PCR primers, kit and method for sex identification of Mule duck

Abstract

The invention provides a PCR primer, a kit and a method for sex identification of a Mule duck. PCR amplification and capillary electrophoresis are performed by using the PCR primers of the invention, and the sex of the Mule duck is determined by using the number of peaks in the capillary electrophoresis result. The invention has the advantages of simple and convenient operation, rapid and accurate identification result, convenience for grassroots promotion and use, and broad market application prospects. In addition, the detection kit developed based on the method of the invention can generate considerable economic benefits and good social value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a PCR primer, a kit and a method for sex identification of a Mule duck. Background Art

[0002] Hybrid vigor is a common genetic phenomenon in the biological world, which means that the offspring produced by the hybridization of parents with different genetic backgrounds are superior to the parents in terms of growth potential, biomass, yield and adaptability to the environment. Generally, the more distant the relationship between the parents, the more obvious the hybrid vigor. In livestock and poultry, mules, yak and mule ducks are classic examples of distant hybridization, which have made important contributions to the development of my country's animal husbandry.

[0003] Mule ducks are the offspring of a cross between a Muscovy duck (Cairina moschata) of the genus Cairina and a domestic duck (Anas platyrhynchos domestica) of the genus Anas Linnaeus, commonly known as mule ducks. Mule ducks overcome the defects of the large size difference between male and female Muscovy ducks and the long growth cycle, showing strong hybrid advantages. They have delicious meat, strong vitality, fast growth, large size, and high feed efficiency. They are very popular in South my country and Southeast Asia, with an annual output of more than 100 million. Mule ducks are also an important foie gras poultry. The new variety of "Zhongchu Changbai Mule Duck" bred in my country has an annual output of more than 20 million, accounting for about 40% of the domestic foie gras market.

[0004] Mule ducks are the offspring of distant hybridization between genera and have no reproductive ability. To produce them, parents must be raised and artificial insemination is used, which is not only cumbersome, but also has a low fertilization rate and consumes a lot of manpower and material resources. Therefore, it is of great value to study the mechanism of infertility in Mule ducks. Due to the incomplete development of gonadal organs, the secondary sexual characteristics between male and female Mule ducks are not obvious, and it is impossible to distinguish male and female by appearance alone, which brings certain difficulties to the study of the infertility mechanism of Mule ducks. Therefore, it is urgent to develop a simple and convenient method that can quickly and accurately identify the sex of Mule ducks, so as to break through the technical bottleneck of infertility in Mule ducks as soon as possible. Summary of the invention

[0005] The technical problem that the present invention aims to solve is to provide a PCR primer with a reasonable design that can be used for rapid early sex identification of Mule ducks in view of the deficiencies of the above-mentioned prior art.

[0006] The present invention achieves the purpose of the present invention through the following technical solutions:

[0007] One of the purposes of the present invention is to provide a PCR primer for sex identification, the primer sequence is as follows. That is, the nucleotide sequence of the primer is:

[0008] Forward primer: 5′-TCCAAATGCCGAAGAAATGC-3′;

[0009] Reverse primer: 5′-GTTACATTTTGTCCACCTGC-3′.

[0010] A second object of the present invention is to provide a kit comprising the PCR primers for gender identification described in the present invention.

[0011] In one embodiment of the present invention, the kit of the present invention comprises the PCR primers and PCR reaction solution of the present invention, and in some embodiments, may further comprise a DNA extraction solution.

[0012] The third object of the present invention is to provide application of the PCR primers or the kit described in the present invention in aquaculture.

[0013] A fourth object of the present invention is to provide an application of the PCR primers or the kit described in the present invention in sex identification of Mule ducks.

[0014] The application of the invention in sex identification of a Mule duck is to perform PCR amplification on the genomic DNA of the Mule duck to be tested by using the primers of the invention. The capillary electrophoresis result shows two peaks of 966 bp and 998 bp for a male Mule duck, and one peak of 966 bp for a female Mule duck.

[0015] In the method of the present invention, step 1) extracting the genomic DNA of the Mule duck to be tested can be extracted according to conventional methods in the art, for example, the genomic DNA of the Mule duck to be tested can be extracted from materials including but not limited to feathers, blood, tissues, organs, etc.

[0016] In the method described in the present invention, the PCR reaction system in step 2) can be a conventional system in the art. In a specific embodiment of the present invention, 2×PCR Mix (Nanjing Novozyme Biotechnology Co., Ltd.) 25 μL, 10 μmol / L forward and reverse primers 1 μL each, 50-100 μg / ml template DNA 2 μL, and ultrapure water 21 μL.

[0017] In the method described in the present invention, the PCR reaction program in step 2) can be a conventional system in the art. In a specific embodiment of the present invention, it is: 95°C for 5 min, (95°C for 30 s, 60°C for 30 s, 72°C for 30 s) 35 cycles, and 72°C for 3 min.

[0018] Compared with the prior art, the present invention has the following advantages: the present invention uses designed PCR primers to perform PCR amplification and capillary electrophoresis, and uses the number of peaks in the capillary electrophoresis result to determine the sex of the mule duck. The invention has the advantages of simple and convenient operation, rapid and accurate identification results, convenience for grassroots promotion and use, and broad market application prospects. In addition, the detection kit developed based on the method of the present invention can generate considerable economic benefits and good social value.

[0019] The primers of the present invention have little restriction on the species of Mule ducks, and therefore there is no restriction on the specific species of the Mule ducks described in the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figures 1 to 10 This is the capillary electrophoresis pattern of the PCR amplification products of the Mule ducks numbered 1-10 in Example 2 of the present invention. DETAILED DESCRIPTION

[0021] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0022] Example 1

[0023] 1 Identification of Mule Duck of Unknown Sex

[0024] 1.1 Sample collection

[0025] Ten young Mule ducks of unknown sex were collected, and the following primers designed by the present invention were used to amplify the Mule duck genome.

[0026] Forward primer: 5'-TCCAAATGCCGAAGAAATGC-3'; 5 ， Add FAM fluorescent label to the end.

[0027] Reverse primer: 5′-GTTACATTTTGTCCACCTGC-3′.

[0028] 1.2 PCR amplification

[0029] The PCR reaction system is:

[0030] 2×PCR Mix (Shanghai Sangon Biotechnology Co., Ltd.) 12.5 μL, 10 μmol / L forward and reverse primers 0.5 μL each, 50-100 μg / ml template DNA 1 μL, ultrapure water 10.5 μL.

[0031] The PCR reaction program was: 95°C for 5 min, 35 cycles of (95°C for 30 s, 60°C for 30 s, 72°C for 30 s), and 72°C for 3 min.

[0032] 1.3 Capillary electrophoresis detection

[0033] After the reaction, the PCR products were genotyped on the ABI 3730 analyzer, as shown in the results. Figures 1 to 10 (Among them, numbers 1, 2, 3, 5, 7, 9, and 10 are male Mule ducks, and numbers 4, 6, and 8 are female Mule ducks).

[0034] The test samples were slaughtered and dissected, and the sexual organs were observed to verify that the above identification results were 100% accurate.

Claims

1. A PCR primer for sex identification of a Mule duck, characterized in that: The primers are as follows: Forward primer: 5′- TCCAAATGCCGAAGAAATGC -3′ (SEQ ID NO. 1); Reverse primer: 5'-GTTACATTTTGTCCACCTGC -3' (SEQ ID NO. 2).

2. The PCR primer according to claim 1, characterized in that The 5' end of the primer is labeled with FAM fluorescence.

3. A kit comprising the PCR primers for sex identification according to claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit also contains PCR reaction solution and / or DNA extraction solution.

5. Use of the PCR primers according to claim 1 or 2 or the kit according to claim 3 or 4 in sex identification of Mule ducks.

6. The use according to claim 5, characterized in that: The genomic DNA of the tested Mule duck is amplified by PCR using the PCR primers described in claim 1 or 2 or the kit described in claim 3 or 4. The electrophoresis result shows two peaks of 966 bp and 998 bp for male Mule ducks, and one peak of 966 bp for female Mule ducks.

7. A method for rapid sex identification of Mule ducks, characterized in that: The following steps are involved: 1) Extracting genomic DNA from the mule duck to be tested; 2) using the DNA extracted in step 1) as a template and using the primer pair of claim 1 or 2 or the kit of claim 3 or 4 to perform a PCR amplification reaction; 3) The PCR products were tested by capillary electrophoresis. The results showed two peaks of 966 bp and 998 bp for male Mule ducks, and one peak of 966 bp for female Mule ducks.

8. The identification method according to claim 7, characterized in that: Step 1) Extracting genomic DNA of the tested Mule duck: Extracting genomic DNA from feathers, tissues or organs.

9. The identification method according to claim 7, characterized in that: In step 2), the PCR reaction system is: 2×PCR Mix 25 μL, 1 μL each of 10 μmol / L forward and reverse primers, 2 μL of 50-100 μg / ml template DNA, and 21 μL of ultrapure water.

10. The identification method according to claim 7, characterized in that: The PCR reaction program in step 2) is: 95°C for 5 min, i.e., 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles, and 72°C for 10 min.

Images