Method for rapidly constructing single plasmid T7 expression system

Abstract

The invention provides a method for constructing a T7RNAP expression unit, which comprises the following steps: inserting the designed T7RNAP expression unit into a test plasmid to express T7RNAP in a host cell, then determining the enzyme activity E of the T7RNAP expressed by the plasmid, and if the enzyme activity E is determined to be Elt, determining the enzyme activity E of the T7RNAP expressed by the plasmid; if the threshold value of the T7RNAP enzyme activity in the host cell is E0, successfully constructing a T7RNAP expression unit, if E is judged to be greater than or equal to E0, adjusting the DNA structure of the designed T7RNAP expression unit, and repeating the steps until Elt is judged; if E0 is greater than E0, successfully constructing a T7RNAP expression unit, and finally selecting the plasmid of which the enzyme activity of the T7RNAP is lower than the E0 value. The invention also provides a method for adjusting the DNA structure of the designed T7RNAP expression unit in the above steps. The method for constructing the T7RNAP expression unit has the characteristics of predictability, rapidness, customization and the like, so that the problems that a conventional single plasmid T7 expression system cannot be constructed, the construction period is long and the system is easy to mutate are solved, and a convenient method is provided for utilizing the T7 expression system by a non-model strain.

Description

Technical Field

[0001] The present application belongs to the field of genetic engineering and analysis and detection, and relates to a method for constructing a single-plasmid T7 expression system, and specifically, to a method for constructing a T7 RNAP expression unit, and a method for adjusting the DNA structure of a designed T7 RNAP expression unit to successfully construct a T7 RNAP expression unit. That is, the present application provides 1. a method for predicting the upper limit value of the T7 RNAP content (activity) that can successfully construct a single-plasmid T7 expression system in Escherichia coli; 2. a method for predicting the upper limit value of the T7 RNAP content (activity) that can successfully construct a single-plasmid T7 expression system in a host bacterium (hereinafter referred to as a method for predicting the upper limit value of T7 RNAP lethality); 3. by detecting the activity of T7 RNAP, based on the upper limit value of the activity of T7 RNAP of each host, a method for quickly customizing the construction of a single-plasmid T7 expression system is provided. Background Art

[0002] The T7 expression system is an efficient expression system based on bacteriophage T7 RNA polymerase (T7 RNAP), which can achieve high-level protein expression. It is mainly composed of two elements: T7 promoter and T7 RNAP. The most important feature of this system is that T7 RNAP has super strong activity and is highly specific to the T7 promoter, thereby guiding the high-level transcription of genes downstream of the T7 promoter. In addition, the system has simple genetic manipulation, rigorous gene regulation, and is easy to operate. Therefore, it is widely used in synthetic biology, metabolic engineering, biomedicine, enzyme engineering, RNA synthesis, mRNA vaccines and other fields.

[0003] For a long time, researchers have hoped to place the T7 RNAP expression gene element (referred to as the "T7 RNAP expression unit" in this patent) and the T7 promoter and its downstream transcribed gene (referred to as the "T7 promoter transcription unit" in this patent) on the same plasmid, which can not only construct an orthogonal transcription system that is common to different hosts, but also eliminate the operation of integrating the T7 RNAP gene into the host genome. Studies have shown that due to the high transcriptional activity of T7 RNAP, placing the T7 RNAP gene and the T7 promoter on the same plasmid often causes the death of the host bacteria. Many attempts have failed due to the inability to construct the correct plasmid (Davanloo, P., et al., cloning and expression of the gene for bacteriophage-t7 rna-polymerase. Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences, 1984. 81(7): p. 2035-2039; Ting, W.-W., S.-I. Tan, and ISNg, Development of chromosome-based T7 RNA polymerase and orthogonal T7 promoter circuit in Escherichia coli W3110 as a cell factory. Bioresources and Bioprocessing, 2020. 7(1).). This is because compared with the integration into the genome, the number of copies of the T7 RNAP gene located on the plasmid is greatly increased, and the expression of the T7 RNAP protein is also doubled. A large amount of T7 After RNAP recognizes the T7 promoter, it transcribes the target gene with high activity, excessively occupying the host's resources for synthesizing mRNA and protein, leading to host death (Davanloo, 1984; Chen, ZH and TD Schneider, Comparative analysis of tandem T7-like promoter containing regions in enterobacterial genomes reveals a novel group of genetic islands. Nucleic Acids Research, 2006. 34(4): p. 1133-1147).

[0004] In order to construct a host-independent single-plasmid T7 expression system to facilitate the application of the T7 expression system in different hosts, this patent develops a method for rapidly constructing a single-plasmid T7 expression system based on the modular concept of synthetic biology. According to the different characteristics of various hosts, a single-plasmid T7 expression system is rapidly constructed to realize the application of the T7 expression system in the host, greatly simplifying the operation process of constructing the single-plasmid T7 expression system. Summary of the Invention

[0005] Based on this, in view of the problems that the application process of the T7 expression system in non-model hosts is relatively complex in the prior art, and the construction process of the single-plasmid T7 expression system is time-consuming and has a low success rate, this application provides a method for rapidly constructing a single-plasmid T7 expression system in a host considering the characteristics of different hosts and targeting the personalized characteristics of the host. The method provided by this application can more rapidly construct a single-plasmid T7 expression system in Gram-negative bacteria and Gram-positive bacteria to express foreign proteins. In addition, this application also provides a method for predicting the lethal upper limit value of T7 RNAP in a host. The lethal upper limit value prediction method provided by this application can effectively predict the upper limit value of the activity of T7 RNAP in each host cell that can enable the successful construction and survival of the T7 expression system, thereby guiding the rapid construction of the single-plasmid T7 expression system therein.

[0006] Specifically, this application relates to the following content:

[0007] 1. A method for constructing a T7 RNAP expression unit, which includes the following steps:

[0008] a. Design a T7 RNAP expression unit;

[0009] b. Insert the designed T7 RNAP expression unit into a test plasmid;

[0010] c. Express T7 RNAP in a host cell using the test plasmid;

[0011] d. Measure the activity E of T7 RNAP expressed by the test plasmid;

[0012] e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell;

[0013] f1. If E < E0, then the T7 RNAP expression unit is successfully constructed;

[0014] f2. If E ≥ E0, then adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b - e until it is determined that E < E0, then the T7 RNAP expression unit is successfully constructed;

[0015] g. Select the plasmid whose T7 RNAP activity is lower than the E0 value.

[0016] 2. The method according to item 1, wherein the T7 RNAP expression unit comprises: a promoter sequence, an RBS sequence, a T7 RNAP encoding gene, and a terminator sequence.

[0017] 3. The method according to item 1, wherein in step f2, the method for adjusting the DNA structure of the designed T7 RNAP expression unit is selected from any one or more of the following to reduce the expression amount and expression activity of T7 RNAP:

[0018] Change the promoter,

[0019] Mutation promoter,

[0020] Design RBS structure,

[0021] Changing the distance from the RBS to the start codon of the T7 RNAP encoding gene,

[0022] Changing the codons in the T7 RNAP encoding gene to rare codons,

[0023] Change the terminator of the T7 RNAP encoding gene,

[0024] Change the plasmid copy number,

[0025] Design antisense RNA to inhibit T7 RNAP expression,

[0026] Insert a sequence that can reduce the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit.

[0027] Insert a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit, or

[0028] Mutation of the T7 RNAP encoding gene.

[0029] 4. The method according to item 1, wherein the test plasmid is selected from: pUC-type high copy plasmid, pET-type medium copy plasmid, pBBRMCS-type broad host plasmid, pBL-type low copy plasmid, pYE plasmid, pYC plasmid, pRS plasmid or PGEX plasmid.

[0030] 5. The method according to item 1, wherein the host cell is selected from: Gram-negative bacteria or Gram-positive bacteria; preferably, Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Pseudomonas, Bacillus licheniformis, Sinorhizobium, Tatum or strict halophile.

[0031] 6. The method according to item 1, wherein the method for determining T7 RNAP activity is the TX-TL detection method.

[0032] 7. The method according to item 1, wherein the threshold value E0 of T7 RNAP activity in the host cell is: 2.1 to 5.1 U·OD in Gram-negative bacteria 600 -1 μL -1 ; In Gram-positive bacteria, 1.3 to 3.7 U·OD 600 -1 μL -1 .

[0033] 8. The method according to item 3, wherein changing the promoter refers to: changing the original promoter to the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter or J23112 promoter.

[0034] 9. The method according to item 3, wherein the mutant promoter refers to: insertion, deletion or replacement of nucleotides in the original promoter sequence.

[0035] 10. The method according to item 3, wherein designing the RBS structure refers to: predicting the RBS translation efficiency by RBS calculator software.

[0036] 11. The method according to item 3, wherein changing the distance from RBS to the start codon of the T7 RNAP encoding gene means: adjusting the distance from RBS to the start codon of the T7 RNAP encoding gene within the following range: 0 to 60 bp, preferably 7 to 40 bp.

[0037] 12. The method according to item 3, wherein changing the codons in the T7 RNAP encoding gene to rare codons means: changing the codons in the T7 RNAP encoding gene to rare codons with a usage frequency in the range of 0% to 10%, preferably in the range of 0% to 2%.

[0038] 13. The method according to item 3, wherein changing the terminator of the T7 RNAP encoding gene refers to: changing the terminator of the T7 RNAP encoding gene to a terminator with an RNA polymerase termination efficiency ranging from 40-99%.

[0039] 14. The method according to claim 3, wherein changing the plasmid copy number refers to: reducing the plasmid copy number, for example, reducing the copy number by 10%, by 20%, by 30%, by 40%, by 50%, by 60%, by 70%, by 80%, by 90%, by 95%, preferably to any integer between 700-1.

[0040] 15. The method according to item 3, wherein designing the antisense RNA for inhibiting the expression of T7 RNAP comprises: inserting a module for expressing the T7 RNAP antisense gene into the T7 RNAP expression plasmid.

[0041] 16. The method according to item 3, wherein inserting a sequence downstream of the promoter of the T7 RNAP expression unit that can lead to a decrease in the transcription intensity of T7 RNAP refers to inserting the following DNA sequence capable of binding to a repressor downstream of the promoter: lacO, TetO, a terminator sequence, a hairpin structure sequence, or a Poly T sequence of greater than or equal to 4 Ts.

[0042] 17. The method according to item 3, wherein inserting a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit refers to: inserting a reverse promoter downstream of the T7 RNAP expression unit.

[0043] 18. The method according to item 3, wherein the mutation of the T7 RNAP encoding gene refers to: inserting, deleting or replacing nucleotides in the original T7 RNAP encoding gene.

[0044] 19. A method for adjusting the DNA structure of the T7 RNAP expression unit, comprising any one or two or more of the following:

[0045] Change the promoter,

[0046] Mutation promoter,

[0047] Design RBS structure,

[0048] Changing the distance from the RBS to the start codon of the T7 RNAP encoding gene,

[0049] Changing the codons in the T7 RNAP encoding gene to rare codons,

[0050] Change the terminator of the T7 RNAP encoding gene,

[0051] Change the plasmid copy number,

[0052] Design antisense RNA to inhibit T7 RNAP expression,

[0053] Insert a sequence that can reduce the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit.

[0054] Insert a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit, or

[0055] Mutation of the T7 RNAP encoding gene.

[0056] 20. The method according to item 19, wherein changing the promoter refers to: changing the original promoter to the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter or J23112 promoter.

[0057] 21. The method according to item 19, wherein the mutant promoter refers to: insertion, deletion or substitution of nucleotides in the original promoter sequence.

[0058] 22. The method according to item 19, wherein designing the RBS structure refers to: predicting the RBS translation efficiency by RBS calculator software.

[0059] 23. The method according to item 19, wherein changing the distance from RBS to the start codon of the T7 RNAP encoding gene refers to adjusting the distance from RBS to the start codon of the T7 RNAP encoding gene within the following range: 0 to 60 bp, preferably 7 to 40 bp.

[0060] 24. The method according to item 19, wherein changing the codons in the T7 RNAP encoding gene to rare codons means: changing the codons in the T7 RNAP encoding gene to rare codons with a usage frequency in the range of 0% to 10%, preferably in the range of 0% to 2%.

[0061] 25. The method according to item 19, wherein changing the terminator of the T7 RNAP encoding gene refers to: changing the terminator of the T7 RNAP encoding gene to a terminator with an RNA polymerase termination efficiency ranging from 40-99%.

[0062] 26. A method according to claim 19, wherein changing the plasmid copy number refers to: reducing the plasmid copy number, for example, reducing the copy number by 10%, by 20%, by 30%, by 40%, by 50%, by 60%, by 70%, by 80%, by 90%, by 95%, preferably to any integer between 700-1.

[0063] 27. The method according to item 19, wherein designing the antisense RNA for inhibiting the expression of T7 RNAP comprises: inserting a module for expressing the T7 RNAP antisense gene into the T7 RNAP expression plasmid.

[0064] 28. The method according to item 19, wherein inserting a sequence downstream of the promoter of the T7 RNAP expression unit that can lead to a decrease in the transcription intensity of T7 RNAP refers to: inserting the following DNA sequence capable of binding to a repressor downstream of the promoter: lacO, TetO, a terminator sequence, a hairpin structure sequence, or a Poly T sequence of greater than or equal to 4 Ts.

[0065] 29. The method according to item 19, wherein inserting a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit refers to: inserting a reverse promoter downstream of the T7 RNAP expression unit.

[0066] 30. The method according to item 19, wherein the mutation of the T7 RNAP encoding gene refers to: inserting, deleting or replacing nucleotides in the original T7 RNAP encoding gene.

[0067] Beneficial Effects

[0068] By establishing a method for predicting the upper limit of T7 RNAP activity, the upper limit of T7 RNAP activity that can be tolerated during the construction of the single-plasmid T7 expression system of each host is detected, providing guidance and basis for the next step of accurately constructing the single-plasmid T7 expression system; this method has a large adjustable range and can effectively detect the upper limit of T7 RNAP activity in different hosts.

[0069] The present application provides a method for rapid and customized construction of a single-plasmid T7 expression system, which has the characteristics of predictability, rapidity, and customization, thereby solving the problems of the previous single-plasmid T7 expression system being unable to be constructed, having a long construction cycle, and the system being prone to mutation, and providing a convenient method for non-model strains to utilize the T7 expression system. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 This is a schematic diagram of the process of predicting the upper lethal limit of T7 RNAP activity in the present application.

[0071] Figure 2 The upper limit value detection result of T7RNAP activity of the single plasmid T7 expression system constructed by the Escherichia coli DH5α host of the present application.

[0072] Figure 3 Schematic diagram of the construction process of the single plasmid T7 expression system of this application.

[0073] Figure 4 This is a logic diagram for the rapid construction of a single-plasmid T7 expression system for this application.

[0074] Figure 5 A single plasmid T7 expression system of Escherichia coli DH5α was constructed to regulate the distance from RBS to ATG of T7 RNAP gene.

[0075] Figure 6 To construct a single plasmid T7 expression system of Escherichia coli DH5α using promoters of different strengths.

[0076] Figure 7To construct a single plasmid T7 expression system of Escherichia coli DH5α using a mutant promoter.

[0077] Figure 8 To construct a single plasmid T7 expression system of Escherichia coli DH5α by inserting a terminator sequence.

[0078] Fig. 9 To construct a single plasmid T7 expression system of Escherichia coli DH5α using codon preference.

[0079] Fig.10 To construct a single plasmid T7 expression system of Escherichia coli DH5α by mutating the T7 RNAP gene.

[0080] Fig.11 To construct a single plasmid T7 expression system of E. Coli DH5α using transcriptional interference (inserting reverse promoters with different strengths).

[0081] Fig.12 To construct a single plasmid T7 expression system of B. subtilis 168 by promoter mutation and RBS distance.

[0082] Fig.13 To construct a single plasmid T7 expression system of B. subtilis 168 by promoter modification and inserting a terminator sequence downstream.

[0083] Fig.14 For the expression of fluorescent proteins in single plasmid T7 expression systems of different host bacteria. Detailed implementation manners

[0084] On the one hand, the present application provides a method for constructing a T7 RNAP expression unit, which includes the following steps: a. Designing a T7 RNAP expression unit; b. Inserting the designed T7 RNAP expression unit into a test plasmid; c. Expressing T7 RNAP in a host cell with the test plasmid; d. Measuring the activity E of T7 RNAP expressed by the test plasmid; e. Determining whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f1. If E < E0, the T7 RNAP expression unit is successfully constructed; f2. If E ≥ E0, adjusting the DNA structure of the designed T7 RNAP expression unit and repeating steps b - e until it is determined that E < E0, then the T7 RNAP expression unit is successfully constructed; g. Selecting the plasmid with the T7 RNAP activity lower than the E0 value.

[0085] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Designing a T7 RNAP expression unit; b. Inserting the designed T7 RNAP expression unit into a test plasmid; c. Expressing T7 RNAP in a host cell using the test plasmid; d. Measuring the activity E of the T7 RNAP expressed by the test plasmid; e. Determining whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjusting the DNA structure of the designed T7 RNAP expression unit and repeating steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Selecting the plasmid with a T7 RNAP activity lower than the E0 value.

[0086] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Designing a T7 RNAP expression unit; b. Inserting the designed T7 RNAP expression unit into a test plasmid; c. Expressing T7 RNAP in a host cell using the test plasmid; d. Measuring the activity E of the T7 RNAP expressed by the test plasmid; e. Determining whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjusting the DNA structure of the designed T7 RNAP expression unit and repeating steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Selecting the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the promoter to reduce the expression level and expression activity of T7 RNAP. Changing the promoter means changing the original promoter to the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter or J23112 promoter. The promoter may be a promoter for expressing proteins in an organism, but is not limited to the above promoters.

[0087] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit can be: mutating the promoter. The purpose is to reduce the transcriptional intensity of the promoter, thereby reducing the expression level and activity of T7 RNAP. Mutating the promoter means: inserting, deleting, or substituting nucleotides in the original promoter sequence. Preferably, the lacUV5 promoter is mutated into the promoter shown in the following sequences: SEQ ID NO.1: TTTACACTTTATGCTTCCGGCTCGTAAAGTG, SEQ ID NO.2: TTTACACTTTATGCTTCCGGCTCGTAGTGTG, or SEQ ID NO.3: TTTACACTTTATGCTTCCGGCTCGTAACGTG.

[0088] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in a host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: designing an RBS structure to reduce the expression level and expression activity of T7 RNAP. Designing an RBS structure means predicting the RBS translation efficiency through RBS calculator software (Salis, H.M., Mirsky, E.A., & Voigt, C.A. (2009). Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology, 27(10), 946–950.). The software may use various software capable of predicting the RBS translation efficiency, but is not limited to this software.

[0089] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Designing a T7 RNAP expression unit; b. Inserting the designed T7 RNAP expression unit into a test plasmid; c. Expressing T7 RNAP in a host cell with the test plasmid; d. Measuring the activity E of T7 RNAP expressed by the test plasmid; e. Determining whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjusting the DNA structure of the designed T7 RNAP expression unit and repeating steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Selecting the plasmid with the T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the distance from the RBS to the start codon of the T7RNAP coding gene. The aim is to reduce the RBS translation efficiency, thereby reducing the expression level and expression activity of T7 RNAP. Changing the distance from the RBS to the start codon of the T7 RNAP coding gene means: adjusting the distance from the RBS to the start codon of the T7 RNAP coding gene within the following range: 0 to 60 bp, preferably 7 to 40 bp. For example, adjusting the distance from the RBS to the start codon of the T7 RNAP coding gene to distances of: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 bp.

[0090] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the codons in the T7 RNAP coding gene to rare codons. The purpose is to reduce the expression level and expression activity of T7 RNAP. Changing the codons in the T7 RNAP coding gene to rare codons means: changing the codons in the T7 RNAP coding gene to rare codons with a usage frequency in the range of 0% - 10%, preferably in the range of 0% - 2%. For example, the usage frequency of the rare codon may be 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%.

[0091] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the terminator of the T7 RNAP coding gene. The purpose is to reduce the expression level and expression activity of T7 RNAP. Changing the terminator of the T7 RNAP coding gene means: changing the terminator of the T7 RNAP coding gene to a terminator with a termination efficiency range of 40 - 99% for RNA polymerase. For example, changing it to a terminator with a termination efficiency range of 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% for RNA polymerase.

[0092] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Designing a T7 RNAP expression unit; b. Inserting the designed T7 RNAP expression unit into a test plasmid; c. Expressing T7 RNAP in the host cell using the test plasmid; d. Measuring the activity E of the T7 RNAP expressed by the test plasmid; e. Determining whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjusting the DNA structure of the designed T7 RNAP expression unit, and repeating steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Selecting the plasmid with the T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the plasmid copy number. The purpose is to reduce the T7 RNAP expression level and expression activity. Changing the plasmid copy number means: reducing the plasmid copy number, for example, reducing the copy number by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, preferably reducing it to any integer between 700 and 1. For example, changing the pUC plasmid with a copy number between 500 and 700 to a pET or pBBRMCS plasmid with a copy number between 40 and 50, or a pBL plasmid with a copy number between 1 and 3.

[0093] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell with the test plasmid; d. Determine the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with the T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: designing an antisense RNA that inhibits the expression of T7 RNAP. The purpose is to reduce the expression level and expression activity of T7 RNAP. Designing an antisense RNA that inhibits the expression of T7 RNAP means: inserting a module that expresses the antisense gene of T7 RNAP into the T7 RNAP expression plasmid. The module that expresses the antisense gene of T7 RNAP may be composed of a promoter sequence, an antisense RNA sequence of the T7 RNAP gene, and a terminator sequence. The promoter sequence and the terminator sequence are any promoter that can express proteins in an organism or a terminator that terminates the expression of proteins. The antisense RNA sequence includes an RNA sequence that is antisense to the DNA sequence within 20 bases before and after the promoter sequence, or an antisense RNA sequence that is antisense to the T7 RNAP gene and the DNA sequence within 20 bases upstream of the N-terminal sequence. The module that expresses the antisense gene of T7 RNAP can be inserted at any position in the T7 RNAP expression plasmid.

[0094] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in a host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: inserting a sequence that can cause a decrease in the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit. The aim is to reduce the expression level and expression activity of T7 RNAP. Inserting a sequence that can cause a decrease in the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit means: inserting the following DNA sequences that can bind to a repressor downstream of the promoter: lacO, TetO, a terminator sequence, a hairpin structure sequence, or a Poly T sequence with 4 or more Ts. For example, inserting a Poly T sequence with any one of 4, 5, 6, 7, 8, 9, 10 or more Ts that can bind to a repressor downstream of the promoter.

[0095] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: introducing a transcriptional interference structure downstream of the T7 RNAP expression unit that interferes with the transcription process of the T7 RNAP gene. The purpose is to reduce the expression level and expression activity of T7 RNAP. Inserting a transcriptional interference structure downstream of the T7 RNAP expression unit that interferes with the transcription process of the T7 RNAP gene means: inserting a reverse promoter downstream of the T7 RNAP expression unit, that is, introducing a (reverse) promoter opposite to the promoter for expressing T7 RNAP, to interfere with the expression level and expression activity of T7 RNAP.

[0096] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: mutating the T7 RNAP coding gene. The purpose is to reduce the expression level and expression activity of T7 RNAP. Mutating the T7 RNAP coding gene means: performing nucleotide insertion, deletion, or substitution on the original T7 RNAP coding gene.

[0097] In a specific embodiment of the present application, in the method for constructing a T7 RNAP expression unit, the method for adjusting the DNA structure of the designed T7 RNAP expression unit may be any one or two or more of the above specific embodiments.

[0098] In the above specific embodiment, T7 RNA polymerase (T7 RNAP) is a DNA-dependent 5'→3' RNA polymerase that highly specifically recognizes the T7 promoter sequence. The T7 RNAP expression unit comprises: a promoter sequence, an RBS sequence, a T7RNAP encoding gene, and a terminator sequence. Plasmid refers to a smaller DNA molecule that is attached to the non-cellular chromosome or nuclear region DNA in the cell and is capable of autonomous replication. Although most plasmids are circular in configuration, they exist in many bacteria and yeasts. The test plasmid is selected from: pUC high-copy plasmids, pET medium-copy plasmids, pBBRMCS broad-host plasmids, pBL low-copy plasmids, pYE plasmids, pYC plasmids, pRS plasmids or PGEX plasmids. The test plasmid can also be any plasmid known in the art that is suitable for use as a test plasmid. It can also be: a plasmid used for transfer into Gram-negative bacteria or Gram-positive bacteria, but is not limited to the above plasmids. The host cell is selected from: Gram-negative bacteria or Gram-positive bacteria; preferably, Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Pseudomonas, Bacillus licheniformis, Sinorhizobium, Tatum or strict halophilic bacteria. Gram-negative bacteria include but are not limited to: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Silvae, Neisseria, Pseudomonas, Salmonella, and Ureaplasma. Gram-positive bacteria include but are not limited to: Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus and Streptomyces. The method for determining T7 RNAP activity is the TX-TL detection method. The threshold value E0 of T7 RNAP activity in the host cell: in Gram-negative bacteria, it is 2.1~5.1U·OD 600 -1 μL -1 ; In Gram-positive bacteria, 1.3 to 3.7 U·OD 600 -1 μL -1. A promoter refers to a DNA sequence located in the 5' upstream region of a structural gene, which can activate RNA polymerase, allowing it to accurately bind to the template DNA and have the specificity of transcription initiation. The ribosome binding site (RBS) is a segment of the 5' (upstream) of the mRNA molecule, which can bind to the ribosome and correctly locate it to the translation initiation site, and can also control the accuracy and efficiency of the initiation of mRNA translation. In prokaryotic mRNA, the RBS is located 8-13 nucleotides upstream of the start codon (i.e., the first AUG). The transcribed mRNA achieves the recruitment and binding of ribosomes through the 5' end RBS sequence, further realizing the gene translation process. Therefore, the strength of RBS directly affects the binding efficiency of ribosomes and determines the translation efficiency to a certain extent. The terminator is a DNA sequence that gives RNA polymerase a transcription termination signal. One type can achieve termination without relying on protein cofactors. The other type relies on protein cofactors to achieve termination. Coding genes refer to the coding regions of structural genes. Coding genes are the part of messenger RNA that can transcribe, and it can synthesize the corresponding protein. Gene mutation refers to the change of certain bases or sequences in genomic DNA molecules. Substitution refers to the replacement of a base in a DNA molecule by another different base. Base substitution leads to changes in codons in mRNA, affecting amino acids in polypeptide chains, and may have several different effects. Insertion or deletion refers to the insertion (addition) or deletion of one or several bases in the DNA coding sequence, which changes the downstream reading frame, resulting in abnormal or inactive amino acid sequence and protein, or causes the peptide chain to increase or decrease one or several amino acids but the amino acids after the insertion or deletion point remain unchanged. Rare codons refer to the fact that due to the degeneracy of codons, each amino acid corresponds to at least one codon, and at most one amino acid can correspond to six codons. However, the frequencies of use of these different codons encoding the same amino acid in different species and different organisms are not completely evenly distributed, that is, most organisms tend to use only a part of these codons, a phenomenon also called codon preference. Among them, those codons that are used most frequently are called optimal codons, and those codons that are not often used are called rare codons or low-utilization codons.

[0099] On the one hand, the present application provides a method for adjusting the DNA structure of the T7 RNAP expression unit, which comprises: changing the promoter, mutating the promoter, designing the RBS structure, changing the distance from the RBS to the start codon of the T7 RNAP encoding gene, adjusting the usage frequency of rare codons in the T7 RNAP encoding gene, adjusting the terminator structure and / or position of the T7 RNAP encoding gene, changing the plasmid copy number, designing an antisense RNA that inhibits the expression of T7 RNAP, inserting a repressor sequence that can reduce the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit, introducing a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit, or mutating the T7 RNAP encoding gene.

[0100] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: changing the promoter. To reduce the expression amount and expression activity of T7 RNAP. Changing the promoter means: changing the original promoter to the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter or J23112 promoter. The promoter can be a promoter for expressing proteins in organisms, but is not limited to the above promoters.

[0101] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: mutating the promoter. The purpose is to reduce the transcription intensity of the promoter, thereby reducing the expression amount and expression activity of T7 RNAP. Mutating the promoter means: inserting, deleting or replacing nucleotides in the original promoter sequence. Preferably, the lacUV5 promoter is mutated to the promoter shown in the following sequence: SEQ ID NO.1: TTTACACTTTATGCTTCCGGCTCGTAAAGTG, SEQ ID NO.2: TTTACACTTTATGCTTCCGGCTCGTAGTGTG or SEQ ID NO.3: TTTACACTTTATGCTTCCGGCTCGTAACGTG.

[0102] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: designing an RBS structure. To reduce the expression amount and expression activity of T7 RNAP. Designing an RBS structure means: predicting the RBS translation efficiency by RBS calculator software. The software can use a variety of software that can predict the RBS translation efficiency, but is not limited to this software.

[0103] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: changing the distance from RBS to the start codon of the T7 RNAP encoding gene. The purpose is to reduce the translation efficiency of RBS, thereby reducing the expression amount and expression activity of T7 RNAP. Changing the distance from RBS to the start codon of the T7 RNAP encoding gene means: adjusting the distance from RBS to the start codon of the T7 RNAP encoding gene within the following range: 0 to 60 bp, preferably 7 to 40 bp. For example, the distance from RBS to the start codon of the T7 RNAP encoding gene is adjusted to: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 bp.

[0104] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: replacing the codons in the T7 RNAP encoding gene with rare codons. The purpose is to reduce the expression amount and expression activity of T7 RNAP. Changing the codons in the T7 RNAP encoding gene to rare codons means: changing the codons in the T7 RNAP encoding gene to rare codons with a usage frequency in the range of 0% to 10%, preferably in the range of 0% to 2%. For example, the usage frequency of rare codons may be 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%.

[0105] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: changing the terminator of the T7 RNAP encoding gene. The purpose is to reduce the expression amount and expression activity of T7 RNAP. Changing the terminator of the T7 RNAP encoding gene means: changing the terminator of the T7 RNAP encoding gene to a terminator with an RNA polymerase termination efficiency in the range of 40-99%. For example, changing to a terminator with an RNA polymerase termination efficiency in the range of 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0106] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: changing the plasmid copy number. The purpose is to reduce the expression amount and expression activity of T7 RNAP. Changing the plasmid copy number means: reducing the plasmid copy number, for example, reducing the copy number by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, preferably reducing it to any integer between 700-1. For example, a pUC-type plasmid with a copy number of 500 to 700 is changed to a pET and pBBRMCS-type plasmid with a copy number of 40 to 50, or a pBL-type plasmid with a copy number of 1-3.

[0107] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: designing antisense RNA that inhibits the expression of T7 RNAP. The purpose is to reduce the expression amount and expression activity of T7 RNAP. Designing antisense RNA that inhibits the expression of T7 RNAP means: inserting a module expressing the T7 RNAP antisense gene into the T7 RNAP expression plasmid. The module expressing the T7 RNAP antisense gene can be composed of a promoter sequence, an antisense RNA sequence of the T7 RNAP gene, and a terminator sequence. The promoter sequence and the terminator sequence are any promoters that can express proteins in organisms or terminators that terminate the expression of proteins. The antisense RNA sequence includes an RNA sequence that is antisense to the promoter sequence and the DNA sequence within 20 bases before and after, or an antisense RNA sequence within 20 bases upstream of the T7 RNAP gene and the N-terminal sequence. The module expressing the T7 RNAP antisense gene can be inserted at any position of the T7 RNAP expression plasmid.

[0108] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: inserting a sequence that can cause a decrease in the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit. The purpose is to reduce the expression amount and expression activity of T7 RNAP. Inserting a sequence that can cause a decrease in the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit refers to: inserting the following DNA sequence that can bind to a repressor downstream of the promoter: lacO, TetO, a terminator sequence, a hairpin structure sequence, or a Poly T sequence of 4 or more Ts. For example, a Poly T sequence having any one of 4, 5, 6, 7, 8, 9, 10 or more that can bind to a repressor is inserted downstream of the promoter.

[0109] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: inserting a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit. The purpose is to reduce the expression amount and expression activity of T7 RNAP. Inserting a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit means: inserting a reverse promoter downstream of the T7 RNAP expression unit, that is, introducing a (reverse) promoter opposite to the expression T7 RNAP promoter, interfering with the expression amount and expression activity of T7 RNAP.

[0110] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: mutating the T7 RNAP encoding gene. The purpose is to reduce the expression amount and expression activity of T7 RNAP. Mutating the T7 RNAP encoding gene means: inserting, deleting or replacing nucleotides in the original T7 RNAP encoding gene.

[0111] In a specific embodiment of the present application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: any one or more of any one of the above specific embodiments.

[0112] In the above specific embodiment, T7 RNA polymerase (T7 RNAP) is a DNA-dependent 5'→3' RNA polymerase that highly specifically recognizes the T7 promoter sequence. The T7 RNAP expression unit comprises: a promoter sequence, an RBS sequence, a T7 RNAP encoding gene, and a terminator sequence. Plasmid refers to a smaller DNA molecule that is attached to the non-cellular chromosome or nuclear region DNA in the cell and can replicate autonomously. Although most plasmids are circular in configuration, they exist in many bacteria and yeasts. Promoter refers to a DNA sequence located in the 5' upstream region of the structural gene, which can activate RNA polymerase, accurately bind to the template DNA and have the specificity of transcription initiation. The ribosome binding site (RBS, Ribosome-binding site) is a segment of the 5' (upstream) of the mRNA molecule, which can bind to the ribosome and correctly locate to the translation start site, and can also control the accuracy and efficiency of the initiation of mRNA translation. In prokaryotic mRNA, RBS is located 8-13 nucleotides upstream of the start codon (i.e., the first AUG). The transcribed mRNA realizes the recruitment and binding of ribosomes through the 5' end RBS sequence, and further realizes the translation process of the gene. Therefore, the strength of RBS directly affects the binding efficiency of ribosomes and determines the translation efficiency to a certain extent. The terminator is a DNA sequence that gives RNA polymerase transcription termination signals. One type can achieve termination without relying on protein cofactors. The other type relies on protein cofactors to achieve termination. Coding genes refer to the coding regions of structural genes. Coding genes are able to transcribe the part of messenger RNA, which can synthesize the corresponding protein. Gene mutation refers to the change of certain bases or sequences in the genomic DNA molecule. Substitution refers to the replacement of a base in a DNA molecule by another different base. Base substitution leads to changes in codons in mRNA, affecting amino acids in the polypeptide chain, and may have several different effects. Insertion or deletion refers to the insertion (addition) or deletion of one or several bases in the DNA coding sequence, and the downstream reading frame changes, resulting in abnormal or inactive amino acid sequence and protein, or causing the peptide chain to increase or decrease one or several amino acids but the amino acids after the insertion or deletion point remain unchanged. Rare codons refer to the fact that due to the degeneracy of codons, each amino acid corresponds to at least one codon, and at most one amino acid can correspond to six codons. However, the frequencies of these different codons encoding the same amino acid in different species and different organisms are not completely evenly distributed, that is, most organisms tend to use only a part of these codons, a phenomenon also called codon preference. Among them, the codons that are used most frequently are called optimal codons, and those that are not often used are called rare codons or low-utilization codons.

[0113] Unless otherwise defined, technical and scientific terms used in this specification have the same meanings as those commonly understood by those skilled in the art. Although methods and materials similar or identical to those described herein may be used in experiments or practical applications, the materials and methods are described below. In the event of a conflict, the present specification, including definitions therein, shall prevail. In addition, the materials, methods, and examples are provided for illustration only and are not intended to be limiting.

[0114] Although various aspects and embodiments of the present application are disclosed herein, other aspects and embodiments are also obvious to those skilled in the art. Other methods that can change the expression amount and expression activity of T7 RNAP, as well as other methods of reducing the expression amount and expression activity of T7 RNAP by changing the DNA structure of the T7 RNAP expression unit are also included in the scope of the present application. The various aspects and embodiments disclosed herein are for illustrative purposes only, not for limiting purposes. The scope and subject matter of the present application are determined only by the appended claims.

[0115] The present application is further described below with reference to the accompanying drawings and specific examples.

[0116] Example

[0117] The T7 RNAP activity value is the key to successfully constructing a single-plasmid T7 expression system. If there is highly active T7 RNAP in the host cell, the constructed single-plasmid T7 expression system will easily cause a large consumption of host resources, making it impossible for the host cell to grow. Therefore, if the T7 RNAP activity in the host is very high, the single-plasmid T7 expression system cannot be successfully constructed. In order to improve the construction efficiency of the system and solve the problems of complex construction process, long cycle, and blind construction in the past, it is necessary to predict how much T7 RNAP amount (activity) each host bacteria can withstand during the construction of a single-plasmid T7 expression system. Therefore, this patent establishes a method for predicting the T7 RNAP activity threshold (lethal upper limit) ( Figure 1 ), taking E. coli DH5α as an example, design the experimental process ( Figure 1 ) Detect the upper limit of T7 RNAP lethality of the single-plasmid T7 expression system, (1) Design a test process for the upper limit of T7 RNAP lethality of the single-plasmid T7 expression system ( Figure 1), wherein the mCherry (red fluorescent protein) gene is used as a reporter gene in the T7 promoter transcription unit, and the lacI-lacO system is introduced upstream of the T7 RNAP gene to regulate the expression of T7 RNAP in a larger range so that it can be applied to other host bacteria. (2) By designing a promoter library, the mixed promoter fragments are inserted into the upstream of the lacO gene of the test plasmid through DNA ligase to initiate transcription of the downstream T7 RNAP gene. The resulting ligated sample is transformed into the Escherichia coli DH5α host cell. The T7 RNAP is higher than the upper limit and it is impossible to construct a correct single plasmid T7 expression system. Therefore, a strain with red fluorescent protein expression is selected, and after shaking flask culture, the red fluorescence intensity of mCherry of the host bacteria is sequenced and detected ( Figure 2 ), and at the same time, the T7 RNAP activity expressed by the corresponding strain without the plasmid of "T7 promoter transcription unit" was detected, and the highest T7 RNAP activity (4.67 U·OD 600 -1 μL -1 ) is the upper limit of T7 RNAP lethality of E. coli DH5α cells ( Figure 2 ). The test plasmid is further extracted to obtain a single plasmid T7 expression system test plasmid library for predicting the upper limit of T7 RNAP activity in other host bacteria. For different host systems, plasmids suitable for the host are used to determine the lethal upper limit of the T7 RNAP activity of the host according to the above steps.

[0118] Compared with the previous single-plasmid T7 expression system construction method, the single-plasmid T7 expression system constructed in this patent has the characteristics of quantification of T7 RNAP activity, customized design and construction for various hosts, fast construction speed, strong system stability, etc. The single-plasmid T7 expression system constructed in patent CN 201810175644 mainly controls the amount of T7 RNAP by antisense RNA as a regulatory means. The means of regulating the expression amount of T7 RNAP are single, and there is no corresponding range of T7 RNAP activity. It only qualitatively and speculatively gives that the T7 RNAP activity should be controlled at an appropriate value, but what is the appropriate value is not given. The novel idea of ​​the present application is to design and construct the DNA structure that affects the expression activity of T7 RNAP in the "T7 RNAP expression unit" on the plasmid (for example, the distance from RBS to ATG, promoter change or mutation, terminator structure or position, RBS structure, introduction of rare codons, change of plasmid copy number, introduction of antisense RNA unit, introduction of transcription interference structure, mutation of T7 RNAP gene, etc.), and quantitatively measure the activity of the expressed T7 RNAP. If the T7 RNAP activity E is within the range of 0 to E0 (the E0 values ​​of different host bacteria are shown in Table 1), the "T7 promoter transcription unit" is directly introduced into the plasmid, and a single-plasmid T7 expression system can be directly constructed in the corresponding host. If the T7 RNAP activity is not within the range of 0 to E0, the DNA structure in the "T7 RNAP expression unit" (e.g., the distance from RBS to ATG, promoter changes or mutations, terminator structure or position, RBS structure, introduction of rare codons, change of plasmid copy number, introduction of antisense RNA unit, introduction of transcription interference structure, mutation of T7 RNAP gene, etc.) is adjusted in a targeted manner ( Figure 4 , Table 2), quickly construct plasmids so that the T7 RNAP activity expressed by the plasmids in the host falls within the range of 0-E0, and then introduce the "T7 promoter unit" to directly construct a single plasmid T7 expression system. The above construction process is as follows Figure 3 As shown, the single plasmid T7 expression system plasmid contains two parts: "T7 RNAP expression unit" and "T7 promoter transcription unit", wherein the "T7 RNAP expression unit" contains the promoter sequence, RBS sequence, T7 RNAP gene sequence, and terminator sequence. The "T7 promoter transcription unit" contains the T7 promoter sequence, RBS sequence, target gene sequence, and terminator sequence.

[0119] Table 1 E0 values ​​of different host strains

[0120]

[0121]

[0122] Note: The activity of T7 RNAP is defined as: under the conditions of 37℃, pH=8.0, unit volume, unit OD 600 of bacterial solution within 1 hour to make 1nmol of [ 3 The amount of enzyme required for the incorporation of H]GMP into the oligonucleotide fragment is defined as 1 activity concentration (U·OD 600 -1 μL -1 ). [Reference for activity definition: Reisbig, RR, Woody, AY, & Woody, RW (1979). Spectroscopic analysis of the interaction of Escherichia coli DNA-dependentRNA polymerase with T7 DNA and synthetic polynucleotides. Journal of Biological Chemistry, 254(22),11208–11217. https: / / doi.org / 10.1016 / S0021-9258(19)86471-2].

[0123] Table 2 DNA structure adjustment method of test plasmid "T7 RNAP expression unit"

[0124]

[0125]

[0126] Note: The DNA structure adjustment method of "T7 RNAP expression unit" can be used in combination with one or more of the above methods.

[0127] Example 1. Changing the distance from RBS to the start codon ATG in the "T7 RNAP expression unit" to construct a single plasmid T7 expression system

[0128] Taking pUC-19 vector as an example, the T7 RNAP expression unit (lacUV5 promoter sequence, RBS sequence, T7 RNAP gene, T0 terminator sequence) was inserted into pUC-19 plasmid (Takara Code No: 3219) by Gibson ligation to construct the following: Figure 5 The pUC-19-test plasmid in the experiment was modified to change the distance from RBS to the ATG of the T7 RNAP encoding gene to obtain a series of recombinant plasmids with different T7 RNAP expression intensities ( Figure 5), RN (N represents the number of bases from the start codon ATG of the T7 RNAP encoding gene), expressed in E. coli DH5α cells, and the T7 RNAP enzyme activity expression in E. coli DH5α cells was determined by T7 RNAP enzyme activity detection method (TX-TL system detection method, literature Mingxin Cui, Okei Wong, Qiang Li, Wenya Wang, An Assay Method for Characterizing Bacteriophage T7 RNA Polymerase Activity by Transcription–Translation (TX-TL) System, The Journal of Biochemistry, 2023, mvad002, https: / / doi.org / 10.1093 / jb / mvad002.). Plasmids R7, R31, and R55 with T7 RNAP activity lower than E. coli DH5α E0 were selected, and T7 promoter transcription units (T7 promoter sequence, target gene sequence, T7 terminator sequence) were introduced by Gibson ligation. The sfGFP protein gene was used as the target gene to construct a single plasmid T7 expression system plasmid ( Figure 5 ) and transformed into E. coli DH5α cells. After shaking flask culture (growing at 37°C and 200 rpm for 12 h), green fluorescent protein was expressed in all the cells ( Figure 5 ), indicating that by adjusting the distance from RBS to ATG in the "T7 RNAP expression unit" and reducing the host T7 RNAP expression activity to below E0, the E. coli DH5α single-plasmid T7 expression system can be successfully constructed in E. coli DH5α cells.

[0129] Example 2. Construction of a single plasmid T7 expression system by changing promoters of different strengths in the "T7 RNAP expression unit"

[0130] Through the screening of promoter elements, a batch of promoters with different transcription strengths, lacUV5 (SEQ ID NO.4: TTTACACTTTATGCTTCCGGCTCGTATAATG), J23103 (SEQ ID NO.5: CTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGC), J23109 (SEQ ID NO.6: TTTACAGCTAGCTCAGTCCTAGGGACTGTGCTAGC), J23112 (SEQ ID NO.7: CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGC), and J23117 (SEQ ID NO.8: TTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGC) were selected. The promoter in the T7 RNAP expression unit was changed by Gibson connection to regulate the expression amount of the T7 RNAP gene in the pUC-19-test plasmid, and a series of recombinant plasmids with different T7 RNAP expression strengths were obtained. After being transformed into E. coli DH5α cells for culture, the expression of E. coli DH5α was determined. T7 RNAP enzyme activity in DH5α cells ( Figure 6 ), a plasmid with promoter J23112 whose enzyme activity was less than that of E.coli DH5α E0 was selected, and the T7 promoter transcription unit was introduced by Gibson ligation. The sfGFP protein gene was used as the target gene to construct a single-plasmid T7 expression system plasmid, which was then transformed into E.coli DH5α cells. After shaking flask culture (grown at 37°C and 200rpm for 12h), strong green fluorescent protein expression was observed ( Figure 6 ), indicating that a single E. coli DH5α plasmid T7 expression system can be successfully constructed by regulating T7 RNAP with different promoters.

[0131] Example 3. Constructing a single-plasmid T7 expression system by promoter mutation of the "T7 RNAP expression unit"

[0132] Taking the E. coli lacUV5 promoter as an example, the TAA base in the -10 region of the promoter was mutated, and the mutated promoter was connected to the upstream of the T7RNAP gene in the pUC-19-test plasmid by Gibson connection to obtain a series of recombinant plasmids with different T7 RNAP expression intensities. These plasmids were transferred into E. coli DH5α cells to express T7 RNAP, and the T7 RNAP enzyme activity in the cells was measured. Figure 7), lacUV5-2 (TAA mutation in -10 region was GTG), lacUV5-4 (TAA mutation in -10 region was ACG), and lacUV5-6 (TAA mutation in -10 region was TCT) plasmids with enzyme activity less than E0 of E.coli DH5α were selected, T7 promoter transcription unit was introduced by Gibson ligation, sfGFP protein gene was used as target gene, single plasmid T7 expression system plasmid was constructed, and transformed into E.coli DH5α cells. After shaking flask culture (grown at 37℃, 200rpm for 12h), the strains all expressed green fluorescent protein, indicating that the single plasmid T7 expression system of E.coli DH5α can be successfully constructed by regulating T7 RNAP gene by promoter mutation.

[0133] Example 4. Inserting a terminator that blocks transcription downstream of the promoter of the "T7 RNAP expression unit" to construct a single-plasmid T7 expression system

[0134] Based on the pUC-19 test plasmid, different terminator sequences were inserted into the downstream of the promoter by Gibson ligation to obtain a series of plasmids with different T7 RNAP expression intensities. After being transformed into E. coli DH5α cells for culture, the T7 RNAP enzyme activity in E. coli DH5α cells was determined. Figure 8 ), RBS-7 (inserted terminator sequence is SEQ ID NO.9: CTAGCAGGGCCTCTAAACGGGCCTTGAGGGGTTTTTTG), RBS-9 (inserted terminator sequence is SEQ ID NO. 10: ATAACCCCTTGGGGCCTCTAAACGGGCCTTGAGGGGTTTTTT), and RBS-10 (inserted terminator sequence is SEQ ID NO.11: AAAAAACGCCCGGCGGCAACCGAGCGTTCTG) plasmids with enzyme activity less than that of E0 of E. coli DH5α were selected, T7 promoter transcription unit was introduced by Gibson ligation, sfGFP protein gene was used as target gene, single plasmid T7 expression system plasmid was constructed, and transformed into E. coli DH5α cells. After shaking flask culture (grown at 37°C, 200 rpm for 12 h), the strains all expressed green fluorescent protein, indicating that inserting terminator sequence downstream of the promoter to regulate T7 RNAP gene can successfully construct E. coli DH5α single plasmid T7 expression system.

[0135] Example 5. Construction of a single plasmid T7 expression system by changing codons in the T7 RNAP encoding gene to rare codons with lower usage frequency

[0136] Based on the codon preference of E. coli, rare codons with lower usage frequency were selected to replace the codons in the T7RNAP gene ( Fig. 9 ), then synthesized (Genwis Sequencing Company) T7 RNAP genes containing different amounts of rare codons, replaced the T7 RNAP gene in the pUC-19-test plasmid by Gibson ligation, and constructed a series of T7 RNAP expression plasmids containing different rare codons. After being transferred into E. coli DH5α cells for culture, the T7 RNAP enzyme activity in the bacteria was determined ( Fig. 9 ), a T7 RNAP-3 test plasmid (T7 RNAP gene: the start codon ATG was replaced with TTG, i.e., SEQ ID NO.12: GAACAGTTGGCCCTTGAGCATGAGTCTTAC was replaced with SEQ ID NO.13: GAGCAACTAGCTCTAGAGCACGAGTCCTAC) with an enzyme activity less than that of E. coli DH5α was selected, and then a T7 promoter transcription unit was introduced by Gibson ligation, and the sfGFP protein gene was used as the target gene to construct a single-plasmid T7 expression system plasmid, which was then transformed into E. coli DH5α cells. After shaking flask culture (grown at 37°C and 200 rpm for 12 h), the strain had strong green fluorescent protein expression, indicating that the E. coli DH5α single-plasmid T7 expression system can be successfully constructed by replacing the codons of the T7 RNAP gene with codons with lower frequency to regulate the expression activity of the T7 RNAP gene.

[0137] Example 6. Mutation of T7 RNAP encoding gene to construct a single plasmid T7 expression system

[0138] By analyzing the structure of T7 RNAP protein, designing primers, mutating different amino acids of T7 RNAP gene by PCR, and then replacing T7 RNAP gene in pUC-19-test plasmid by Gibson ligation, a series of T7 RNAP gene test plasmids with mutations at different sites were constructed. After being transferred into E.coli DH5α cells for culture, the enzyme activity of T7 RNAP was determined. Fig.10), T7 RNAP-M2 (amino acid arginine at position 627 mutated to alanine) and T7 RNAP-M3 (serine at position 539 mutated to alanine) test plasmids with enzyme activity less than that of E. coli DH5α were selected, T7 promoter transcription unit was introduced, sfGFP protein gene was used as target gene, single-plasmid T7 expression system plasmid was constructed, and transformed into E. coli DH5α cells. After shaking flask culture (grown at 37°C, 200 rpm for 12 h), the strains all expressed strong green fluorescent protein, indicating that the single-plasmid T7 expression system of E. coli DH5α could be successfully constructed by changing the T7 RNAP activity by mutating the T7 RNAP gene.

[0139] Example 7. Construction of a single plasmid T7 expression system by inserting a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit

[0140] Insert a reverse promoter downstream of T7 RNAP to reduce the expression of T7 RNAP through transcriptional interference. Use Gibson ligation to insert reverse promoters of different strengths P1 (SEQ ID NO.14:TTGACATAAGCCTGTTCGGTTCGTAAACT), P2 (SEQ ID NO.15:TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGC), P3 (SEQ ID NO.16:TTTACACTTTATGCTTCCGGCTCGTATGATG), and P4 (SEQID NO.17:TTTACACTTTATGCTTCCGGCTCGTATGTTG) into the downstream of the T7 RNAP gene of the pUC-19-test plasmid to construct a series of test plasmids with different T7 RNAP expression strengths. After being transferred into E. coli DH5α cells for culture, the enzyme activity of T7 RNAP was determined ( Fig.11 ), P3 and P4 test plasmids with enzyme activity less than E0 of E.coliDH5α were selected, T7 promoter transcription unit was introduced, sfGFP protein gene was used as target gene, single plasmid T7 expression system plasmid was constructed, and transformed into E.coli DH5α cells. After shaking flask culture (grown at 37℃, 200rpm for 12h), all strains expressed green fluorescent protein, indicating that the single plasmid T7 expression system of E.coli DH5α can be successfully constructed by regulating the expression of T7 RNAP using transcription interference.

[0141] Example 8. Construction of a single plasmid T7 expression system by simultaneously mutating the promoter and adjusting the distance from the RBS to the start codon ATG

[0142] For some strains, changing the promoter or the distance from RBS to the ATG of the T7 RNAP gene alone cannot reduce the T7 RNAP activity to its E0 value, and a single plasmid independent expression system cannot be successfully constructed. However, the combination of promoter mutation and adjustment of the distance from RBS to ATG can reduce the T7 RNAP enzyme activity to below the E0 value of the strain. Taking B. subtilis 168 strain as an example, the pHT01 plasmid is used as the basic skeleton, and the T7 RNAP expression unit (P43 promoter sequence, RBS sequence, T7 RNAP encoding gene, T0 terminator sequence) is inserted into the pHT01 plasmid by Gibson connection to construct the following. Fig.12 The test plasmid was prepared by mutating the P43 promoter (mutating the -10 region AAA) and adjusting the distance between RBS and the ATG of the T7 RNAP gene to adjust the expression of T7 RNAP. The test plasmids with different T7 RNAP expression intensities were obtained and transformed into B. subtilis 168 cells. The enzyme activity of T7 RNAP expressed by the strain was determined. Fig.12 ). The P43-5-R40 (promoter -10 region mutated to GCG, RBS to T7 RNAP gene ATG distance of 40bp) test plasmid with enzyme activity less than E0 of B.subtilis 168 was selected, and the T7 promoter transcription unit was introduced. The sfGFP protein gene was used as the target gene to construct a single-plasmid T7 expression system plasmid, which was transformed into B.subtilis 168 cells. After shaking flask culture (grown at 37°C, 200rpm for 12h), the strain expressed green fluorescent protein, indicating that the expression amount of T7 RNAP can be adjusted by both promoter mutation and adjustment of the distance from RBS to the start codon ATG, and the B.subtilis 168 single-plasmid T7 expression system can be successfully constructed and the target protein can be expressed.

[0143] Example 9. Construction of a single plasmid expression system by simultaneously changing the promoter and inserting a terminator sequence downstream of the promoter and inserting a transcription interference structure downstream of the T7RNAP expression unit

[0144] The promoter elements PB1 (SEQ ID NO.18: TTGACAAATTGCAGTAGGCATGACAAAATGGACTCA), PB2 (SEQ ID NO.19:

[0145] The expression of T7 RNAP was weakened by inserting a terminator sequence (SEQ ID NO.21:TTGGGGCCTCTAAACGGGCCTTGAGGGGTTTTTT), and PB3 (SEQ ID NO.20:GGAGTTCTGAGAATTGGTATGCCTTATAAGTCCAATTAACAGTTGAAAACCTGCATAGGAGAGCTATGCGGGTTTTTTATTTTACATAATGATACATAATTTACCGAAACTTGCGGAACATAATTGAGGAATCATAGAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTAGT), and at the same time, a terminator sequence (SEQ ID NO.21:TTGGGGCCTCTAAACGGGCCTTGAGGGGTTTTTT) was inserted downstream of the promoter to weaken the expression of T7 RNAP. The test plasmid for RNAP expression intensity was transformed into B. subtilis 168 cells, and the expressed T7 RNAP enzyme activity was measured ( Fig.13 ). The PB2-RBS-5 test plasmid with an enzyme activity less than E0 of B.subtilis 168 was selected, and then the T7 promoter transcription unit was introduced, and the sfGFP protein gene was used as the target gene to construct a single-plasmid T7 expression system plasmid, which was transformed into B.subtilis 168 cells. After shaking flask culture (grown at 37°C and 200rpm for 12h), the strain expressed green fluorescent protein, indicating that the expression of T7 RNAP can be regulated by changing the promoter and inserting a terminator sequence downstream of the promoter and transcription interference, and the B.subtilis 168 single-plasmid T7 expression system can be successfully constructed.

[0146] Example 10. Construction of a single plasmid T7 expression system for non-E. coli hosts

[0147] We further selected a plasmid suitable for the host bacteria as a single plasmid T7 expression system construction vector, and used the sfGFP protein gene as the target gene. Figure 3The construction process shown in the figure was also used to successfully construct a single plasmid T7 expression system in E. coli BL21, E. coli JM109, E. coli Top10, E. coli S17, E. coli Nissle 1917, Tatumella morbirosei THVC01, C. glutamicum 13032, C. glutamicum RES167, B. subtilis 168, Sinorhizobium TH572, P. putida KT2440, Halomonas sp. THY01, Lactococcus lactis NZ9000, Bacillus licheniformis BL01, and Bacillus megaterium BM01. Fig.14 As shown, each strain expressed green fluorescent protein.

[0148] Sequence Listing

[0149]

Claims

1. A method for constructing a T7 RNAP expression unit, comprising the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f1. If E < E0, the T7 RNAP expression unit is successfully constructed; f2. If E ≥ E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E < E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value.

2. The method according to claim 1, wherein: The T7 RNAP expression unit contains: a promoter sequence, an RBS sequence, a T7 RNAP coding gene, and a terminator sequence.

3. The method according to claim 1, wherein: In step f2, the method for adjusting the DNA structure of the designed T7 RNAP expression unit is selected from any one or more of the following to reduce the expression level and expression activity of T7 RNAP: Changing the promoter, Mutating the promoter, Designing the RBS structure, Changing the distance from the RBS to the start codon of the T7 RNAP coding gene, Changing the codons in the T7 RNAP coding gene to rare codons, Changing the terminator of the T7 RNAP coding gene, Changing the plasmid copy number, Designing an antisense RNA that inhibits the expression of T7 RNAP, Inserting a sequence that can weaken the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit, Inserting a transcriptional interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit, or Mutating the T7 RNAP coding gene.

4. The method according to claim 1, wherein: The test plasmid is selected from: pUC - type high - copy plasmids, pET - type medium - copy plasmids, pBBRMCS - type broad - host plasmids, pBL - type low - copy plasmids, pYE plasmids, pYC plasmids, pRS plasmids, or PGEX plasmids.

5. The method according to claim 1, wherein: The host cell is selected from: Gram - negative bacteria or Gram - positive bacteria; preferably, Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Pseudomonas, Bacillus licheniformis, Sinorhizobium meliloti, Tatumella, or Haloferax volcanii.

6. The method according to claim 1, wherein: The method for measuring the T7 RNAP activity is the TX - TL detection method.

7. The method according to claim 1, wherein: The threshold value E0 of T7 RNAP activity in the host cell is 2.1 to 5.1 U·OD in Gram-negative bacteria. 600 -1 μL -1 ; In Gram-positive bacteria, 1.3 to 3.7 U·OD 600 -1 μL -1 .

8. The method according to claim 3, wherein changing the promoter means changing the original promoter to the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter, or J23112 promoter.

9. The method according to claim 3, wherein mutating the promoter means inserting, deleting, or substituting nucleotides in the original promoter sequence.

10. A method for adjusting the DNA structure of the T7 RNAP expression unit, comprising any one or more of the following: Changing the promoter, Mutating the promoter, Design RBS structure, Changing the distance from the RBS to the start codon of the T7 RNAP encoding gene, Changing the codons in the T7 RNAP encoding gene to rare codons, Change the terminator of the T7 RNAP encoding gene, Change the plasmid copy number, Design antisense RNA to inhibit T7 RNAP expression, Insert a sequence that can reduce the transcription intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit. Insert a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit, or Mutation of the T7 RNAP encoding gene.

Images