Kit for detecting various nucleic acids based on crispr / cas12a combined with universal crna

By using a kit that combines CRISPR/Cas12a with universal crRNA, and leveraging the trans-cleavage activity of Cas12a and one-step isothermal amplification technology, the problems of crRNA instability and high cost are solved, enabling high-sensitivity detection of various viral DNA and RNA, suitable for POCT products.

CN119144704BActive Publication Date: 2025-11-11BEIJING TECH & BUSINESS UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310711635.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-15
Publication Date
2025-11-11
Estimated Expiration
2043-06-15

AI Technical Summary

Technical Problem

In existing CRISPR/Cas systems, crRNA is unstable and expensive, and one crRNA can only detect one viral target, which increases the difficulty and cost of detection.

Method used

A kit based on CRISPR/Cas12a and pluripotent crRNA was used to detect multiple viral DNA and RNAs using a single crRNA, leveraging the trans-cleavage activity of Cas12a and one-step isothermal amplification technology.

Benefits of technology

It achieves high-sensitivity detection of various viral DNA and RNA, reduces the cost and design difficulty of crRNA, and is suitable for POCT product development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119144704B_ABST
    Figure CN119144704B_ABST
Patent Text Reader

Abstract

The application discloses a kit for multiple nucleic acid detection based on CRISPR / Cas12a combined with universal crRNA, and belongs to the field of nucleic acid detection, and comprises crRNA, Cas12a, buffer 3.1, buffer 2, RNAase inhibitor, Bst DNA polymerase and dNTP mixed solution. The application utilizes the Cas12a trans-cleavage activity, and for the first time, a single type of crRNA is applied to nucleic acid detection of different types of viruses. Using the same crRNA, multiple viral nucleic acids, including but not limited to SARS-CoV-2, multiple subtypes of HPV viruses and tumor marker miRNA, etc. can be detected. The application widens the design ideas and methods of CRISPR / Cas nucleic acid detection, and has good analysis performance. Under optimized experimental conditions, the same crRNA can be used to effectively detect multiple DNA viruses and RNA viruses, and has high sensitivity, and can detect a concentration of 5 pM. Taking HPV-16 pseudovirus as an example, actual sample detection is carried out.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a reagent kit, specifically a reagent kit for detecting multiple nucleic acids based on CRISPR / Cas12a combined with pluripotent crRNA, belonging to the field of nucleic acid detection. Background Technology

[0002] Nucleic acids, including DNA and RNA, are carriers of genetic information and can serve as biomarkers for diagnosing various diseases, such as cancer and infectious diseases caused by pathogens. Nucleic acid molecular diagnostics offers advantages such as high sensitivity, real-time performance, and ease of operation, making it crucial for the early screening and diagnosis of cancer and infectious diseases caused by pathogens. Currently, commonly used nucleic acid detection methods mainly include gene sequencing and nucleic acid amplification detection.

[0003] Most existing nucleic acid detection methods are complex and rely on expensive equipment. The CRISPR / Cas system, hailed as the "gene scissors," has shown great potential and advantages in nucleic acid detection. Clustered regularly interspaced short palindromic repeats (CRISPR) are an acquired immune system in bacteria, forming the CRISPR / Cas system with Cas proteins. Among them, Cas12a, Cas13a, and Cas14a, after specifically recognizing target molecules, activate "trans-cleavage" activity, continuing to non-specifically cleave other single-stranded DNA (ssDNA) or RNA.

[0004] crRNA is extremely unstable and expensive in the environment. Traditional CRISPR / Cas systems use crRNA designed for specific viral target nucleic acids; one crRNA can only detect one viral target. Different crRNAs need to be designed for different viral targets, significantly increasing the difficulty and cost of detection. This invention overcomes this difficulty by using the same crRNA. It only requires binding a short-chain DNA or RNA target to a long track strand, followed by a single amplification step to obtain double-stranded DNA. This amplified double-stranded DNA region contains the binding region of the universal crRNA, which is then recognized by Cas12a and cleaves the reporter, generating a signal. This allows for the detection of multiple viral targets using a single crRNA. Summary of the Invention

[0005] In view of this, the present invention provides a kit for the detection of multiple nucleic acids based on CRISPR / Cas12a combined with universal crRNA. It utilizes the trans-cleavage activity of Cas12a and one-step isothermal amplification to achieve the purpose of using a single crRNA to recognize different targets, thereby detecting multiple viral DNA and RNA.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] This kit for detecting multiple nucleic acids based on CRISPR / Cas12a combined with universal crRNA includes, by concentration in the system: 0.5 μL 20 μM crRNA (500 nM), 0.5 μL 10 μM Cas12a protein (250 nM), 7.5 μL Buffer 3.1, 0.5 μL RNase inhibitor, 1 μL 10 μM reporter (500 nM), 6.25 μL Buffer 2, 1 μL 1 μM Track chain (100 nM), 0.75 μL 8000 units / ml Bst DNA polymerase (0.375 units / μL), and 1 μL 10 mM dNTP solution (250 μM). The concentrations in parentheses are those in the detection system.

[0008] Based on the above technical solution, the present invention can be further improved as follows:

[0009] Furthermore, the sequence of the crRNA is: UAA UUU CUA CUC UUG UAG AU GUAA CUA GCA AGAAUA CCA C.

[0010] Furthermore, the sequence of the reporter is: 5'-Texas Red-TGG GAT ATC TTT AAT TTT ATTTTA ACA AGA TAT CCC A-BHQ2-3'.

[0011] Furthermore, the Cas12a protein is a Cpf1 endonuclease.

[0012] Furthermore, the RNase inhibitor is a recombinant obtained from a porcine liver RNase inhibitor purified from Escherichia coli.

[0013] Furthermore, the Bst DNA polymerase was prepared from an Escherichia coli strain containing a gene fusion of a Lactobacillus acidophilus DNA polymerase gene lacking a 5ˊ→3ˊ exonuclease structure and a gene encoding Escherichia coli maltose-binding protein (MBP). The fusion protein was purified to near homogeneity, the fused MBP portion was lysed in vitro, and the remaining polymerase was purified to be free of MBP.

[0014] Furthermore, the dNTP solution is an equimolar solution of ultrapure dATP, dCTP, dGTP, and dTTP.

[0015] The method of using the above-mentioned reagent kit of the present invention can be referred to as follows:

[0016] The Track chain, target, and Buffer 2 from the universal crRNA nucleic acid detection reagent were added to a centrifuge tube. The mixture was annealed from 95°C to 25°C to form a secondary structure. 0.75 μL of 8000 units / ml Bst DNA polymerase and 1 μL of 10 mM dNTP solution were added, and the reaction was carried out at 37°C for 45 min. The Bst polymerase was then inactivated by heating to 85°C and cooled to room temperature. Subsequently, 0.5 μL of 20 μM crRNA, 0.5 μL of 10 μM Cas12a protein, 7.5 μL of Buffer 3.1, 0.5 μL of RNase inhibitor, and 1 μL of 10 μM reporter were added. The resulting mixture was placed in a real-time fluorescence PCR instrument and reacted at 47°C for 8000 s, during which real-time fluorescence signals were collected.

[0017] The beneficial effects of this invention are as follows:

[0018] 1. This invention is the first to utilize a single crRNA to detect different DNA or RNA viruses, expanding the scope of CRISPR / Cas nucleic acid detection. It is suitable for POCT product development, overcoming the previous limitation that a single crRNA could only detect one type of viral nucleic acid, reducing costs, and simplifying design.

[0019] 2. The kit of the present invention can be used for the detection of various DNA and RNA viruses and has good analytical performance. Taking the novel coronavirus, HPV virus nucleic acid and tumor miRNA as examples, it can detect as low as 5pM.

[0020] 3. This invention can effectively detect HPV-16 pseudoviruses. Attached Figure Description

[0021] Figure 1 This is a diagram showing the results of detecting the S13 gene of COVID-19 in Example 2 of the present invention;

[0022] Figure 2 This is a diagram showing the results of the amplification solution concentration, amplification time, and detection of the SARS-CoV-2 S13 gene in Example 3 of the present invention.

[0023] Figure 3 Example 4 of this invention shows the optimized detection results of the COVID-19 S12 gene;

[0024] Figure 4 Example 5 of this invention shows the optimized detection results of the HPV-6b gene.

[0025] Figure 5 Example 6 of this invention shows the optimized detection results of the HPV-11b gene.

[0026] Figure 6Example 7 of this invention shows the optimized detection results of the HPV-16b gene;

[0027] Figure 7 Example 8 of this invention shows the optimized detection results of the HPV-31 gene;

[0028] Figure 8 Example 9 of this invention shows the optimized detection results of the HPV-33 gene;

[0029] Figure 9 Example 10 of this invention shows the optimized detection results of the HPV-45a gene;

[0030] Figure 10 Example 11 of this invention shows the optimized detection results of the HPV-52 gene;

[0031] Figure 11 Example 12 of this invention shows the optimized detection results of the HPV-58 gene;

[0032] Figure 12 Example 13 of this invention shows the optimized detection results of the HCOV-NL63 gene;

[0033] Figure 13 Example 14 of this invention shows the optimized detection results of the HCOV-OC43 gene;

[0034] Figure 14 Example 15 of this invention shows the optimized detection results of the HRSV gene;

[0035] Figure 15 Example 16 of this invention shows the optimized detection results of the HCOV-HKU1 gene;

[0036] Figure 16 Example 17 of this invention shows the optimized detection results of the miRNA-141 gene;

[0037] Figure 17 The above is the optimized actual sample detection result for Example 18 of the present invention. Detailed Implementation

[0038] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0039] In the following examples, the nucleic acid sequences used are shown in Tables 1-2, which were synthesized by Shanghai Sangon Biotech Co., Ltd. and purified by HPLC.

[0040] Table 1 shows the nucleic acid sequences used for DNA and RNA virus detection in this invention.

[0041]

[0042]

[0043]

[0044] Table 2 shows the nucleic acid sequences used in the actual sample testing of this invention.

[0045]

[0046]

[0047] Lba Cas12a, buffer 2, buffer 3.1, Bst DNA polymerase and dNTP solution were purchased from NEB Beijing;

[0048] RNase inhibitor was purchased from Takara, and DEPC-treated water was purchased from Shanghai Sangon Biotech Co., Ltd.

[0049] Fluorescence signals were acquired using a BIO-GENER Q3200 real-time fluorescence PCR instrument;

[0050] Unless otherwise specified, all other instruments or reagents are commonly used in this field.

[0051] Example 1

[0052] This kit for detecting multiple nucleic acids based on CRISPR / Cas12a combined with universal crRNA includes, in concentrations per unit volume: 0.5 μL 20 μM crRNA (500 nM), 0.5 μL 10 μM Cas12a protein (250 nM), 7.5 μL Buffer 3.1, 0.5 μL RNase inhibitor, 1 μL 10 μM reporter (500 nM), 6.25 μL Buffer 2, 1 μL 1 μM Track strand (100 nM), 0.75 μL 8000 units / ml Bst DNA polymerase (0.375 units / μL), and 1 μL 10 mM dNTP solution (250 μM).

[0053] Wherein, the concentration in parentheses is the concentration in the detection system;

[0054] The crRNA sequence is: UAA UUU CUA CUC UUG UAG AU G UAA CUA GCA AGA AUA CCA C;

[0055] The reporter's sequence is: 5'-Texas Red-TGG GAT ATC TTT AAT TTT ATT TTA ACA AGATAT CCC A-BHQ2-3';

[0056] Cas12a protein is a Cpf1 endonuclease;

[0057] The RNase inhibitor was a recombinant obtained from a porcine liver RNase inhibitor purified from Escherichia coli;

[0058] Bst DNA polymerase fragments were prepared from a strain of Escherichia coli containing a gene fusion of the Lactobacillus acidophilus DNA polymerase gene lacking a 5′→3′ exonuclease structure and the gene encoding the Escherichia coli maltose-binding protein (MBP). The fusion protein was purified to near homogeneity, the fused MBP portion was cleaved in vitro, and the remaining polymerase was purified to be free of MBP.

[0059] dNTP solution is an equimolar solution of ultrapure dATP, dCTP, dGTP and dTTP;

[0060] The steps for nucleic acid detection using the above-mentioned kit are as follows:

[0061] 1 μL of 1 μM Track strand (100 nM), 1 μL of target, and 6.25 μL of buffer 2 from the universal crRNA nucleic acid detection reagent were added to a centrifuge tube and annealed from 95 °C to 25 °C to form secondary structures. Then, 0.75 μL of 8000 units / mL Bst DNA polymerase (0.375 units / μL) and 1 μL of 10 mM dNTP solution (250 μM) were added, and the reaction was carried out at 37 °C for 45 min, followed by heating to 85 °C and finally cooling to room temperature. Next, 0.5 μL of 20 μM crRNA, 0.5 μL of 10 μM Cas12a protein, 7.5 μL of buffer 3.1, 0.5 μL of RNase inhibitor, and 1 μL of 10 μM reporter (500 nM) were added. The resulting mixture was placed in a real-time fluorescence PCR instrument and reacted at 47 °C for 8000 s, and fluorescence signals were collected.

[0062] Example 2

[0063] The target in Example 1 was replaced with the SARS-CoV-2-S13 (COVID-19 S13) gene, and the target chain was replaced with different concentrations (5nM, 50pM, 5pM, 0) of the COVID-19 S13 genome. The detection was performed according to the method in Example 1, and fluorescence signals were collected.

[0064] The results are as follows Figure 1 , Figure 1Real-time fluorescence intensity curves and bar charts for different concentrations.

[0065] Depend on Figure 1 It can be seen that as the concentration of SARS-CoV-2-S13 genome increases, the fluorescence value also increases, and the lowest detectable target concentration is 5pM, but the gradient is not obvious.

[0066] Example 3

[0067] Amplification process optimization experiment

[0068] 1 μL of 1 μM Track strand (100 nM), 1 μL of SARS-CoV-2-S13 genomic target (5 nM, 500 pM, 50 pM, 5 pM, 0), and 6.25 μL of buffer 2 were added to a centrifuge tube for annealing, cooling from 95 °C to 25 °C to form secondary structures. Then, (0.75 μL, 0.5 μL) of 8000 units / mL Bst DNA polymerase (0.375 units / μL, 0.1875 units / μL) and (1 μL, 2 μL, 4 μL) of 10 mM dNTP solution (250 μM, 500 uM, 1 mM) were added, and the mixture was incubated at 37 °C for 30 min, 45 min, and 60 min, respectively. The temperature was then increased to 85 °C and finally cooled to room temperature. Finally, 0.5 μL of 20 μM crRNA and 0.5 μL of buffer 2 were added. 10 μM Cas12a protein, 7.5 μL buffer 3.1, 0.5 μL RNase inhibitor, and 1 μL 10 μM reporter (500 nM) were added to a real-time fluorescence PCR instrument and reacted at 47 °C for 8000 s. Fluorescence signals were collected, and the results are as follows. Figure 2 .

[0069] Depend on Figure 2 It can be seen that during the amplification process, such as Figure 2 (A) The optimal amplification time is 45 minutes, such as Figure 2 (B) The optimal concentration of Bst DNA polymerase is 0.375 units / μL, such as Figure 2 (C) The optimal concentration of 10 mM dNTP solution is 250 μM, such as Figure 2 (D) Under optimal amplification conditions, the fluorescence value increases with the increase of the target concentration of the SARS-CoV-2 S13 genome.

[0070] Example 4

[0071] The target in Example 1 was replaced with the SARS-CoV-2-S12 gene.

[0072] 1 μL of 1 μM Track strand (100 nM), 1 μL of SARS-CoV-2-S12 target strand (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0), and 6.25 μL of Buffer 2 were added to a centrifuge tube for annealing, cooling from 95 °C to 25 °C to form secondary structures. Then, 0.75 μL of 8000 units / mL Bst DNA polymerase (0.375 units / μL) and 1 μL of 10 mM dNTP solution (250 μM) were added, and the reaction was carried out at 37 °C for 45 min. The temperature was then increased to 85 °C and finally cooled to room temperature. Subsequently, 0.5 μL of 20 μM crRNA, 0.5 μL of 10 μM Cas12a protein, 7.5 μL of Buffer 3.1, and 0.5 μL of Buffer 2 were added. RNase inhibitor, 1 μL 10 μM reporter (500 nM), and the resulting mixture were placed in a real-time fluorescence PCR instrument and reacted at 47 °C for 8000 s. Fluorescence signals were then collected.

[0073] The results are as follows Figure 3 , Figure 3 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0074] Depend on Figure 3 (A) indicates that as the concentration of the SARS-CoV-2-S12 genome increases, the fluorescence value also increases. Figure 3 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM SARS-CoV-2-S12 target, so the target DNA concentration of 5pM can be detected at the lowest.

[0075] Example 5

[0076] Replace the target of Example 1 with the HPV-6b gene, 1 μL of HPV-6b target chain (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0), and operate according to the procedure of Example 4, and collect fluorescence signals.

[0077] The results are as follows Figure 4 , Figure 4 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0078] Depend on Figure 4 (A) indicates that as the concentration of the HPV-6b genome increases, the fluorescence value also increases. Figure 4 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HPV-6b target, so the target DNA concentration of 5pM can be detected at the lowest.

[0079] Example 6

[0080] Replace the target of Example 1 with the HPV-11b gene, 1 μL of HPV-11b target chain (50 nM, 5 nM, 0), and operate according to the procedure of Example 4, and collect fluorescence signals.

[0081] The results are as follows Figure 5 , Figure 5 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0082] Depend on Figure 5 (A) indicates that as the concentration of the HPV-11b genome increases, the fluorescence value also increases. Figure 5 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5nM HPV-11b target, so the target DNA concentration of 5nM can be detected at the lowest.

[0083] Example 7

[0084] Replace the target of Example 1 with the HPV-16b gene, 1 μL of HPV-16b target chain (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0), and operate according to the procedure of Example 4, and collect fluorescence signals.

[0085] The results are as follows Figure 6 , Figure 6 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0086] Depend on Figure 6 (A) indicates that as the concentration of the HPV-16b genome increases, the fluorescence value also increases. Figure 6 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HPV-16b target, so the target DNA concentration of 5pM can be detected at the lowest.

[0087] Example 8

[0088] Replace the target of Example 1 with the HPV-31 gene, 1 uL of HPV-31 target chain (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0), and operate according to the procedure of Example 4 to collect fluorescence signals.

[0089] The results are as follows Figure 7 , Figure 7 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0090] Depend on Figure 7 (A) indicates that as the concentration of the HPV-31 genome increases, the fluorescence value also increases. Figure 7 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HPV-31 target, so the target DNA concentration of 5pM can be detected at the lowest.

[0091] Example 9

[0092] Replace the target of Example 1 with the HPV-33 gene, 1 uL of HPV-33 target chain (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0), and operate according to the procedure of Example 4 to collect fluorescence signals.

[0093] The results are as follows Figure 8 , Figure 8 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0094] Depend on Figure 8 (A) It can be seen that as the concentration of HPV-33 genome increases, the fluorescence value also increases. Figure 8 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HPV-33 target, so the target DNA concentration of 5pM can be detected at the lowest.

[0095] Example 10

[0096] Replace the target of Example 1 with the HPV-45a gene, 1 μL of HPV-45a target chain (50 nM, 5 nM, 500 pM, 50 pM, 0), and operate according to the procedure of Example 4 to collect fluorescence signals.

[0097] The results are as follows Figure 9 , Figure 9 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0098] Depend on Figure 9 (A) It can be seen that as the concentration of HPV-45a genome increases, the fluorescence value also increases. Figure 9 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 50pM HPV-45a target, so the target DNA concentration of 50pM can be detected at the lowest.

[0099] Example 11

[0100] Replace the target of Example 1 with the HPV-52 gene, 1 uL of HPV-52 target chain (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0), and follow the procedure in Example 4 to collect fluorescence signals.

[0101] The results are as follows Figure 10 , Figure 10 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0102] Depend on Figure 10 (A) It can be seen that as the concentration of HPV-52 genome increases, the fluorescence value also increases. Figure 10(B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HPV-52 target, so the target DNA concentration of 5pM can be detected at the lowest.

[0103] Example 12

[0104] Replace the target of Example 1 with the HPV-58 gene, and follow the procedure in Example 4 to collect fluorescence signals.

[0105] The results are as follows Figure 11 , Figure 11 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0106] Depend on Figure 11 (A) It can be seen that as the concentration of HPV-58 genome increases, the fluorescence value also increases. Figure 11 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 50pM HPV-58 target, so the target DNA concentration of 50pM can be detected at the lowest.

[0107] Example 13

[0108] Replace the target of Example 1 with the HCOV-NL63 gene, 1 μL of HCOV-NL63 target chain (50 nM, 5 nM, 50 pM, 5 pM, 0), and operate according to the procedure of Example 4 to collect fluorescence signals.

[0109] The results are as follows Figure 12 , Figure 12 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0110] Depend on Figure 12 (A) It can be seen that as the HCOV-NL63 genome concentration increases, the fluorescence value also increases accordingly. Figure 12 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HCOV-NL63 target, so the target DNA concentration of 5pM can be detected at the lowest.

[0111] Example 14

[0112] Replace the target of Example 1 with the HCOV-OC43 gene, 1 μL of HCOV-OC43 target chain (50 nM, 5 nM, 500 pM, 0), and operate according to the procedure of Example 4 to collect fluorescence signals.

[0113] The results are as follows Figure 13 , Figure 13 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0114] Depend on Figure 13 (A) It can be seen that as the HCOV-OC43 genome concentration increases, the fluorescence value also increases accordingly. Figure 13 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HCOV-OC43 target, so the target DNA concentration of 500pM can be detected at the lowest.

[0115] Example 15

[0116] Replace the target of Example 1 with the HRSV gene, 1 uL of HRSV target chain (50 nM, 5 nM, 500 pM, 0), and follow the procedure in Example 4 to collect fluorescence signals.

[0117] The results are as follows Figure 14 , Figure 14 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0118] Depend on Figure 14 (A) It can be seen that as the HRSV genome concentration increases, the fluorescence value also increases accordingly. Figure 14 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HRSV target, so the target DNA concentration of 500pM can be detected at the lowest.

[0119] Example 16

[0120] Replace the target of Example 1 with the HKU1 gene, 1 uL of HKU1 target chain (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0), and operate according to the procedure of Example 4 to collect fluorescence signals.

[0121] The results are as follows Figure 15 , Figure 15 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0122] Depend on Figure 15 (A) It can be seen that as the concentration of the HKU1 genome increases, the fluorescence value also increases. Figure 15 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM HKU1 target, so the target DNA concentration of 5pM can be detected at the lowest.

[0123] Example 16

[0124] Replace the target of Example 1 with the miRNA-141 gene.

[0125] 1 μL of miRNA-141 target strand (50 nM, 5 nM, 500 pM, 50 pM, 5 pM, 0) was collected by following the procedure in Example 4, and fluorescence signals were acquired.

[0126] The results are as follows Figure 15 , Figure 15 Real-time fluorescence intensity curves and bar charts for different concentrations.

[0127] Depend on Figure 15 (A) It can be seen that as the concentration of miRNA-141 increases, the fluorescence value also increases accordingly. Figure 15 (B) It can be seen that the fluorescence value of the amplification control is significantly different from that of the 5pM miRNA target, so the target RNA can be detected at a minimum concentration of 5pM.

[0128] Example 17

[0129] Actual sample testing.

[0130] HPV-16 pseudovirus was selected, and the target nucleic acid sequence fragment was extracted from the virus culture, nucleic acid extraction, and PCR amplification. The fragment was then detected using the kit and method described in Example 1. The results are as follows: Figure 16 It has good analytical performance.

[0131] As demonstrated in the above examples, this invention utilizes Cas12a and a universal crRNA to develop a simple and sensitive method for detecting DNA and RNA viruses. The innovation of this study lies in using a single crRNA to detect multiple DNA and RNA targets, significantly reducing crRNA costs and design complexity. This method is suitable for point-of-care testing (POCT) and enables the development of nucleic acid detection products with significant application value.

Claims

1. A kit for detecting multiple nucleic acids based on CRISPR / Cas12a combined with universal crRNA, characterized in that, The system contained the following concentrations: 0.5 μL of 20 μM crRNA (final concentration 500 nM), 0.5 μL of 10 μM Cas12a protein (final concentration 250 nM), 7.5 μL of NEB buffer 3.1, 0.5 μL of RNase inhibitor, 1 μL of 10 μM reporter (final concentration 500 nM), 6.25 μL of NEB buffer 2, 1 μL of 1 μM Track chain (final concentration 100 nM), 0.75 μL of 8000 units / mL Bst DNA polymerase (0.375 units / μL), and 1 μL of 10 mM dNTP solution (final concentration 250 μM). The sequence of the crRNA is: UAA UUU CUA CUC UUG UAG AU G UAA CUA GCAAGAAUA CCA C The sequence of the Track chain is any of the following sequences: HPV-6b-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACACTTACACCCACACCTAATGGCTG HPV-11b-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACCCCACTAACACCAACGCCTAAAGG HPV-16-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACTTACAACCTTAGATACTGGGACAG HPV-31-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACTTACAACTTTAGACACTGGGACAG HPV-33-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACTGGCTGCCCTCTACCTATTTCAAG HPV-45a-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACATAATAGAGCCACTGGGAGAAGGG HPV-52-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACAGTGCTTACAACCTTAGAGACAGG HPV-58-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACCAACCTTAGACACAGGCACAGGAG HCOV-NL63-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACAATCCAAAACAAACAACCAACTTG HCOV-OC43-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACCAACTTCTCCTCTGCGTCCTCAAA HRSV-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACGGGTGTGGATATTTGTTTCACTAG HCOV-HKU1-track: GTAAGGATGGCTAGTGTAACTAGCAAGAATACCACGAAAGCAAGAAAAAGAAGTACGCTATTAACTATTAACGTACCAGGAATAACACCAGATGATTGGG miRNA-141-track: GTA AGG ATG GCT AGT GTA ACT AGC AAG AAT ACC ACG AAA GCA AGAAAAAGAAGT ACGCTA TTAACT ATT AAC GTA C CCA TCT TTA CCA GACAGT GTTA.

2. The reagent kit according to claim 1, characterized in that, The sequence of the reporter is: 5'-Texas Red-TGG GAT ATC TTT AAT TTT ATT TTA ACA AGA TAT CCC A-BHQ2-3'.

3. The reagent kit according to claim 1, characterized in that, The Cas12a protein is a Cpf1 endonuclease.

4. The reagent kit according to claim 1, characterized in that, The RNase inhibitor is a recombinant obtained from a porcine liver RNase inhibitor purified from Escherichia coli.

5. The reagent kit according to claim 1, characterized in that, The Bst DNA polymerase was prepared from an Escherichia coli strain containing a gene fusion of a Lactobacillus acidophilus DNA polymerase gene lacking a 5ˊ→3ˊ exonuclease structure and a gene encoding Escherichia coli maltose-binding protein (MBP). The fusion protein was purified to near homogeneity, the fused MBP portion was lysed in vitro, and the remaining polymerase was purified to be free of MBP.

6. The reagent kit according to claim 1, characterized in that, The dNTP solution is an equimolar solution of ultrapure dATP, dCTP, dGTP, and dTTP.

Citation Information

Patent Citations

  • CRISPR (Clustered regularly interspaced short palindromic repeats) / Cas12 one-step nucleic acid detection method and 2019-nCoV detection kit

    CN111593145A

  • CRISPR / Cas12f detection system and application thereof

    CN113897416A