Adeno-associated virus vector for treating spinal cord injury and application thereof

Abstract

The invention discloses a recombinant nucleic acid molecule. The recombinant nucleic acid molecule comprises a promoter, a nucleic acid sequence for coding KCC2 protein and a polyadenylic acid sequence (namely polyA). The invention also discloses a recombinant adeno-associated virus, which comprises an AAV capsid and a vector genome, and the vector genome comprises the recombinant nucleic acid molecule. The invention also discloses the use of the recombinant adeno-associated virus for more effective treatment of spinal cord injury.

Description

Technical Field

[0001] The present invention relates to the field of biological treatment, and particularly to a recombinant adeno-associated virus vector for treating spinal cord injury and its application. Background Art

[0002] Spinal cord injury (SCI) is the most serious complication of spinal cord injury, which often leads to sensory and motor dysfunction of the limbs below the injured segment. The continued existence of pathogenic factors and the high incidence rate worldwide make SCI a serious threat to human health and also bring a heavy economic burden to society and families.

[0003] For SCI, the most prominent problem in current treatment is how to effectively reconstruct the neural circuits on both sides of the injury plane and restore the patient's limb movement and sensory functions. However, current SCI treatments are difficult to meet clinical needs and the requirements for neural circuit reconstruction. Small molecule drugs that have been marketed, such as glucocorticoid receptor agonists, phospholipase A inhibitors, α2-adrenergic receptor agonists, etc., are all aimed at the pathological cascade reactions secondary to primary SCI, and play anti-inflammatory, anti-ischemic, immune response inhibition and neuroprotective effects; surgical treatment is also aimed at secondary injuries, and is performed within 24 hours after the vital signs of SCI patients are stable, to reduce bleeding and remove necrotic tissue. Among the drugs under development, stem cell combined with neurotrophic factor therapy in phase II and III can only structurally reconstruct the neural circuits on both sides of the injury but cannot reconstruct the functional circuits. Although there are literature reports on the use of recombinant viral vectors carrying nucleic acid sequences encoding full-length K+-Cl- cotransporter (full-length KCC2) to treat spinal cord injury (WO2019226643A1), there is still room for further improvement in its therapeutic effect to obtain better therapeutic effects. Current research still cannot meet the clinical needs of SCI.

[0004] Therefore, there is an urgent need to explore innovative, safer and effective drugs and methods for the treatment of spinal cord injury. Summary of the invention

[0005] In a first aspect, the present invention provides a recombinant nucleic acid molecule comprising a promoter, a nucleic acid sequence encoding a KCC2 protein and a polyadenylic acid sequence (ie, poly A), wherein the promoter is derived from an mMeCp2 promoter.

[0006] In some specific embodiments, the sequence of the promoter is shown as SEQ ID NO:7 or SEQ ID NO:8.

[0007] In other specific embodiments, the poly A is BGH poly A, whose sequence is shown in SEQ ID NO:5.

[0008] In some specific embodiments, the KCC2 protein is a full-length KCC2a protein, and its amino acid sequence is shown in SEQ ID NO:3.

[0009] In some specific embodiments, the nucleic acid sequence encoding the KCC2 protein has a polynucleotide sequence selected from the following:

[0010] 1) the polynucleotide sequence shown in SEQ ID NO: 2;

[0011] 2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO: 2; or

[0012] 3) A polynucleotide sequence having more than 80% sequence identity with SEQ ID NO: 2, preferably a sequence having 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity; more preferably, a sequence having 98% or 99% or more identity; in a more preferred embodiment, the polynucleotide sequence is a codon-optimized sequence.

[0013] In some specific embodiments, the recombinant nucleic acid molecule further comprises one or more of a Kozak sequence, a WPRE and a post-transcriptional regulatory element.

[0014] In some preferred embodiments, the recombinant nucleic acid molecule comprises the following polynucleotide sequence:

[0015] 1) the polynucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 13;

[0016] 2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 13; or

[0017] 3) A polynucleotide sequence having more than 80% sequence identity with SEQ ID NO: 11 or SEQ ID NO: 13, preferably a sequence having 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity; more preferably, a sequence having 98% or 99% or more identity.

[0018] In certain specific embodiments, the recombinant nucleic acid molecule further comprises an AAV inverted terminal repeat sequence; preferably, the AAV inverted terminal repeat sequence is selected from AAV of different serotypes; preferably, the AAV inverted terminal repeat sequence is selected from AAV of any serotype in evolutionary branch AF or any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or their hybrid / chimeric types; more preferably, the AAV inverted terminal repeat sequence is from AAV2.

[0019] In a second aspect, the present invention provides a recombinant vector comprising the aforementioned recombinant nucleic acid molecule, wherein the vector is selected from a plasmid vector, a phage vector and a viral vector, wherein the viral vector is selected from an adeno-associated viral vector, an adenoviral vector, a lentiviral vector and a hybrid viral vector.

[0020] In a third aspect, the present invention provides a recombinant adeno-associated virus, comprising an AAV capsid and a vector genome, wherein the vector genome comprises the aforementioned recombinant nucleic acid molecule, and in certain specific embodiments, the recombinant nucleic acid molecule comprises an AAV inverted terminal repeat sequence, a nucleic acid sequence encoding a KCC2 protein, and an expression control sequence for directing the expression of the nucleic acid sequence of the KCC2 protein in a host cell, and a PolyA sequence; in some embodiments, the AAV capsid is selected from any serotype of AAV in evolutionary branch AF or any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or their hybrid / chimeric types, and in certain preferred embodiments, the capsid of the recombinant adeno-associated virus is AAV9, and its amino acid sequence is shown in SEQ ID NO: 15.

[0021] In a fourth aspect, the present invention provides an isolated host cell comprising the aforementioned recombinant nucleic acid molecule or the aforementioned recombinant vector or recombinant adeno-associated virus.

[0022] In some specific embodiments, the cell is a neuronal cell. In some specific embodiments, the cell is a cholinergic neuronal cell, a noradrenergic neuronal cell, a dopaminergic neuronal cell, a 5-hydroxytryptamine neuronal cell, a γ-aminobutyric acid neuronal cell. In some specific embodiments, the cell is a neural cell line, including NG108-15, N1E115, PC12, SHSY5Y, F11, ND7-23, N27, SN4741 cell lines.

[0023] In a fifth aspect, the present invention provides a pharmaceutical composition comprising the aforementioned recombinant nucleic acid molecule, recombinant vector or recombinant adeno-associated virus and / or the aforementioned host cell and a pharmaceutically acceptable excipient. In some preferred embodiments, the pharmaceutical composition can be formulated for intravenous injection, intrathecal injection, intraventricular injection, intraspinal injection, intrathoracic injection, oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intramuscular, intraperitoneal and / or other parenteral administration. In some preferred embodiments, the pharmaceutical composition may also include other drugs that can be used to treat spinal cord injury.

[0024] In a sixth aspect, the present invention provides the use of the aforementioned recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or the aforementioned pharmaceutical composition in the preparation of a medicament for preventing or treating spinal cord injury. In certain specific embodiments, the recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or pharmaceutical composition can be administered in combination with another therapy.

[0025] In a seventh aspect, the present invention provides a method for treating spinal cord injury in a subject, the method comprising administering the aforementioned recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or the aforementioned pharmaceutical composition to a subject in need thereof. In certain preferred embodiments, the composition is administered intravenously; in certain preferred embodiments, the composition is administered intrathecally; in certain preferred embodiments, the composition is administered intraspinal; in other preferred embodiments, the subject is a mammal; in a more preferred embodiment, the subject is a human. In some embodiments, the treatment method can also be used in combination with other therapies.

[0026] The beneficial effects of the present invention are:

[0027] The combination of the promoter derived from MeCp2 and BGH polyadenylic acid used in the recombinant nucleic acid molecule or recombinant adeno-associated virus provided by the present invention can regulate the expression of KCC2 protein in nerve cells more safely and effectively, and can treat spinal cord injury more effectively and safely than other promoter and polyadenylic acid combinations used in the nervous system in the prior art.

[0028] The present disclosure is further described below in conjunction with the accompanying drawings and specific implementations, but is not intended to limit the present disclosure. Any equivalent replacement in the art made in accordance with the content of the present disclosure shall fall within the scope of protection of this patent. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 .The main structure diagram of the vector genome containing different promoter and polyA combinations in the recombinant adeno-associated virus.

[0030] Figure 2. Plasmid map of the construction process of the shuttle plasmid pSNAV2.0-K-Syn-KCC2-BGH.

[0031] Figure 3. Map of shuttle plasmids containing different promoter and polyA combinations.

[0032] Figure 4 .Immunofluorescence detection results after different recombinant viruses infected neuronal cells.

[0033] Figure 5 .In vitro biological activity test results of different recombinant viruses.

[0034] Figure 6 .In vivo efficacy test results of different recombinant viruses (BMS score).

[0035] Figure 7 .In vivo efficacy test results (survival rate) of different recombinant viruses. DETAILED DESCRIPTION OF THE INVENTION

[0037] definition

[0038] Unless otherwise noted, the practice of the present invention will adopt conventional chemistry, biochemistry, recombinant DNA technology and immunological methods in the art. Such technology is fully explained in the literature (see, for example, Fundamental Virology, Second Edition, vol. I & II (BN Fields and DMKnipe ed.); Handbook of Experimental Immunology, VoIs. I-FV (DM Weir and CC. Blackwell ed., Blackwell Scientific Publications); TECreighton, Proteins: Structures and Molecular Properties (WH Freeman and Company, 1993); A Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan ed., Academic Press, Inc.).

[0039] To facilitate understanding of the various embodiments of the present disclosure, the following explanations of specific terms are provided:

[0040] Adeno-associated virus (AAV): A small, replication-defective, non-enveloped virus that infects humans and some other primate species. AAV is known to cause no disease and to elicit a very mild immune response. Recombinant AAV vectors can infect both dividing and quiescent cells and can remain extrachromosomal without integrating into the host cell's genome. These features make AAV an attractive viral vector for gene therapy.

[0041] Administration / administration: Providing or administering an agent, such as a therapeutic agent (e.g., a recombinant AAV), to a subject by an effective route. Exemplary routes of administration include, but are not limited to, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intracerebroventricular, intrathecal, intraspinal), oral, intraductal, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes.

[0042] Codon optimized: A "codon optimized" nucleic acid refers to a nucleic acid sequence that has been altered so that the codons are optimal for expression in a particular system (e.g., a particular species or group of species). For example, a nucleic acid sequence can be optimized for expression in mammalian cells or a particular mammalian species (e.g., human cells). Codon optimization does not change the amino acid sequence of the encoded protein.

[0043] Enhancer: A nucleic acid sequence that increases transcription efficiency by increasing promoter activity.

[0044] Inverted terminal repeats (ITRs): Symmetrical nucleic acid sequences in the adeno-associated virus genome required for efficient replication. ITR sequences are located at each end of the AAV DNA genome. ITRs serve as replication origins for viral DNA synthesis and are essential cis elements for the production of AAV integrative vectors.

[0045] Isolated: An "isolated" biological component (e.g., a nucleic acid molecule, protein, virus, or cell) has been substantially separated or purified from cells or tissues of a naturally occurring organism or from other biological components of the organism itself (e.g., other chromosomal and extrachromosomal DNA and RNA, proteins, and cells). Nucleic acid molecules and proteins that have been "isolated" include those purified by standard purification methods. The term also includes nucleic acid molecules and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acid molecules and proteins.

[0046] Operably linked: A first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first and second nucleic acid sequences are placed in a functional relationship. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Typically, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

[0047] Pharmaceutically acceptable carriers: Pharmaceutically acceptable carriers (vehicles) that may be used in the present disclosure are conventional. Remington's Pharmaceutical Sciences, by EW Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975) describes compositions and formulations suitable for drug delivery of one or more therapeutic compounds, molecules or agents.

[0048] In general, the properties of the carrier depend on the specific mode of administration used. For example, parenteral preparations generally include injectable fluids, which include pharmaceutically and physiologically acceptable fluids, such as water, saline, balanced salt solutions, aqueous dextrose, glycerol, etc. as solvents. For solid compositions (e.g., powders, pills, tablets or capsule forms), conventional non-toxic solid carriers may be included, such as pharmaceutical grade mannitol, lactose, starch or magnesium stearate. In addition to biologically neutral carriers, the pharmaceutical composition to be administered may also include a small amount of non-toxic auxiliary substances, such as wetting agents or emulsifiers, preservatives and pH buffers, such as sodium acetate or sorbitan monolaurate.

[0049] Prevent, treat, or ameliorate a disease: "Preventing" a disease means inhibiting the full onset of a disease. "Treatment" means therapeutic intervention to improve the signs or symptoms of a disease or pathological condition after the disease has begun to develop. "Amelioration" means reducing the number or severity of signs or symptoms of a disease.

[0050] Promoter: A region of DNA that directs / causes transcription of a nucleic acid (e.g., a gene). A promoter includes essential nucleic acid sequences near the transcription start site. Typically, a promoter is located near the gene it transcribes. The promoter region also optionally includes a distal enhancer or repressor element, which may be located thousands of base pairs away from the transcription start site.

[0051] Recombinant: A recombinant nucleic acid molecule is a nucleic acid molecule that has a sequence that does not occur naturally, or a sequence that is prepared by the artificial combination of two sequence fragments that would otherwise be separate. This artificial combination can be achieved by chemical synthesis or by artificial manipulation of isolated nucleic acid molecule fragments (such as by genetic engineering techniques).

[0052] Likewise, a recombinant virus is a virus comprising a sequence that is not naturally present or a sequence that is prepared by an artificial combination of sequences from at least two different sources. The term "recombinant" also includes nucleic acids, proteins, and viruses that are altered only by the addition, substitution, or deletion of a portion of a natural nucleic acid molecule, protein, or virus. "Recombinant AAV" as used herein refers to an AAV particle in which a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule encoding G6Pase-α) is packaged.

[0053] Serotype: A group of closely related microorganisms (eg, viruses) distinguished by a characteristic set of antigens.

[0054] Subject: A living multicellular vertebrate organism, including the class of humans and non-human mammals. Specifically, the subject described herein is an individual with spinal cord injury, who may have residual endogenous KCC2 activity, or no measurable activity.

[0055] Synthetic: Produced in a laboratory by artificial means, e.g. synthetic nucleic acids can be chemically synthesized in a laboratory.

[0056] Therapeutically effective amount: The amount of a particular drug or therapeutic agent (e.g., recombinant AAV) sufficient to achieve the desired effect in a subject or cell treated with the agent. The effective amount of the agent depends on a variety of factors, including but not limited to the subject or cell being treated, and the mode of administration of the therapeutic composition.

[0057] Vector: A vector is a nucleic acid molecule that allows the insertion of exogenous nucleic acid without destroying the ability of the vector to replicate and / or integrate in a host cell. The vector may contain a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. The vector may also contain one or more selective marker genes and other genetic elements. An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of the inserted gene. In some embodiments herein, the vector is an AAV vector.

[0058] Sequence identity: The identity or similarity between two or more nucleic acid sequences or between two or more amino acid sequences is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percent identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percent similarity (taking into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences have a relatively high degree of sequence identity / similarity when aligned using standard methods. This homology is more pronounced when orthologous proteins or cDNAs are from more closely related species (e.g., human and mouse sequences) than from more distantly related species (e.g., human and C. elegans sequences).

[0059] The length of sequence identity comparison can be on the full length of the genome, the full length of the gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides is desirable. However, identity in smaller fragments (e.g., having at least about 9 nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides) can also be desirable.

[0060] The percent identity of an amino acid sequence can be readily determined over a full-length protein, polypeptide, about 32 amino acids, about 330 amino acids, or a peptide fragment thereof, or a corresponding nucleic acid coding sequence. Suitable amino acid fragments can be at least about 8 amino acids in length, and can be up to about 700 amino acids in length. Typically, when referring to "identity," "homology," or "similarity" between two different sequences, the "identity," "homology," or "similarity" is determined with reference to an "aligned" sequence. An "aligned" sequence or "alignment" refers to a plurality of nucleic acid sequences or protein (amino acid) sequences, which typically contain corrections for missing or additional bases or amino acids compared to a reference sequence.

[0061] The alignment can be performed using any public or commercially available multiple sequence alignment program. Sequence alignment programs can be used for amino acid sequences, such as "Clustal X", "MAP", "PIMA", "MSA", "BLOCKMAKER", "MEME" and "Match-Box" programs. Typically, any of these programs is used with the default settings, although those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can use another algorithm or computer program that at least provides the identity or alignment level as provided by the reference algorithm or program. See, for example, JD Thomson et al., Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments", 27 (13): 2682-2690 (1999).

[0062] Multiple sequence alignment programs can also be used for nucleic acid sequences. Examples of such programs include "ClustalW", "CAPSequence Assembly", "BLAST", "MAP" and "MEME", which can be accessed through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the VectorNTI application is also used. There are also many algorithms known in the art that can be used to measure nucleotide sequence identity, including those included in the above programs. As another example, Fasta can be used. TM (a program in GCG Version 6.1) to compare polynucleotide sequences. Fasta TM Alignment and percent sequence identity of the best overlapping region between the query and search sequences are provided. For example, Fasta TMThe percentage sequence identity between nucleic acid sequences is determined by using the default parameters (word length of 6 and NOPAM factor for scoring matrix) provided in GCG Version 6.1 (incorporated herein by reference). "Replication defective virus" or "viral vector" refers to a synthetic or artificial virus particle, wherein the expression cassette containing the relevant gene is packaged in a viral capsid or envelope, wherein any viral genome sequence also packaged in the viral capsid or envelope is replication defective, i.e., they cannot produce progeny virions, but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding enzymes required for replication (the genome can be engineered to be "no content"--only related transgenes containing side-joining amplification and packaging of artificial genome required signals), but these genes can be provided during production. Therefore, it is considered to be safe for use in gene therapy, because except in the presence of viral enzymes required for replication, replication and infection by progeny virions will not occur. Such replication defective viruses can be adeno-associated viruses (AAV), adenoviruses, lentiviruses (integrated or non-integrated) or another suitable viral source.

[0063] "Self-complementary AAV" refers to a construct in which the coding region carried by the recombinant AAV is designed to form an intramolecular double-stranded DNA template. During infection, rather than waiting for the cell-mediated synthesis of the second chain, the two complementary halves of the scAAV will associate to form a double-stranded DNA (dsDNA) unit ready for immediate replication and transcription, see, for example, DM McCarty et al., "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy (August 2001), Vol. 8, No. 16, pp. 1248-1254. Self-complementary AAV is described in, for example, US6,596,535 B1, US7,125,717 B2, and US7,456,683 B2, each of which is incorporated herein by reference in its entirety.

[0064] The term "expression" is used in this article in its broadest sense and includes the production of DNA or RNA and proteins. In terms of RNA, the term "expression" or "translation" particularly refers to the production of peptides or proteins. Expression can be transient, or can be stable.

[0065] The term "translation" in the context of the present invention relates to the process of ribosome processing in which an mRNA chain controls the assembly of an amino acid sequence to produce a protein or peptide.

[0066] The term "a" or "an" refers to one or more. Thus, the terms "a" (or "an"), "one or more" and "at least one" are used interchangeably herein.

[0067] The word "comprising" should be interpreted as inclusive rather than exclusive. The word "consisting of" and its variations should be interpreted as exclusive rather than inclusive. Although various embodiments in the specification appear to use the language of "comprising", in other cases, the relevant embodiments are also intended to be interpreted and described using the language of "consisting of" or "consisting essentially of".

[0068] As used herein, the term "about" refers to a difference of 10% (±10%) from a given reference value, unless otherwise specified.

[0069] As used herein, "disease," "disorder," and "condition" are used interchangeably to refer to an abnormal state in a subject.

[0070] Recombinant nucleic acid molecules

[0071] In a first aspect, the present invention provides a recombinant nucleic acid molecule comprising a promoter, a nucleic acid sequence encoding a KCC2 protein and a polyadenylic acid sequence (ie, poly A), wherein the promoter is derived from an mMeCp2 promoter.

[0072] KCC2 protein and nucleic acid sequence encoding the same

[0073] KCC2 is K + -Cl - Cotransporter 2, also known as solute carrier family 12 member 5, is a neuron-specific K + -Cl - Cotransporter that mediates neuron-specific K + -Cl -Transport. KCC2 protein has 12 transmembrane regions, 6 extracellular loops, a shorter intracellular amino terminus (NTD) and a longer intracellular carboxyl terminus (CTD). KCC2 has two subtypes: KCC2a and KCC2b, the difference between which is that the NTD of KCC2a has 23 more amino acids than the NTD of KCC2b. KCC2 proteins have been found in many species, including human KCC2 protein, mouse KCC2 protein, rat KCC2 protein, rabbit, dog, pig and other KCC2 proteins. The amino acid sequences and nucleotide sequences of various KCC2 proteins are known and can be found in various biological information databases such as NCBI. For example, the NCBI Gene ID of the full-length human KCC2a is 57468, its amino acid sequence number is NCBI Ref Seq: NP_001128243.1 (SEQ ID NO: 3), and its mRNA sequence number is NCBI Ref Seq: NM_001134771.2.

[0074] The KCC2 protein of the present invention may be derived from different species. In one embodiment, the KCC2 protein of the present invention is a naturally occurring mature KCC2 protein. In another embodiment, the KCC2 protein of the present invention includes various mutants or derivatives that retain biological activity.

[0075] In one embodiment, a modified or optimized KCC2 protein coding sequence is provided. In one embodiment, the KCC2 protein coding sequence is a codon-optimized sequence optimized for its expression in the subject species. "Subject" as used herein is a mammal, such as a human, mouse, rat, guinea pig, dog, cat, horse, cattle, pig or non-human primate, such as a monkey, chimpanzee, baboon or gorilla. In a preferred embodiment, the subject is a human. In one embodiment, the sequence is codon-optimized for expression in the human body.

[0076] Codon optimized coding region can be designed by various methods.Can use the method (such as GeneArt) available online, disclosed method or the company that provides codon optimization service, such as DNA2.0 (Menlo Park, CA) to carry out this optimization.For example, in International Patent Publication No. WO 2015 / 012924A2, a kind of codon optimization method is described, and it is incorporated herein by reference in its entirety.Also referring to, for example, US2014 / 0032186A1 and US2006 / 0136184A1.Suitably, modify the whole length of the open reading frame (ORF) of this product.But, in some embodiments, can only change the fragment of ORF.By using one in these methods, can apply described frequency to any given peptide sequence, and produce the codon optimized encoding sequence of this polypeptide encoding.

[0077] Many selections can be used to actually change codons or to synthesize the codon-optimized coding region designed as described herein. Such modifications or synthesis can be performed using standard and conventional molecular biological operations well known to those of ordinary skill in the art. In one method, a series of complementary oligonucleotide pairs having a length of 80-90 nucleotides and spanning a desired sequence length are synthesized by standard methods. These oligonucleotide pairs are synthesized so that they form double-stranded fragments of 80-90 base pairs containing sticky ends when annealed, such as synthesizing each oligonucleotide in the pair to extend 3, 4, 5, 6, 7, 8, 9, 10 or more bases beyond the region complementary to another oligonucleotide in the pair. The single-stranded ends of each oligonucleotide pair are designed to anneal with the single-stranded ends of another oligonucleotide pair. This oligonucleotide pair is annealed, and approximately five to six of these double-stranded fragments are annealed together via sticky single-stranded ends subsequently, and they are linked together and cloned into standard bacterial cloning vectors subsequently, such as those available from Invitrogen Corporation, Carlsbad, Calif. Vector. The construct is then sequenced by standard methods. Several of these constructs consisting of 5 to 6 fragments of 80 to 90 base pairs (i.e., fragments of about 500 base pairs) linked together are prepared so that the entire desired sequence is displayed as a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and linked together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Additional methods will be apparent to those skilled in the art. In addition, gene synthesis is readily available.

[0078] The nucleotide sequences encoding KCC2 proteins described herein can be synthesized using techniques well known in the art. For example, the PCR-based accurate synthesis (PAS) of long DNA sequences can be used, as described by Xiong et al., PCR-based accurate synthesis of long DNA sequences, Nature Protocols 1, 791-797 (2006). A method combining double asymmetric PCR and overlap extension PCR is described by Young and Dong, Two-step total gene synthesis method, Nucleic Acids Res. 2004; 32 (7): e59. See also Gordeeva et al., J Microbiol Methods. Improved PCR-based gene synthesis method and its application to the Citrobacter freundii phytase gene codon modification. May 2010; 81(2):147-52. Epub 2010 Mar 10; see also the following patents on oligonucleotide synthesis and gene synthesis, Gene Seq. April 2012; 6(1):10-21; US ​​8008005 and US 7985565. Each of these documents is incorporated herein by reference. In addition, kits and protocols for generating DNA via PCR are commercially available. These include the use of polymerases, including but not limited to Taq polymerase, (New England Biolabs), High-Fidelity DNA polymerase (New England Biolabs) and G2 polymerase (Promega). DNA can also be generated from cells transfected with a plasmid containing the KCC2 protein sequence described herein. Kits and protocols are known and commercially available and include, but are not limited to, QIAGEN plasmid kits, Pro Filter Plasmid Kit (Invitrogen) and GenElute TMPlasmid kit (Sigma Aldrich). Other techniques available in this article include sequence-specific isothermal amplification methods, which eliminate the need for thermal cycling. These methods typically use strand displacement DNA polymerases such as Bst DNA polymerase, Large Fragment (New England Biolabs) instead of heating to separate duplex DNA. DNA can also be generated from RNA molecules by amplification using reverse transcriptase (RT), which is an RNA-dependent DNA polymerase. RT polymerizes a DNA strand complementary to the original RNA template and is referred to as cDNA. This cDNA can then be further amplified by PCR or isothermal methods as described above. Custom DNA can also be generated commercially by companies including, but not limited to, GenScript, (Life Technologies) and IntegratedDNA Technologies.

[0079] In some specific embodiments of the present invention, the nucleic acid molecule encoding the KCC2 protein is DNA or RNA. In some specific embodiments of the present invention, the nucleic acid molecule encoding the KCC2 protein has a polynucleotide sequence selected from the following:

[0080] 1) the polynucleotide sequence shown in SEQ ID NO: 2;

[0081] 2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO: 2; or

[0082] 3) A polynucleotide sequence having more than 80% sequence identity with SEQ ID NO: 2, preferably a sequence having 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity; more preferably, a sequence having 98% or 99% or more identity; in a more preferred embodiment, the polynucleotide sequence is a codon-optimized sequence.

[0083] Promoter

[0084] The promoter used in the present invention is derived from the mouse Mecp2 promoter (mMeCp2 promoter).

[0085] MeCp2 is a gene encoding murine methyl-CpG-binding protein 2, which is highly expressed in neurons of the central nervous system and plays an important role in maintaining synaptic connections between neurons.

[0086] The MeCp2 promoter is the promoter of the murine methyl-CpG-binding protein 2, which is located upstream of the start codon of the MeCp2 gene in the genome and can regulate and initiate the transcription of the gene DNA sequence.

[0087] In some preferred embodiments of the present invention, the promoter is mMeCp2 promoter, and its sequence is shown in SEQ ID NO: 7. In some other preferred embodiments of the present invention, the promoter is shortmMeCp2 promoter, and its sequence is shown in SEQ ID NO: 8.

[0088] Polyadenylation sequence (PolyA)

[0089] In some embodiments of the present invention, the polyadenylation sequence (polyA) is BGH poly A.

[0090] BGH polyA is a bovine growth hormone polyadenylation signal, which is a transcription termination signal of eukaryotic organisms. In a specific embodiment of the present invention, the sequence of BGH polyA is shown in SEQ ID NO:5.

[0091] Other regulatory elements

[0092] In some specific embodiments of the present invention, the recombinant nucleic acid molecule further comprises other expression control elements, such as one or more of a Kozak sequence, a WPRE and a post-transcriptional regulatory element, wherein the Kozak sequence can enhance translation efficiency, and the WPRE sequence can enhance and stabilize mRNA expression.

[0093] In some preferred embodiments of the present invention, the recombinant nucleic acid molecule comprises a polynucleotide sequence selected from the group consisting of:

[0094] 1) the polynucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 13;

[0095] 2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 13; or

[0096] 3) A polynucleotide sequence having more than 80% sequence identity with SEQ ID NO: 11 or SEQ ID NO: 13, preferably a sequence having 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity; more preferably, a sequence having 98% or 99% or more identity.

[0097] The polynucleotide sequence shown in SEQ ID NO: 11 comprises the following elements: mMeCp2 promoter, nucleic acid sequence encoding full-length KCC2, and BGH polyA sequence. The polynucleotide sequence shown in SEQ ID NO: 13 comprises the following elements: shortmMeCp2 promoter, nucleic acid sequence encoding full-length KCC2 protein, and BGH polyA sequence.

[0098] In certain specific embodiments, the recombinant nucleic acid molecule further comprises an AAV inverted terminal repeat sequence; preferably, the AAV inverted terminal repeat sequence is selected from AAV of different serotypes; preferably, the AAV inverted terminal repeat sequence is selected from AAV of any serotype in evolutionary branch AF or any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or their hybrid / chimeric types; more preferably, the AAV inverted terminal repeat sequence is from AAV2.

[0099] Recombinant vector or recombinant adeno-associated virus

[0100] The second aspect of the present invention also provides a recombinant vector comprising the aforementioned recombinant nucleic acid molecule.

[0101] In some specific embodiments, the vector is selected from a plasmid vector, a phage vector or a viral vector, wherein the viral vector is selected from an adeno-associated viral vector, an adenoviral vector, a lentiviral vector or a hybrid viral vector.

[0102] In some specific embodiments, the nucleic acid molecules encoding KCC2 proteins described herein can be engineered into suitable genetic elements (vectors) that can be used to generate viral vectors and / or delivered to host cells, such as naked DNA, bacteriophages, transposons, cosmids, episomes, etc., which transmit the nucleic acid molecules encoding KCC2 proteins carried thereon. The selected vector can be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion technology, high-speed DNA coated beads, viral infection, and protoplast fusion. The method for making such constructs is known to those skilled in the art of nucleic acid manipulation, and includes genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.

[0103] The third aspect of the present invention also provides a recombinant adeno-associated virus, which comprises an AAV capsid and a vector genome, wherein the vector genome comprises the aforementioned recombinant nucleic acid molecule.

[0104] Adeno-associated virus (AAV) viral vectors are AAV DNase-resistant particles that can package exogenous nucleic acid sequences into AAV protein capsids for delivery to target cells. The AAV capsid is composed of 60 capsid protein subunits VP1, VP2, and VP3, which are arranged in icosahedral symmetry at a ratio of about 1:1:10 to 1:1:20 depending on the AAV subtype. The AAV capsid can be selected from those AAV capsids known in the art, including variants thereof.

[0105] In one embodiment, the AAV capsid is selected from those AAV capsids that can effectively transduce neuronal cells. In one embodiment, the AAV capsid is selected from AAV1, AAV2, AAV7, AAV8, AAV9, AAVrh.10, AAV5, AAVhu.11, AAV8DJ, AAVhu.32, AAVhu.37, AAVpi.2, AAVrh.8, AAVhu.48R3 and variants thereof, see Royo et al., Brain Res, January 2008, 1190: 15-22; Petrosyan et al., Gene Therapy, December 2014, 21 (12): 991-1000; Holehonnur et al., BMC Neuroscience, 2014, 15: 28; and Cearley et al., Mol Ther. October 2008, 16 (10): 1710-1718, each of which is incorporated herein by reference.

[0106] Other AAV capsids available herein include AAVrh.39, AAVrh.20, AAVrh.25, AAV10, AAVbb.1 and AAVbb.2 and variants thereof. As the source of the capsid of the AAV viral vector (DNase-resistant virions), other AAV serotypes can be selected, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAVrh10, AAVrh64R1, AAVrh64R2, AAVrh8, AAVrh.10, any known or mentioned AAV variants or AAVs yet to be discovered, see, for example, US20070036760A1, US20090197338A1, EP 1310571A2. See also WO 2003 / 042397A2 (AAV7 and other simian AAVs), US7790449B2 and US7282199B2 (AAV8), WO2005 / 033321A2 and US 7,906,111B2 (AAV9), and WO 2006 / 110689A2 and WO 2003 / 042397A2 (AAVrh.10). Alternatively, a recombinant AAV based on any of the AAVs described can be used as a source of AAV capsids. These documents also describe other AAVs that can be selected for generating AAVs and are incorporated by reference herein. In some embodiments, the AAV capsid for the viral vector can be produced by mutagenesis (i.e., by insertion, deletion, or substitution) of one of the aforementioned AAV capsids or its encoding nucleic acid.

[0107] In some specific embodiments, the AAV capsid is chimeric, comprising domains from two or three or four or more of the aforementioned AAV capsid proteins. In some embodiments, the AAV capsid is a chimera of Vpl, Vp2 and Vp3 monomers from two or three different AAVs or recombinant AAVs. As used herein, with respect to AAV, the term variant refers to any AAV sequence derived from a known AAV sequence, including sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity in amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes a variant comprising up to about 10% variation with any of the described or known AAV capsid sequences. That is, the AAV capsid shares about 90% to 99.9% identity, about 95% to 99% identity, or about 97% to 98% identity with the AAV capsids provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with the AAV capsid. When determining the percent identity of an AAV capsid, the comparison can be made to any variable protein (e.g., vp1, vp2, or vp3). In another embodiment, a self-complementary AAV (scAAV) is used. In another embodiment, a single-stranded AAV (ssAAV) is used.

[0108] In some preferred embodiments, the AAV capsid is selected from any serotype of AAV in clade AF or any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or their hybrid / chimeric forms. In certain preferred embodiments, the capsid of the recombinant adeno-associated virus is AAV9, and its amino acid sequence is shown in SEQ ID NO: 15. In some preferred embodiments, the recombinant adeno-associated virus is a single-stranded adeno-associated virus.

[0109] In some specific embodiments, the recombinant nucleic acid molecules described herein can be packaged into the capsid of a viral vector (e.g., virion). Typically, such recombinant nucleic acid molecules used to generate viral vectors contain the coding sequence of the KCC2 protein described herein, the packaging signal of the viral genome on its side, and other expression control sequences, such as those described herein. For example, for AAV viral vectors, the packaging signal is 5' reverse terminal repeats (ITR) and 3' ITR. When packaged into the AAV capsid, the recombinant nucleic acid molecule and the ITRs associated therewith are referred to herein as "recombinant AAV (rAAV) genome" or "vector genome".

[0110] In some specific embodiments, the recombinant adeno-associated virus vector (rAAV) provided by the present invention comprises an AAV capsid and a vector genome as described herein. In some specific embodiments, the vector genome comprises a nucleic acid molecule encoding a KCC2 protein and a regulatory sequence for guiding and / or regulating the expression of the above nucleic acid molecule in a host cell. In some specific embodiments, the vector genome comprises the recombinant nucleic acid molecule described in the present invention. In other specific embodiments, the vector genome also comprises an ITR sequence of AAV. In one embodiment, the ITRs are from an AAV serotype different from the capsid provided. In a preferred embodiment, the ITR sequence is from AAV2, or a deletion variant thereof (ΔITR), which may be used for convenience and accelerate regulatory approval. However, ITRs from other AAV sources can be selected. When the source of the ITR is from AAV2 and the AAV capsid is from another AAV source, the resulting vector can be referred to as a pseudotype. Typically, the AAV vector genome comprises AAV 5'ITR and AAV 3'ITR. Deletion variants of the 5'ITR in which the D-sequence and the terminal resolution site (trs) are deleted (referred to as ΔITR) have been described. In some embodiments, the 5' and 3' ITRs of the full-length AAV are used. The ITR or ΔITR sequences of each serotype are well known to those skilled in the art.

[0111] In one embodiment, the capsid is an AAV9 capsid (whose amino acid sequence is shown in SEQ ID NO: 15) or a variant thereof.

[0112] In one embodiment, single-stranded AAV (ssAAV) can be selected.

[0113] In one embodiment, double-stranded AAV, or self-complementary AAV (scAAV) can be selected.

[0114] The method for generating and separating AAV viral vectors suitable for delivery to a subject is known in the art. See, for example, US2007 / 0036760A1 (February 15, 2007), US7790449B2, US7282199B2, WO 2003 / 042397A2, WO 2005 / 033321 A2, WO 2006 / 110689A2 and US7588772B2. In one system, a production cell line is transiently transfected with a construct encoding a transgenic flanking ITR and a construct encoding rep and cap. In a second system, a packaging cell line stably providing rep and cap is transiently transfected with a construct encoding a transgenic flanking ITR. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpes virus, wherein rAAV needs to be separated from contaminating viruses. Later, a system was developed that did not require infection with a helper virus to recover AAV, by which the required auxiliary functions (i.e., adenovirus E1, E2a, VA and E4 or herpesvirus UL5, UL8, UL52 and UL29 and herpesvirus polymerase) were provided in trans, in which the auxiliary functions can be provided by transiently transfecting the cell with a construct encoding the required auxiliary function, or the cell can be engineered to stably contain a gene encoding the auxiliary function, the expression of which can be controlled at the transcriptional or post-transcriptional level. In another system, transgenic and rep / cap genes flanking ITRs are introduced into insect cells by infection with a baculovirus-based vector. For an overview of these production systems, see, for example, Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associatedvirus production", Human Gene Therapy 20:922-929, each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. Patents, the contents of each of which are incorporated herein by reference in their entirety: U.S. Patent Nos. 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065.

[0115] Optionally, the recombinant nucleic acid molecules described herein can also be used to produce other viral vectors. Such other viral vectors can include any virus suitable for adoptable gene therapy, including but not limited to adenovirus, herpes virus, slow virus, retrovirus, etc. Suitably, when one of these other vectors is produced, it is produced as a replication-defective viral vector.

[0116] cell

[0117] The fourth aspect of the present invention also provides an isolated host cell, which comprises the aforementioned recombinant nucleic acid molecule or the aforementioned recombinant vector or recombinant adeno-associated virus.

[0118] In some specific embodiments, the cells are neuronal cells; in some specific embodiments, the cells are cholinergic neuronal cells, noradrenergic neuronal cells, dopaminergic neuronal cells, 5-hydroxytryptaminergic neuronal cells, γ-aminobutyric acid neuronal cells; in some specific embodiments, the cells are neural cell lines, including NG108-15, N1E115, PC12, SHSY5Y, F11, ND7-23, N27, SN4741 cell lines.

[0119] Pharmaceutical composition

[0120] The fifth aspect of the present invention also provides a pharmaceutical composition, which comprises the aforementioned recombinant nucleic acid molecule, recombinant vector or recombinant adeno-associated virus and / or the aforementioned host cell and a pharmaceutically acceptable excipient. In some preferred embodiments, the pharmaceutical composition can be formulated for intravenous injection, intrathecal injection, intraventricular injection, intraspinal injection, thoracic injection, oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intramuscular, intraperitoneal and / or other parenteral administration. In some preferred embodiments, the pharmaceutical composition may also include other drugs that can be used to treat spinal cord injury.

[0121] In some specific embodiments, the pharmaceutical composition of the present invention can be designed to be delivered to a subject in need thereof by any suitable route or a combination of different routes. In one embodiment, the composition is delivered via intravenous injection. In one embodiment, the pharmaceutical composition is delivered via intraspinal injection. In one embodiment, it can be carried out via intrathecal injection. In one embodiment, the composition is delivered via intraventricular injection. In another embodiment, the composition is delivered via thoracic injection. In another embodiment, the in situ injection of the target tissue can be performed. Alternatively, other routes of administration (e.g., oral, inhaled, intranasal, intratracheal, intraarterial, intraocular, intramuscular, intraperitoneal and other parenteral routes) can be selected.

[0122] In some specific embodiments, the recombinant nucleic acid molecules, recombinant vectors, recombinant adeno-associated viruses or isolated host cells described herein can be delivered in a single composition or multiple compositions. Optionally, two or more different AAVs can be delivered (see, for example, WO 2011 / 126808A2 and WO 2013 / 049493A1). In another embodiment, such multiple viruses can contain different replication-defective viruses (e.g., AAV, adenovirus and / or lentivirus). Alternatively, delivery can be mediated by non-viral vectors, such as "naked DNA", "naked plasmid DNA", RNA and mRNA; various delivery compositions and nanoparticle combinations, including, for example, micelles, liposomes, cationic lipid-nucleic acid compositions, poly-glycan compositions and other polymers, lipid-based and / or cholesterol-nucleic acid conjugates, and other constructs as described herein, see, for example, X. Su et al., Mol. Pharmaceutics, 2011, 8(3), pp. 774-787; online publication: March 21, 2011; WO2013 / 182683A1, WO 2010 / 053572A2 and WO 2012 / 170930A1, all of which are incorporated herein by reference, and such non-viral KCC2 delivery vectors can be administered by the aforementioned routes.

[0123] In some embodiments, the viral vector or non-viral DNA or RNA transfer part can be formulated with a physiologically acceptable carrier for gene transfer and gene therapy. In some embodiments, the delivery vector can select a variety of suitable purification methods, describing examples of purification methods suitable for separating empty capsids from carrier particles, such as International Patent Application No. PCT / US16 / 65976 filed on December 9, 2016 and its priority documents, U.S. Patent Provisional Application No. 62 / 322,098 filed on April 13, 2016, and U.S. Patent Provisional Application No. 62 / 266,341 filed on December 11, 2015 and entitled "Scalable Purification Method for AAV8", which are hereby incorporated by reference herein. See also the purification methods described in the following documents: International Patent Application No. PCT / US16 / 65974 filed on December 9, 2016 and its priority documents, U.S. Provisional Application Nos. 62 / 322,083 filed on April 13, 2016 and 62 / 266,351 filed on December 11, 2015 (AAV1); International Patent Application Nos. PCT / US16 / 66013 filed on December 9, 2016 and Its priority documents, U.S. Provisional Application Nos. 62 / 322,055 filed on April 13, 2016 and 62 / 266,347 filed on December 11, 2015 (AAVrh10); International Patent Application No. PCT / US16 / 65970 filed on December 9, 2016 and its priority applications, U.S. Provisional Application Nos. 62 / 266,357 and 62 / 266,357 (AAV9), are hereby incorporated by reference herein. In one embodiment, purification comprises a two-step purification scheme that selectively captures and separates rAAV vector particles containing the genome from the clarified, concentrated supernatant of the rAAV production cell culture. The method utilizes an affinity capture method performed at high salt concentrations, followed by an anion exchange resin method performed at high pH to provide rAAV vector particles that are substantially free of rAAV intermediates. In another embodiment, purification comprises affinity chromatography, ultracentrifugation, molecular sieve chromatography, and the like.

[0124] In the case of AAV viral vectors, quantification of viral genomes (vg) can be used as a measure of the dose contained in the formulation. The dose of rAAV administered in the methods disclosed herein will vary depending on, for example, the specific rAAV, the mode of administration, the therapeutic goal, the individual, and the targeted cell type, and can be determined by standard methods in the art. The dose can be expressed in units of viral genomes (vg) (i.e., 1×10 7 vg, 1×10 8 vg, 1×10 9 vg, 1×10 10vg, 1×10 11 vg, 1×10 12 vg, 1×10 13 vg, 1×l0 14 vg, 1×10 15 vg, 1×10 16 vg). Doses can also be expressed in units of viral genomes (vg) per kilogram (kg) of body weight (i.e., 1×10 6 vg / kg, 1×10 7 vg / kg, 1×10 8 vg / kg, 1×10 9 vg / kg, respectively 1×10 10 vg / kg, 1×10 11 vg / kg, 5×10 11 vg / kg, 1×10 12 vg / kg, 5×10 12 vg / kg, 1×10 13 vg / kg, 1×10 14 vg / kg, 1×10 15 vg / kg, 1×10 16 vg / kg). Methods for titrating AAV are described in Clark et al., Hum. Gene Ther. 1999; 10: 1031-1039.

[0125] These above-mentioned doses can be administered in various volumes of carrier, excipient or buffer formulations, the volume being in the range of about 25 microliters to about 15 milliliters, including all numbers within this range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is about 800 μL. In another embodiment, the volume is about 900 μL. In another embodiment, the volume is about 1 mL. In yet another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 6 mL. In another embodiment, the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 10 mL. In another embodiment, the volume is about 15 ml.

[0126] The rAAV is preferably suspended in a physiologically compatible carrier and can be administered to a human or non-human mammal patient. In another embodiment, the composition includes a pharmaceutically acceptable carrier, a diluent, an excipient and / or an adjuvant. Suitable carriers can be easily selected by those skilled in the art in view of the indications for which the transfer virus is directed. For example, including saline, it can be prepared with a variety of buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil and water. The buffer / carrier should include components that prevent rAAV from attaching to the infusion tube but do not interfere with the binding activity of rAAV in vivo.

[0127] Optionally, the composition of the present invention may contain other conventional pharmaceutical ingredients in addition to rAAV and a pharmaceutically acceptable carrier, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0128] The compositions of the invention may comprise a pharmaceutically acceptable carrier as defined above. Suitably, the compositions described herein comprise an effective amount of one or more AAVs suspended in a pharmaceutically suitable carrier and / or mixed with a suitable excipient, which are designed to be delivered to a subject via injection, an osmotic pump, an intrathecal catheter, or by another device or route of delivery.

[0129] The viral vectors described herein can be used to prepare drugs so that nucleic acid molecules encoding KCC2 proteins are delivered to subjects (e.g., human patients) in need thereof, and to provide KCC2 to subjects for the treatment of spinal cord injury. The treatment process can optionally include repeated administration of the same viral vector (e.g., AAV9 vector) or different viral vectors (e.g., AAV9 and AAV10). Other combinations can still be selected using the viral vectors and non-viral delivery systems described herein.

[0130] Pharmaceutical Uses and Treatment Methods

[0131] The sixth aspect of the present invention also provides the use of the aforementioned recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or the aforementioned pharmaceutical composition in the preparation of a medicament for preventing or treating spinal cord injury. In certain specific embodiments, the recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or pharmaceutical composition can be administered in combination with another therapy.

[0132] The seventh aspect of the present invention also provides a method for treating spinal cord injury in a subject, the method comprising administering the aforementioned recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or the aforementioned pharmaceutical composition to a subject in need thereof; in certain preferred embodiments, the composition is administered intravenously; in certain preferred embodiments, the composition is administered intrathecally; in certain preferred embodiments, the composition is administered intraspinal; in other preferred embodiments, the subject is a mammal; in a more preferred embodiment, the subject is a human. In some embodiments, the treatment method can also be used in combination with other therapies.

[0133] In some specific embodiments, the above-mentioned recombinant nucleic acid molecules, recombinant vectors, recombinant adeno-associated viruses, host cells and / or the aforementioned pharmaceutical compositions can be administered repeatedly. Optionally, more than one repeated administration is allowed. Such repeated administration can have the same type of vector, different viral vectors, or via non-viral delivery as described herein. For example, if a patient is treated with rAAV9 carrying a nucleic acid molecule encoding a KCC2 protein and a secondary treatment is required, rAAV10 carrying the above-mentioned nucleic acid molecule can be subsequently administered, and vice versa.

[0134] Treatment of patients with spinal cord injury may require combined therapy, such as in some embodiments of the present invention, the pharmaceutical composition of the present invention can be used in combination with any of substances including but not limited to CLP290, osteopontin, growth factors or 4-aminopyridine. As in other specific embodiments of the present invention, before, during and / or after treatment with the composition of the present invention, immunosuppressants are used for transient co-treatment. Immunosuppressants used for such co-therapy include but are not limited to steroids, antimetabolites, T cell inhibitors and alkylating agents. For example, such transient treatments may include taking steroids (e.g., prednisone) once a day in decreasing doses for 7 days, starting with an amount of about 60 mg, and reducing 10 mg per day (no dose on the 7th day). Other doses and immunosuppressants can be selected.

[0135] Unless otherwise defined in this specification, technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art and by reference to the disclosure, which provides a general guide to many of the terms used in this application. DETAILED DESCRIPTION

[0136] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0137] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. The experimental methods in the following examples are all conventional methods in the art unless otherwise specified.

[0138] Example 1. Design of expression cassette and construction of shuttle plasmid carrying the expression cassette

[0139] 1. Design of expression cassettes containing different promoter and poly A combinations

[0140] In order to verify the effect of the combination of promoter and poly A involved in the present invention, this example uses a combination of multiple promoters (Syn, mNFH, mMeCp2, short mMeCp2) and polyA (BGH poly A, Synthetic poly A) to design multiple different expression cassettes. At the same time, adeno-associated virus vectors were used as delivery vectors to verify the effects of different combinations of promoters and poly A on the expression of human wild-type full-length KCC2 protein in neural cells.

[0141] The expression cassette and nucleic acid sequence thereof comprising the combination are shown below (the schematic diagram of its structure and composition can be found in Figure 1 , the figure also shows the ITRs located on both sides of the expression cassette, the ITRs are from AAV2):

[0142] (1) Syn-KCC2-BGH poly A (SEQ ID NO: 9);

[0143] (2) mNFH-KCC2-Synthetic poly A (SEQ ID NO: 10);

[0144] (3) mMeCp2-KCC2-BGH polyA (SEQ ID NO: 11);

[0145] (4) mMeCp2-KCC2-Synthetic poly A (SEQ ID NO: 12);

[0146] (5) shortmMeCp2-KCC2-BGH polyA (SEQ ID NO: 13);

[0147] (6) shortmMeCp2-KCC2-Synthetic poly A (SEQ ID NO: 14).

[0148] Among them, Syn-KCC2-BGH poly A (SEQ ID NO: 9) is an expression cassette that has been disclosed in existing literature (see WO2019226643A1) and is used as a positive control in this example.

[0149] The nucleotide sequences of each promoter and poly A are shown in Table 1 below:

[0150] Table 1

[0151] name Sequence number Syn promoter SEQ ID NO: 1 mNFH promoter SEQ ID NO: 4 mMeCp2 promoter SEQ ID NO: 7 short mMeCp2 promoter SEQ ID NO: 8 BGH poly A SEQ ID NO: 5 Synthetic poly A SEQ ID NO: 6

[0152] 2. Construction of shuttle plasmid carrying the above expression cassette

[0153] Based on the above expression cassettes, shuttle plasmids carrying the above expression cassettes were constructed for packaging recombinant adeno-associated virus vectors. 2.1 Construction of shuttle plasmids carrying the expression cassette Syn-KCC2-BGH poly A

[0154] (1) The pSNAV2.0-Syn-EGFP vector was double-digested with restriction endonucleases SalⅠ and XhoⅠ ( Figure 2A ) and recovered the large fragment (about 6329 bp).

[0155] (2) The human Syn promoter (human synapsin I promoter, human synapsin I promoter, SEQ ID NO: 1) and its seamless primers (forward primer: 5'-TGGTGGCGGCGATATCCTGCGCTCTCAGGCACGACAC-3', reverse primer: 5'-GGGTTCCTCTGCTCGAGCAGTGCAAGTGGGTTTTAGG-3') and the KCC2 coding sequence (Genebank NM_001134771.2) (SEQ ID NO: 2, the amino acid sequence of which is shown in SEQ ID NO: 3) and its seamless primers (forward primer: 5'-TCGAGGCAGATCTGTCGAC-3', reverse primer: 5'-CAGGATATCGCCGCCACCATGAGCCGCAGGTTCACGGTC-3') were synthesized respectively (synthesized by Beijing Nosai Genome Research Center Co., Ltd.).

[0156] (3) The Syn promoter and KCC2 protein coding sequence were inserted into the backbone vector between the 5'ITR sequence and the BGH polyadenylation by seamless cloning PCR method. The constructed plasmid was named pSNAV2.0-Syn-KCC2 ( Figure 2B ).

[0157] (4) The plasmid pSNAV2.0-Syn-KCC2 was double-digested with SwaI and NruI to recover a vector fragment of about 6.2 kb.

[0158] (5) Use seamless ligation primer pair 1 (forward primer:

[0159] 5'-CAGCTGAACCAACTCGCGAATTCCACAGCTGCCTCGCGC-3', Reverse Primer:

[0160] 5'-GGTGGCGGCGATATCCTGCGCTCTCAGGCACGAC-3') and primer pair 2 (forward primer:

[0161] 5'-CCGTTGAATATGGCTCATACTCTTCCTTTTTCAATATTA-3', Reverse Primer:

[0162] 5'-AGGTTAAGTCCTCATTTAAATTAGGCAA-3') was used to amplify fragment 1 (about 1.27 kb) and fragment 2 (about 270 bp) on the original vector by PCR using the above plasmid pSNAV2.0-Syn-KCC2 as a template.

[0163] (6) The kana resistance encoding gene was amplified by PCR using the seamless primer pair 3 (forward primer: 5′-TTAGAAAAACTCATCGAGCATCAAATG-3′, reverse primer: 5′-ATGAGCCATATTCAACGGGA-3′) and the synthetic 1902-Kan (containing the kana resistance encoding gene) as a template, and was named fragment 3.

[0164] (7) PCR was used to add homology arms between the vector and fragment 1, fragment 1 and fragment 3, fragment 3 and fragment 2, and fragment 2 and the vector. Fragment 1, fragment 2, fragment 3 and the vector fragment of pSNAV2.0-Syn-KCC2 were connected by seamless connection. The resulting shuttle plasmid was named pSNAV2.0-K-Syn-KCC2-BGH ( Figure 2C The main structure of its vector genome is as follows Figure 1 A).

[0165] 2.2 Construction of shuttle plasmid carrying mNFH-KCC2-SyntheticpolyA expression cassette

[0166] (1) The pSNAV2.0-K-Syn-KCC2-BGH vector obtained above was double-digested with restriction endonucleases BamHI and XhoⅠ ( Figure 3A ), and a large fragment (about 4.3 kb) was recovered.

[0167] (2) The mNFH promoter (mouse neurofilament heavy chain promoter, mouse neurofilament heavy chain promoter, SEQ ID NO: 4) and its seamless primers (forward primer: 5'-TGGTGGCGGCGATATCGGAGCTCACGGACGTCCG-3', reverse primer: 5'-ACTAGGGGTTCCTCTGCTCGAGCACTTAAGCCCCTTTGGGTGGC-3'), the coding sequence of KCC2 protein (Genebank NM_001134771.2) (SEQ ID NO: 2, the amino acid sequence of which is shown in SEQ ID NO: 3) and its seamless primers (forward primer: 5'-TCAGGAGTAGATGGTGATGACCTC-3', reverse primer: 5'-GATATCGCCGCCACCATGAGC-3'), the synthetic poly A sequence (SEQ ID NO: 6) and its seamless connection primers (forward primer: 5'-TTCCTTGAAGTAAGGGGATCCCACACAAAAAACCAACACACAGATCTAATGAAAATAAA-3', reverse primer:

[0168] 5′-ACCATCTACTCCTGAGTCGACAATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGG-3′) (synthesized by Beijing Nosai Genome Research Center Co., Ltd.).

[0169] (3) The mNFH promoter, KCC2 protein coding sequence, and synthetic polyA sequence were inserted into the 5' ITR sequence of the backbone vector by seamless cloning PCR method. The shuttle plasmid constructed was named pSNAV2.0-K-mNFH-KCC2-synthetic polyA ( Figure 3B The main structure of its vector genome is as follows Figure 1 B).

[0170] 2.3 Construction of shuttle plasmid carrying mMeCp2-KCC2-BGHpolyA expression cassette

[0171] (1) Double digest the pSNAV2.0-K-Syn-KCC2-BGH vector with restriction endonucleases SalⅠ and XhoⅠ ( Figure 3A ), and a large fragment (about 4.5 kb) was recovered.

[0172] (2) The mMeCp2 promoter (SEQ ID NO: 7) and its seamless primer (forward primer: 5′-TGGTGGCGGCGATATCTCCGCTCGGCGCGGCGGC-3′, reverse primer: 5′-CTAGGGGTTCCTCTGCTCGAGCACACACCATCTGCCCATTATAAACGTC-3′) and the coding sequence of KCC2 protein (Genebank NM_001134771.2) (SEQ ID NO: 2, its amino acid sequence is as shown in SEQ ID NO: 3) and its seamless primer (forward primer: same as Section 2.1, reverse primer: same as Section 2.2) were synthesized by Beijing Nosai Genome Research Center Co., Ltd.

[0173] (3) The mMeCp2 promoter and KCC2 protein coding sequence were inserted between the 5'ITR sequence and the BGH polyA sequence of the backbone vector by seamless cloning PCR method. The shuttle plasmid constructed was named pSNAV2.0-K-mMeCp2-KCC2-BGH ( Figure 3C The main structure of its vector genome is as follows Figure 1 C).

[0174] 2.4 Construction of shuttle plasmid carrying mMeCp2-KCC2-synthetic polyA expression cassette

[0175] (1) The pSNAV2.0-K-Syn-KCC2-BGH vector was double-digested with restriction endonucleases BamHI and XhoⅠ ( Figure 3A ), and a large fragment (about 4.3 kb) was recovered.

[0176] (2) The mMeCp2 promoter (SEQ ID NO: 7) and its seamless primer (forward primer: same as Section 2.3, reverse primer: same as Section 2.3), the coding sequence of KCC2 protein (Genebank NM_001134771.2) (SEQ ID NO: 2, its amino acid sequence is SEQ ID NO: 3) and its seamless primer (forward primer: same as Section 2.2, reverse primer: same as Section 2.2) and the synthetic polyA sequence (SEQ ID NO: 6) and its seamless primer (forward primer: same as Section 2.2, reverse primer: same as Section 2.2) were synthesized by Beijing Nosai Genome Research Center Co., Ltd.

[0177] (3) The mMeCp2 promoter, KCC2 protein coding sequence, and synthetic polyA sequence were inserted into the 5'ITR sequence of the backbone vector by seamless cloning PCR method. The shuttle plasmid constructed was named pSNAV2.0-K-mMeCp2-KCC2-synthetic polyA ( Figure 3D The main structure of its vector genome is as follows Figure 1 D).

[0178] 2.5 Construction of shuttle plasmid carrying shortmMeCp2-KCC2-BGH expression cassette

[0179] (1) Double digest the pSNAV2.0-K-Syn-KCC2-BGH vector with restriction endonucleases SalⅠ and XhoⅠ ( Figure 3A ), and a large fragment (about 4.5 kb) was recovered.

[0180] (2) The shortmMeCp2 promoter (SEQ ID NO: 8) and its seamless primer (forward primer: same as in Section 2.3, reverse primer: 5′-CTAGGGGTTCCTCTGCTCGAGCACAACCAATGAAGGGTAATCTCGACAAAG-3′) and the coding sequence of KCC2 protein (Genebank NM_001134771.2) (SEQ ID NO: 2, its amino acid sequence is as SEQ ID NO: 3) and its seamless primer (forward primer: same as in Section 2.3, reverse primer: same as in Section 2.3) were synthesized by Beijing Nosai Genome Research Center Co., Ltd.

[0181] (3) The shortmMeCp2 promoter and KCC2 protein coding sequence were inserted between the 5'ITR sequence and the BGH polyA sequence of the backbone vector by seamless cloning PCR method. The shuttle plasmid constructed was named pSNAV2.0-K-shortmMeCp2-KCC2-BGH ( Figure 3E The main structure of its vector genome is as follows Figure 1 E).

[0182] 2.6 Construction of shuttle plasmid carrying shortmMeCp2-KCC2-syntheticpolyA expression cassette

[0183] (1) The pSNAV2.0-K-Syn-KCC2-BGH vector was double-digested with restriction endonucleases BamHI and XhoⅠ ( Figure 3A ), and a large fragment (about 4.3 kb) was recovered.

[0184] (2) The shortmMeCp2 promoter (SEQ ID NO: 8) and its seamless primer (forward primer: same as Section 2.3, reverse primer: same as Section 2.5), the coding sequence of KCC2 protein (Genebank NM_001134771.2) (SEQ ID NO: 2, its amino acid sequence is SEQ ID NO: 3) and its seamless primer (forward primer: same as Section 2.4, reverse primer: same as Section 2.3), and the synthetic polyA sequence (SEQ ID NO: 6) and its seamless primer (forward primer: same as Section 2.2, reverse primer: same as Section 2.2) were synthesized by Beijing Nosai Genome Research Center Co., Ltd.

[0185] (3) The shortmMeCp2 promoter, KCC2 protein coding sequence, and synthetic polyA sequence were inserted into the 5'ITR sequence of the backbone vector by seamless cloning PCR method. The shuttle plasmid constructed was named pSNAV2.0-K-short mMeCp2-KCC2-synthetic polyA ( Figure 3F The main structure of its vector genome is as follows Figure 1 F).

[0186] Example 2: Virus packaging and purification

[0187] The present invention uses HEK293T cells as a production cell line and a conventional three-plasmid packaging system to produce AAV virus vectors. The experimental methods used are all conventional methods in the art. (For example, see Xiao Xiao, Juan Li, and Richard Jude Samulski. Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus. J. Virol. 1998, 72 (3): 2224).

[0188] The shuttle plasmids obtained in Example 1 (pSNAV2.0-K-Syn-KCC2-BGH, pSNAV2.0-K-mNFH-KCC2-synthetic polyA, pSNAV2.0-K-mMeCp2-KCC2-BGH, pSNAV2.0-K-mMeCp2-KCC2-synthetic polyA, pSNAV2.0-K-short mMeCp2-KCC2-BGH and pSNAV2.0-K-short mMeCp2-KCC2-synthetic polyA) were used to package recombinant adeno-associated virus vectors carrying the above-mentioned different promoters and polyA combinations, and were named ssAAV 2 / 9-Syn-KCC2-BGHpolyA, ssAAV 2 / 9-mNFH-KCC2-syntheticpolyA, ssAAV 2 / 9-mMeCp2-KCC2-BGH, respectively. polyA, ssAAV 2 / 9-mMeCp2-KCC2-synthetic polyA, ssAAV 2 / 9-short mMeCp2-KCC2-BGH polyA, and ssAAV 2 / 9-short mMeCp2-KCC2-sytheticpolyA.

[0189] The AAV virus vector produced by packaging was purified by AAV9 affinity chromatography (Thermo Scientific POROSCaptureSelect AAV9 affinity resin A27359)-ultracentrifugation-G25 chromatography, and then the genome titer of the virus vector was detected by Q-PCR. The primer probe sequences used in the PCR detection are shown in Table 2, and the results of the titer detection of each recombinant AAV virus genome are shown in Table 3.

[0190] Table 2 Primer and probe sequences used in genomic titer detection

[0191] Primer name Sequence (5'—3') KCC2-2-forward primer TCGTGGGCTCTGTCCTTGA KCC2-2-reverse primer AGGCGCCTGATAGACTCTTCTG KCC2-2-probe CTTTCTGGAAAATCATCCACA

[0192] Table 3 Genome titer detection results

[0193]

[0194]

[0195] Example 3: In vitro efficacy evaluation

[0196] 1. Immunofluorescence detection of primary neuron system

[0197] Primary cortical neurons of P0 rats were isolated and cultured in vitro. Specifically, SD rats within 12 hours after birth were placed under a microscope and the pia mater tissue was carefully removed. The cortex was digested with papain and then beaten into a single cell suspension, which was cultured in Neurobasal medium (Invitrogen, 21103-049) containing 1% FBS and 2% B27.

[0198] Recombinant viral vectors ssAAV 2 / 9-Syn-KCC2-BGH polyA, ssAAV 2 / 9-mNFH-KCC2-synthetic polyA, ssAAV 2 / 9-mMeCp2-KCC2-BGH polyA, ssAAV 2 / 9-mMeCp2-KCC2-synthetic polyA, ssAAV 2 / 9-mMeCp2-KCC2-synthetic polyA, ssAAV 2 / 9-short mMeCp2-KCC2-BGH polyA, and ssAAV 2 / 9-short mMeCp2-KCC2-sythetic polyA carrying different promoter and polyA combinations were used to infect neurons at the same MOI (1E+6), and the negative control group (NC) was added with the same volume of virus solvent. After culturing in an incubator at 37°C and 5% CO2 for 7 days, immunofluorescence detection was performed. Neurons were fixed with 4% PFA for 10 min, then blocked with 1% BSA, 0.1% TritonX-100 blocking solution at room temperature for 1 h, and incubated with primary antibody anti-rabbitKCC2 (Millipore, 07-432) at 1:500 at 4°C overnight. The next day, secondary antibody Goatanti-Rabbit IgG (H+L) Alexa FluorTMPlus 555 (Invitrogen, A32732) was added at 1:1000, incubated at room temperature for 1 h, and sealed with anti-fading mounting medium containing DAPI, and observed and photographed with a fluorescence microscope (Olympus, IX71). Fiji ImageJ software was used to perform average optical density statistics, and the changes in the levels of KCC2 protein in neurons of different groups relative to the NC group were calculated.

[0199] The results are as follows Figure 4 As shown, in the groups of neuronal cells infected by various recombinant adeno-associated viruses, the expression level of KCC2 on the neuronal cell membrane in the two groups of ss-AAV2 / 9-mMeCp2-KCC2-BGH polyA and ss-AAV2 / 9-shortMeCp2-KCC2-BGH polyA was significantly higher than the expression level of KCC2 in the positive control ss-AAV2 / 9-syn-KCC2-BGH polyA group, and was also much higher than the expression level of KCC2 protein in other recombinant adeno-associated virus vector infection groups. It is worth noting that although mNFH is also a promoter known in the art that can drive the expression of exogenous genes in the nervous system, ss-mNFH-KCC2-syntheticpolyA did not show the expected effect.

[0200] The above results indicate that the expression cassette formed by the combination of mMeCp2 or short mMeCp2 and BGH polyA in the technical solution of the present application can significantly increase the level of KCC2 protein on the cell membrane of primary neurons when delivered via an adeno-associated virus vector, compared with the expression cassette formed by the combination of Syn promoter and BGH poly A and the expression cassette formed by the combination of other promoters and poly A used in the prior art, and has a surprising and better in vitro effect.

[0201] 2. In vitro biological activity detection

[0202] In this example, the intracellular chloride ions (Cl - ) levels to evaluate the in vitro activity of the above different recombinant viral vectors. The biological function of KCC2 protein is to convert intracellular Cl - Transported to the extracellular space, maintaining a low Cl - concentration. Therefore, Cl - The efflux activity of KCC2 is an important indicator for evaluating the biological activity of KCC2 protein. Among them, SuperClomeleon (see Grimley, JS; Li, L.; Wang, W.; Wen, L.; Beese, LS; Hellinga, HW; Augustine, GJ (2013). Visualization of Synaptic Inhibition with an Optogenetic Sensor Developed by Cell-Free Protein Engineering Automation. Journal of Neuroscience, 33 (41), 16297–16309.) technology was used to evaluate the intracellular Cl- SuperClomeleon is a fluorescent protein composed of a CFP mutant and a YFP mutant expressed in cells, which can be used as a marker for intracellular chloride ions (Cl - ) concentration changes of fluorescent reporter molecules. - Binding to SuperClomeleon will cause its conformational change, and the fluorescence resonance energy transfer (FRET) efficiency between the two fluorescent protein variants will change. By detecting this change, it can be reflected that SuperClomeleon and Cl - The excitation wavelength of the detection is 440nm, and the emission wavelengths are 485nm and 535nm. The efficiency of FRET is characterized by the ratio value of 535nm / 485nm, which is used as an indicator of the intracellular chloride ion level. The final result graph sets the result of the negative control (NC) as 1, and compares the multiples of the results of other recombinant adeno-associated viruses relative to the negative control.

[0203] First, a lentivirus expressing SuperClomeleon was packaged. Then, primary cortical neurons of P0 rats were isolated in vitro, and the recombinant adeno-associated viruses ssAAV 2 / 9-Syn-KCC2-BGH polyA, ssAAV 2 / 9-mNFH-KCC2-synthetic polyA, ssAAV 2 / 9-mMeCp2-KCC2-BGH polyA, ssAAV 2 / 9-mMeCp2-KCC2-synthetic polyA, ssAAV 2 / 9-short mMeCp2-KCC2-BGH polyA, ssAAV 2 / 9-shortmMeCp2-KCC2-sythetic polyA obtained by packaging in Example 2 were added. PolyA was used to infect neurons at the same MOI (1E+6). The negative control group (NC) was prepared by adding the same volume of virus solvent to the neuronal cells and culturing them in a 37°C, 5% CO2 incubator. Five days after infection, lentivirus expressing SuperClomeleon (MOI=2.5) was added to infect neurons. After 48 hours, the fluorescence intensity was detected by a microplate reader, and the ratio of 535nm / 485nm was calculated to compare the chloride ion efflux activity of recombinant adeno-associated viruses carrying expression frames containing different promoters and PolyA combinations and KCC2.

[0204] The results are as follows Figure 5As shown in the figure, among all the recombinant adeno-associated virus vectors, the recombinant adeno-associated virus vectors ssAAV2 / 9-mMeCp2-KCC2-BGHpolyA and ssAAV2 / 9-shortmMeCp2-KCC2-BGHpolyA have the highest chloride ion efflux activity, which is significantly better than the positive control ss-AAV2 / 9-syn-KCC2-BGH polyA and other recombinant adeno-associated virus molecules. This result is also consistent with the results obtained in the immunofluorescence experiment.

[0205] The above results further confirmed that the expression cassette carrying the combination of mMeCp2 or shortmMeCp2 promoter and BGH polyA used in the technical solution of the present application has surprising and better in vitro activity.

[0206] Example 4: In vivo efficacy evaluation

[0207] In order to further evaluate and verify the in vivo effect of the combination of the present invention, an in vivo efficacy evaluation experiment was performed.

[0208] 1. Evaluation of motor function recovery in model animals

[0209] First, C57BL / 6 mice, 8 weeks old, female, were anesthetized with 1% sodium pentobarbital at a dose of 65 mg / kg. Then, a spinal cord injury model with bilateral lower limb paralysis was created by bilateral hemisection of T7 and T10 (Chen, Bo et al., (2018), Cell, 174 (6) 1599. doi: 10.1016). In short, two transverse hemisections were performed simultaneously at the thoracic vertebrae T7 and T10 of the mouse, with the T10 transverse hemisection ending at the midline of the spinal cord and the T7 transverse hemisection located on the contralateral side of the T10 injury, slightly beyond the midline of the spinal cord. After modeling, the virus solvent (as a model control group) or the recombinant adeno-associated virus vector of the present application (taking ssAAV 2 / 9-shortmMeCp2-KCC2-BGH polyA as an example) and the positive control ssAAV 2 / 9-Syn-KCC2-BGHpolyA were injected through the tail vein at 200 μL each, with an injection dose of 1E+12 vg / animal, and antibiotics were injected for 2 consecutive days after surgery to prevent infection. The recovery of animal motor function was evaluated by BMS behavioral score (see Table 4 for scoring criteria) every week, and the observation period was 5 weeks.

[0210] Table 4

[0211]

[0212]

[0213] Evaluation results such as Figure 6As shown in Figure 2, during the entire administration period, the BMS behavioral scores of mice in the ssAAV 2 / 9-short mMeCp2-KCC2-BGHpolyA and positive control groups were significantly higher than those in the model control group (i.e. Figure 6 "Model" in the text). On the 28th day, the BMS behavioral score of mice in the ssAAV 2 / 9-shortmMeCp2-KCC2-BGHpolyA group was even slightly higher than that of the positive control group (ss-AAV 2 / 9-Syn-KCC2-BGH polyA); on the 35th day, it was basically the same as the positive control. The above results further verify that the expression cassette carrying mMeCp2 or a combination of short mMeCp2 and BGH polyA in the technical solution of the present application can also effectively restore the motor function of mice with spinal cord injury in vivo.

[0214] 2. Animal survival rate test

[0215] The establishment of the mouse model and the drug administration process are as described above. The survival rate of mice is detected and calculated every week. The observation period is 5 weeks, where the survival rate = the number of animals surviving per week / the total number of animals that were initially modeled and dosed (expressed as a percentage). In this experiment, ssAAV 2 / 9-shortmMeCp2-KCC2-BGHpolyA is also used as an example.

[0216] Animal survival test results Figure 7 As shown, during the entire administration period, the survival rate of mice in the ssAAV 2 / 9-short mMeCp2-KCC2-BGH polyA infection group was significantly higher than that in the positive control group (ss-AAV 2 / 9-Syn-KCC2-BGHpolyA). This result shows to a certain extent that the expression cassette carrying the combination of mMeCp2 or shortmMeCp2 promoter and BGH polyA is safer than other promoter and polyA combinations in the prior art, which has great advantages in future clinical applications.

[0217] The above in vivo experiments further confirmed that the expression cassette carrying a combination of mMeCp2 or shortmMeCp2 and BGH polyA used in the technical solution of the present application has surprising and better activity and safety.

Claims

1. A recombinant nucleic acid molecule, characterized in that The recombinant nucleic acid molecule comprises a promoter, a nucleic acid sequence encoding a KCC2 protein and a polyadenylic acid sequence (polyA), wherein the promoter is derived from the mMeCp2 promoter.

2. The recombinant nucleic acid molecule according to claim 1, characterized in that The sequence of the mMeCp2 promoter is shown in SEQ ID NO: 7 or SEQ ID NO:

8.

3. The recombinant nucleic acid molecule according to claim 1 or 2, characterized in that The polyadenylation sequence is BGHpoly A, and its sequence is shown in SEQ ID NO:

5.

4. The recombinant nucleic acid molecule according to claim 1, characterized in that: The KCC2 protein is a full-length KCC2a protein, and its amino acid sequence is shown in SEQ ID NO:

3.

5. The recombinant nucleic acid molecule according to claim 4, characterized in that The sequence of the nucleic acid molecule encoding the KCC2 protein is selected from: 1) the polynucleotide sequence shown in SEQ ID NO: 2; 2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO: 2; or 3) A polynucleotide sequence having more than 80% sequence identity with SEQ ID NO: 2, preferably a sequence having 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity; more preferably, a sequence having 98% or 99% or more identity; more preferably, the polynucleotide sequence is a codon-optimized sequence.

6. The recombinant nucleic acid molecule according to any one of claims 1 to 5, characterized in that The recombinant nucleic acid molecule further comprises one or more of the following regulatory elements: Kozak sequence, WPRE and post-transcriptional regulatory element.

7. The recombinant nucleic acid molecule according to any one of claims 1 to 6, characterized in that The recombinant nucleic acid molecule has a polynucleotide sequence selected from the following: 1) the polynucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 13; 2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides of the polynucleotide sequence shown in SEQ ID NO: 11 or SEQ ID NO: 13; or 3) A polynucleotide sequence having more than 80% sequence identity with SEQ ID NO: 11 or SEQ ID NO: 13, preferably a sequence having 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity; more preferably, a sequence having 98% or 99% or more identity.

8. The recombinant nucleic acid molecule according to any one of claims 1 to 7, characterized in that The recombinant nucleic acid molecule also contains an AAV inverted terminal repeat sequence; preferably, the AAV inverted terminal repeat sequence is selected from AAVs of different serotypes; preferably, the AAV inverted terminal repeat sequence is selected from AAVs of any serotype in evolutionary branch AF or any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or their hybrid / chimeric types; more preferably, the AAV inverted terminal repeat sequence is from AAV2.

9. A recombinant vector, characterized in that: The recombinant vector comprises the recombinant nucleic acid molecule described in any one of claims 1-7, wherein the vector is selected from a plasmid vector, a phage vector and a viral vector, wherein the viral vector is selected from an adeno-associated viral vector, an adenoviral vector, a lentiviral vector and a hybrid viral vector.

10. A recombinant adeno-associated virus, characterized in that: The recombinant adeno-associated virus comprises an AAV capsid and a vector genome, and the vector genome comprises the recombinant nucleic acid molecule according to any one of claims 1 to 8.

11. The recombinant adeno-associated virus according to claim 10, characterized in that: The capsid of the recombinant adeno-associated virus is derived from AAV of any serotype in AAV clade AF or any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or their hybrid / chimeric types, preferably, derived from AAV9.

12. An isolated host cell, characterized in that The cell comprises the recombinant nucleic acid molecule according to any one of claims 1 to 8, the recombinant vector according to claim 9, or the recombinant adeno-associated virus according to claim 10 or 11.

13. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the recombinant nucleic acid molecule according to any one of claims 1 to 8, the recombinant vector according to claim 9, the recombinant adeno-associated virus according to claim 10 or 11 and / or the host cell according to claim 12, and a pharmaceutically acceptable excipient.

14. The pharmaceutical composition according to claim 13, characterized in that The pharmaceutical composition is formulated for administration by intravenous, intrathecal, intracerebroventricular, intraspinal, intrathoracic, oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intramuscular, intraperitoneal and / or other parenteral routes.

15. The pharmaceutical composition according to claim 13 or 14, characterized in that The pharmaceutical composition may also include other drugs that can be used to treat spinal cord injury.

16. Use of the recombinant nucleic acid molecule according to any one of claims 1 to 8, the recombinant vector according to claim 9, the recombinant adeno-associated virus according to claim 10 or 11, the host cell according to claim 12 and / or the pharmaceutical composition according to any one of claims 13 to 15 in the preparation of a medicament for preventing or treating spinal cord injury.

17. The use according to claim 16, characterized in that The recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or pharmaceutical composition may be administered in combination with another therapy.

18. The use according to claim 16 or 17, characterized in that The recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and / or pharmaceutical composition can be prepared in an amount of about 1×10 6 vg / kg to about 1×10 18 vg / kg; preferably, the recombinant adeno-associated virus can be administered at a dose of about 5×10 12 vg / kg; preferably, the recombinant adeno-associated virus can be administered at a dose of about 5×10 11 vg / kg; preferably, the vector or composition can be administered more than once.

19. A method for treating spinal cord injury, characterized in that: The method comprises administering to a subject in need of treatment a recombinant nucleic acid molecule according to any one of claims 1 to 8, a recombinant vector according to claim 9, a recombinant adeno-associated virus according to claim 10 or 11, a host cell according to claim 12, and / or a pharmaceutical composition according to any one of claims 13 to 15; preferably, the composition is administered intravenously, intrathecally or intraspinally; preferably, the subject is a mammal; more preferably, the subject is a human.

20. The method according to claim 19, characterized in that The method may also be used in conjunction with other therapies.

Images