to the spike axis inoculated with the floret to indicate the inoculation date. Gibberella identification is carried out 14 days after inoculation. The method for calculating the diseased floret rate is: diseased floret rate = diseased floret / total floret number. The phenotypic identification and statistical results are shown in Figure 6 , 7 .

[0139] Figure 1 Figure 3 is a nucleic acid sequence alignment of TaNAE in Sumai 3 and Chinese Spring, wherein SM represents Sumai 3, CS represents Chinese Spring, and the color difference part shows the nucleotide variation sites. Figure 2 Figure 4 is the expression and tissue-specific expression of TaNAE in resistant varieties, wherein "CSM" represents the control sample of Chinese Spring, "CSI" represents the inoculated sample of Chinese Spring, "SMM" represents the control sample of Sumai 3, "SMI" represents the inoculated sample of Sumai 3, and "Actin" is the internal reference gene. Figure 2 Figure 5 is the expression pattern of TaNAE in different tissues of Sumai 3, wherein "Glume" represents the glume, "Lemma" represents the lemma, "Palea" represents the palea, "Rachis" represents the rachis, "Seeds" represents the seed, "Flower" represents the flower, "Leaves" represents the leaf, "Stem" represents the stem, and "Root" represents the root. Figure 5 Figure 6 is the expression detection of positive lines, wherein Fielder is the transgenic receptor variety, EV represents the negative line in the transformation process, and #28, #39 and #46 represent three transformed lines, respectively. Figure 6 Figure 7 is the expression detection of positive lines, wherein Fielder is the transgenic receptor variety, EV represents the negative line in the transformation process, and #28, #39 and #46 represent three transformed lines, respectively. The scale is 1 cm. The upper and lower parts of the figure are the front and side photos of the same ear, respectively. Figure 7 Figure 8 is the symptom spikelet rate (PSS) of the transgenic lines, wherein the number of inoculated and phenotyped spikelets of each transgenic line is greater than or equal to 7, the statistical analysis uses Student-t test, ns represents p>0.05, and *** represents p<0.001. Overexpression of TaNAE gene can reduce the scab ear rate from 70% to about 45%.

[0140] It should be noted that the above examples are only used to illustrate the technical solutions of the present application and not to limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the present application, and all of them should be covered in the scope of the present application.

[0141] SEQUENCE LISTING

[0142] SEQ ID NO: 1:

[0143]

[0144] SEQ ID NO: 2:

[0145] MAATRACLVVLVVALTFVCFDGRAAAAPATAGSLAQRRQEVQSLLRRLNKPALATIQSPDGDVIDCVHISKQPAFDHPLLKNHTIQMRPSYHPGGMYHNSNIATHPITQTWHQNGKCPKNTIPIRRTNEDDVLRASSVDRYGKKRPGSIPNISSINDPDTSNISSGHQYAIASSNVDKCHGTKATFNLWQPTIGRANDFSLTQLWIVGGSYEGNDLNTIEAGWQVYPNFYKDNNPRLFIYWTRDAYKSTGCYNLKCSGFVQTNNQIAIGGTLSPVSTYDGAQYDFDILVWKDPKEGNWWLQMGSDYVGYWPSSIFTYLADSASTIQWGGEIASSDLGQTSTDMGSGHFPEEGFGKASHVKNIQVVDSSNILKPPSDVTTIAGQRSCYNVHNGISDNLGTYIFYGGPGKNSNCP

[0146] SEQ ID NO: 3:

[0147]

Claims

1. Use of overexpression of a gene TaNAE for substantially increasing resistance to wheat scab, characterized in that The nucleotide sequence of the gene is shown as SEQ ID No. 1; The TaNAE amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 2; TaNAE amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 2; The TaNAE TaNAE The nucleotide sequence of the recombinant vector of the gene is shown as SEQ ID No. 3, which is obtained by inserting the nucleotide sequence of SEQ ID No. 1 between the restriction enzymes HindIII and BamHI of the polyclonal site of pCambia3300 backbone vector.

Citation Information

Patent Citations

  • Gene TaLAC58 capable of improving disease resistance of wheat scab and application of gene TaLAC58

    CN118516379A