Method for improving tumor detection sensitivity through gene methylation signal pre-amplification

Abstract

The invention discloses a method for improving tumor detection sensitivity through gene methylation signal pre-amplification, and relates to the technical field of tumor detection. The method for improving the tumor detection sensitivity through gene methylation signal pre-amplification comprises six steps, a multiplex PCR technology and a nested PCR technology are combined, whether a sample is methylated or not can be qualitatively detected, meanwhile, the methylation degree can be quantitatively detected, a gene methylation signal can be amplified, and the tumor detection sensitivity can be improved through gene methylation signal pre-amplification. The kit has the advantages that the kit can be used for detecting methylated DNA (deoxyribonucleic acid), the initial quantity of required detection samples is ultralow, the sequencing cost is lower, extremely trace methylated DNA can be detected, so that early screening is possible, the sensitivity and specificity of detection can be further improved by reasonably selecting specific primers, very low gene methylation states can be detected, and the kit can be used for detecting the methylated DNA. Meanwhile, the influence of methylation of a non-CpG region on detection can be eliminated, the interference of low-transformation fragments is eliminated, and the detection rate is increased.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor detection, and specifically to a method for improving the sensitivity of tumor detection by pre-amplifying gene methylation signals. Background Art

[0002] It takes 5-10 years for lung cancer to develop from the initial lesions to cancer infiltration and metastasis. Early detection not only has good treatment effects, but also low medical expenses. However, once this stage is broken, as the course of the disease becomes longer, the lesions accelerate, the treatment costs are high, and the effect is very poor. Therefore, early diagnosis and treatment are the best ways to deal with lung cancer. Since there are no specific clinical manifestations in the early stages of lung cancer, although there are many early tumor signals, there is a lack of highly sensitive and specific early diagnosis technology. Most patients are already in the late stage of cancer when diagnosed. For example, the common ground-glass-based lung nodules are mainly judged to be benign or malignant based on the performance of chest CT images, but it is difficult to differentiate them, and the final diagnosis is often in the middle and late stages.

[0003] Early diagnosis of tumors usually depends on two key factors: high sensitivity of the test indicators and non-invasive, simple detection methods. With the rapid development of science and technology, tumor markers have developed into a new field, new challenge and hope for tumor diagnosis and treatment. Tumor markers can be detected in body fluids or tissues and can reflect the presence, degree of differentiation, prognosis estimation and treatment effect of tumors.

[0004] Blood cells are constantly flowing in the human blood circulation system. After somatic cells and blood cells rupture and degrade, the contents in the cytoplasm are released, including proteins, exosomes, RNA, and DNA fragments carrying various genetic information, namely cfDNA (cell free DNA). This type of DNA fragment contains abnormalities such as mutations, deletions, insertions, rearrangements, copy number abnormalities, methylation, etc., especially ctDNA (circulating tumorDNA, circulating tumor cell DNA) fragments from the tumor genome. ctDNA is used as an important test sample for liquid biopsy because the acquisition process is less invasive, can be obtained multiple times, and dynamic changes can be observed.

[0005] The invention with publication number CN117512115A discloses a method for improving the sensitivity of tumor detection by pre-amplification of gene methylation signals. The method comprises converting the non-methylated CpG sites in the sample cfDNA with bisulfite, and then performing a first round of multi-channel PCR amplification with outer primers. After the PCR amplification product is purified, a second round of PCR amplification is performed with inner primers and probes, and then the dCT (△Ct) value of each target gene is calculated to determine whether the sample is positive or negative.

[0006] As shown in the above invention, the existing method for improving the sensitivity of tumor detection pre-amplifies the gene methylation signal to improve the detection accuracy and sensitivity. However, this method cannot improve the detection accuracy and sensitivity when the methylation signal amplification is not obvious, which affects the detection efficiency. Summary of the invention

[0007] In view of the deficiencies of the prior art, the present invention provides a method for improving the sensitivity of tumor detection by pre-amplifying gene methylation signals, thereby solving the existing problems.

[0008] To achieve the above objectives, the present invention is implemented by the following technical scheme: a method for improving the sensitivity of tumor detection by pre-amplification of gene methylation signals, comprising the following steps:

[0009] Step 1: Modify the DNA sample of the tissue to be tested to obtain the converted DNA;

[0010] Step 2: Use the inner primer pair to perform the first round of amplification of the transformed DNA using the multiplex PCR method, so that the amplified product sequences are the positive strand and negative strand of the DNA transformation respectively;

[0011] Step 3: Purify the obtained first round amplification products to remove small fragments of DNA and dimers that are non-specifically amplified;

[0012] Step 4: Use outer primers to perform secondary amplification on the purified product, and perform secondary purification after amplification;

[0013] Step 5: Perform RT-PCR reaction on the secondary amplified product, specific detection primers and specific probes

[0014] Step 6: Measure the Ct value of the tumor tissue DNA methylation standard.

[0015] Preferably, the bisulfite, bisulfite or hydrazine modification can be applied to the modification treatment in step 1 to convert the unmethylated cytosine in the DNA sample into uracil, while the 5' methylated cytosine remains unchanged, thereby distinguishing methylated or unmethylated gene fragments.

[0016] Preferably, the inner primers include two pairs of primers designed for the positive and negative strands of the methylated DNA of S2, respectively, the 5' end of each pair of inner primers uses 20 to 25 bases complementary to the 3' end of the outer primer, and the 3' end uses a specific primer sequence designed according to the sequence outside the target site.

[0017] Preferably, the amplification method using the inner primers is: all the inner primers are placed in a primer pool, and the first round of amplification is performed in the same reaction system to simultaneously complete the amplification of multiple target genes.

[0018] Preferably, the outer primers include outer primer F and outer primer R, the outer primer F is the same as illumina Multiplexing PCR Primer 1.0 primer, and the outer primer R is illumina RNA PCR Primer primer with 3' end truncated.

[0019] Preferably, the sequence of the specific PCR detection primer is as follows:

[0020] SMF (sequence 1 in the sequence listing): GATAGTTAGGTAATTTTCGTTTCG;

[0021] SMR (sequence 2 in the sequence listing): CCTTCTAACCCGACTTAAACGACG;

[0022] AMF (sequence 3 in the sequence listing): GGGTGGTGATGGAGGAGGTT;

[0023] AMR (sequence 4 in the sequence listing): TAACCACCACCCAACACACAAT.

[0024] Preferably, the sequence of the specific probe is as follows:

[0025] SMP (sequence 5 in the sequence listing): FAM-GTACGACCCCGATCG-MGB;

[0026] AMP (sequence 6 in the sequence listing): VIC-TGGATTGTGAATTTGTG-MGB.

[0027] Preferably, the reaction method of the RT-PCR reaction comprises the following steps:

[0028] S1: 95°C for 3 minutes;

[0029] S2: Cool down to 58°C and hold for 20 seconds;

[0030] S3: Heat to 72°C and hold for 30 seconds;

[0031] S4: performing steps S2 and S3 for 50 cycles;

[0032] S5: Maintain at 72°C for 1 minute.

[0033] Beneficial Effects

[0034] The present invention provides a method for improving the sensitivity of tumor detection by pre-amplifying gene methylation signals.

[0035] Compared with the prior art, it has the following beneficial effects:

[0036] 1. This method of improving the sensitivity of tumor detection by pre-amplifying gene methylation signals, through the combination of multiplex PCR technology and nested PCR technology, can not only qualitatively detect whether methylation occurs in the sample, but also quantitatively detect the degree of methylation. It can not only amplify the gene methylation signal, but also requires an ultra-low starting amount of detection samples, and has a low sequencing cost. It can detect extremely small amounts of methylated DNA, thus making early screening possible.

[0037] 2. This method of improving the sensitivity of tumor detection by pre-amplification of gene methylation signals can further increase the sensitivity and specificity of detection by rationally selecting specific primers, so that it can detect very low gene methylation states, while eliminating the influence of non-CpG region methylation on detection, eliminating the interference of low conversion fragments, and improving the detection rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is a schematic diagram of the method flow of the present invention; DETAILED DESCRIPTION

[0039] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] See Figure 1 , the present invention provides the following three technical solutions:

[0041] The first embodiment: A method for improving the sensitivity of tumor detection by pre-amplification of gene methylation signals, comprising the following steps:

[0042] Step 1: Modify the DNA sample of the tissue to be tested to obtain the converted DNA;

[0043] Step 2: Use the inner primer pair to perform the first round of amplification of the transformed DNA using the multiplex PCR method, so that the amplified product sequences are the positive strand and negative strand of the DNA transformation respectively;

[0044] Step 3: Purify the obtained first round amplification products to remove small fragments of DNA and dimers that are non-specifically amplified;

[0045] Step 4: Use outer primers to perform secondary amplification on the purified product, and perform secondary purification after amplification;

[0046] Step 5: Perform RT-PCR reaction on the secondary amplified product, specific detection primers and specific probe;

[0047] Step 6: Measure the Ct value of the tumor tissue DNA methylation standard.

[0048] Modification by bisulfite, bisulfite or hydrazine salt can be applied to the modification treatment in step 1 to convert the unmethylated cytosine in the DNA sample into uracil, while the 5' methylated cytosine remains unchanged, thereby distinguishing methylated or unmethylated gene fragments.

[0049] The inner primers include two pairs of primers designed for the positive and negative strands of the methylated DNA of S2, respectively. The 5' end of each pair of inner primers uses 20 to 25 bases complementary to the 3' end of the outer primer, and the 3' end uses a specific primer sequence designed according to the sequence outside the target site.

[0050] When designing inner primers, their tm values ​​are controlled to be uniform, thereby preventing differences in the amplification efficiency of multiple amplification products.

[0051] The amplification method using the inner primers is as follows: all inner primers are placed in a primer pool, and the first round of amplification is performed in the same reaction system to simultaneously complete the amplification of multiple target genes. In addition to the primers, the reaction system includes various enzymes selected according to the characteristics of the primers. Those skilled in the art can conduct experiments to determine the specific enzymes according to actual needs and in combination with conventional technical means, and will not be described in detail here.

[0052] The outer primers include outer primer F and outer primer R, the outer primer F is the same as illumina Multiplexing PCR Primer 1.0 primer, and the outer primer R uses illumina RNA PCR Primer primer with 3' end truncated.

[0053] To be suitable for the Illumina platform, the 5' end sequence of the inner primer of the present application uses 20 to 25 bases complementary to the 3' end of the Illumina sequencing primer. However, if the universal adapter sequence is used directly, there will be a complementary sequence, resulting in a corresponding dimer. Therefore, through the permutation and combination test of multiple adapter sequences, the existing sequence is selected to be retained and truncated at the 3' end, thereby reducing the corresponding capture sequence length. In addition, by utilizing the characteristic that the sequencing primers of the Illumina sequencing platform are a mixed system, different series of adapter primers can be detected in one test, thereby enabling the detection of libraries with adapter sequences from different sources. At the same time, the 3' end of the inner primer of the present application uses a specific primer sequence designed according to the sequence outside the target site. The incompatibility of the methylation site is retained during the design, and the complementary characteristics of the 3' end are utilized to eliminate false positives caused by low conversion rate DNA.

[0054] In view of the fact that the sequence undergoes a significant change after DNA conversion (methylation), making the sequence no longer complementary, the present application designs inner primers for the positive and negative strands of methylated DNA respectively, so that the products of the first round of amplification are not complementary and thus form two independent fragments, and the two fragments can be compared with the original template through a computer program and located in the same region. Through the mutual calibration of the positive and negative strands, the authenticity of the methylation state can be determined, and the misreading of the result due to SNP can be corrected through the other strand. For example, the C at a certain site becomes T due to gene polymorphism, and cannot be distinguished from the T signal formed by sequencing after the non-methylated C is converted. At this time, the A signal generated by sequencing the complementary sequence of the other strand can be distinguished from the complementary base G of the non-methylated C, so that it can be judged that the position is due to gene polymorphism rather than the change caused by the low methylation state, thereby eliminating the influence of gene mutation on methylation judgment.

[0055] The sequences of the specific PCR detection primers are as follows:

[0056] SMF (sequence 1 in the sequence listing): GATAGTTAGGTAATTTTCGTTTCG;

[0057] SMR (sequence 2 in the sequence listing): CCTTCTAACCCGACTTAAACGACG;

[0058] AMF (sequence 3 in the sequence listing): GGGTGGTGATGGAGGAGGTT;

[0059] AMR (sequence 4 in the sequence listing): TAACCACCACCCAACACACAAT.

[0060] The sequence of the specific probe is as follows:

[0061] SMP (sequence 5 in the sequence listing): FAM-GTACGACCCCGATCG-MGB;

[0062] AMP (sequence 6 in the sequence listing): VIC-TGGATTGTGAATTTGTG-MGB.

[0063] The reaction method of the RT-PCR reaction comprises the following steps:

[0064] S1: 95°C for 3 minutes;

[0065] S2: Cool down to 58°C and hold for 20 seconds;

[0066] S3: Heat to 72°C and hold for 30 seconds;

[0067] S4: performing steps S2 and S3 for 50 cycles;

[0068] S5: Maintain at 72°C for 1 minute.

[0069] Second Implementation Method: Validation of Tumor Detection

[0070] After the multiple antibodies that recognize tumor-specific antigens are labeled with colloidal gold respectively, they are formed with the polymer into a copolymer containing multiple colloidal gold-labeled antibodies for recognizing different tumor-specific antigens;

[0071] The copolymer containing multiple colloidal gold-labeled antibodies for identifying different tumor-specific antigens is used as an antibody carrier to participate in the immune turbidity reaction as an immune enhancement in vitro diagnostic reagent for detecting multiple tumors;

[0072] The reagent is mixed with the DNA sample of the tissue to be tested, and the test result is compared and verified with the above measurement result.

[0073] The method for preparing the nano-gold labeled antibody copolymer for recognizing tumor-specific antigens is as follows:

[0074] (1) preparing a colloidal gold solution: using a 1% sodium citrate aqueous solution and a 0.01% chloroauric acid aqueous solution in a volume ratio of 1.5 mL:100 mL, heating the chloroauric acid solution to boiling, quickly adding the sodium citrate aqueous solution thereto, stirring and reacting until the resulting reaction solution is wine red, heating for another 10 min until the solution is transparent, cooling to room temperature, and then adjusting the pH value to 6.5-8.0 with a 0.05-0.1 mol / L potassium carbonate aqueous solution to obtain a colloidal gold solution;

[0075] (2) Slowly adding an antibody aqueous solution with a concentration of 10 to 50 μg / mL for identifying gastric cancer-specific antigens to the colloidal gold solution obtained in step (1) under magnetic stirring, mixing, incubating at 37° C. for 30 min, adding a blocking solution and continuing to incubate at 37° C. for 22 to 25 min, centrifuging at 14,000 rpm and 4° C. for 20 to 22 min, removing the supernatant, resuspending the precipitate with a diluent and washing once, to obtain colloidal gold-anti-S100P protein polyclonal antibody marker I;

[0076] Take the colloidal gold solution obtained in step (1), slowly add an antibody aqueous solution with a concentration of 10 to 50 μg / mL for identifying liver cancer specific antigens under magnetic stirring, and follow the same operation method as the above-mentioned preparation of colloidal gold-anti-S100P protein polyclonal antibody marker I to obtain colloidal gold-human liver cancer tissue AFU polyclonal antibody marker II;

[0077] Take another colloidal gold solution obtained in step (1), slowly add an antibody aqueous solution with a concentration of 10 to 50 μg / mL for identifying colon cancer specific antigens under magnetic stirring, and follow the same operation method as the above-mentioned preparation of colloidal gold-anti-S100P protein polyclonal antibody marker I to obtain colloidal gold-colon cancer antigen 3 antibody (SDCCAG3) marker III;

[0078] (3) The polymer is dissolved in dichloromethane at a weight ratio of 1:18 to 30, and the markers I, II and III prepared in the above step (2) are added, and ultrasonic treatment is performed for 30 to 60 seconds to obtain a colloidal gold-labeled antibody copolymer that recognizes specific antigens of three tumors: lung cancer, liver cancer and colon cancer.

[0079] The colloidal gold-anti-S100P protein polyclonal antibody marker I is calculated by mass ratio, that is, the colloidal gold: anti-S100P protein polyclonal antibody is 5:0.21-0.23; the colloidal gold-human liver cancer tissue AFU polyclonal antibody marker II is calculated by mass ratio, that is, the colloidal gold: human liver cancer tissue AFU polyclonal antibody is 5:0.25-0.28; the colloidal gold-colon cancer antigen 3 antibody (SDCCAG3) marker III is calculated by mass ratio, that is, the colloidal gold: colon cancer antigen 3 antibody (SDCCAG3) is 5:0.23-0.26.

[0080] The third implementation method: obtaining DNA samples from tumor tissue

[0081] The positive enrichment method using positive antibodies to capture tumor cells is used to enrich tumor cells, which includes the following steps:

[0082] A) Magnetic bead coupling: Take an antibody (e.g., EGFR antibody) modified with modifier 1 (e.g., biotin) and magnetic beads modified with modifier 2 (e.g., streptavidin), add them to a buffer (e.g., 0.5% BSA-PBS buffer), incubate (e.g., incubate with rotation at room temperature for 4 hours), and magnetically separate (e.g., separate for 3 minutes) to obtain magnetic beads coupled with the antibody (e.g., EGFR) (i.e., a complex of modifier 1-antibody-modifier 2-magnetic beads); preferably, wash the separated magnetic beads coupled with the antibody (e.g., EGFR) with 0.5% BSA-PBS buffer;

[0083] B) Sample preparation: Obtain the sample to be tested from the subject;

[0084] C) Magnetic bead incubation: Mix the antibody-coupled magnetic beads obtained in step (a) and the sample to be tested obtained in step (b), and incubate at 4° C. for 1 h with rotation to obtain a modification 1-antibody-modification 2-magnetic bead-cell complex sample;

[0085] D) Magnetic separation: Place the modified substance 1-antibody-modified substance 2-magnetic beads-cell complex sample obtained in step (c) on a magnetic stand for magnetic separation, remove the supernatant, and obtain a tumor cell sample.

[0086] The above-mentioned positive antibody capture is single antibody capture or multiple antibody capture.

[0087] The experimental method of the present invention is to carry out a multi-channel fluorescent quantitative probe PCR amplification reaction in a reaction tube, obtain the Ct value of each gene through the fluorescent signal, and subtract the Ct value of the internal reference gene ACTB from the Ct value of each gene in the tumor cell positive clinical sample to obtain the dCt (△Ct) value of the target gene of the sample, and compare it with the dCT (△Ct) threshold (critical value) for judging the methylation of the gene obtained from a large number of known tumor tissues and control tissue DNA samples, or cfDNA in plasma. If it is less than the threshold, it means that the target gene is methylated, and the methylation status of the target gene is judged.

[0088] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0089] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method to improve the sensitivity of tumor detection by pre-amplification of gene methylation signals. It is characterized in that The following steps are involved: Step 1: Modify the DNA sample of the tissue to be tested to obtain the converted DNA; Step 2: Use the inner primer pair to perform the first round of amplification of the transformed DNA using the multiplex PCR method, so that the amplified product sequences are the positive strand and negative strand of the DNA transformation respectively; Step 3: Purify the obtained first round amplification products to remove small fragments of DNA and dimers that are non-specifically amplified; Step 4: Use outer primers to perform secondary amplification on the purified product, and perform secondary purification after amplification; Step 5: Perform RT-PCR reaction on the secondary amplified product, specific detection primers and specific probes Step 6: Measure the Ct value of the tumor tissue DNA methylation standard.

2. The method for improving tumor detection sensitivity by pre-amplification of gene methylation signals according to claim 1, Features: The bisulfite, bisulfite or hydrazine modification can be applied to the modification treatment in step 1 to convert the unmethylated cytosine in the DNA sample into uracil, while the 5' methylated cytosine remains unchanged, thereby distinguishing methylated or unmethylated gene fragments.

3. The method for improving tumor detection sensitivity by pre-amplification of gene methylation signals according to claim 1, Features: The inner primers include two pairs of primers designed for the positive and negative strands of the methylated DNA of S2, respectively. The 5' end of each pair of inner primers uses 20 to 25 bases complementary to the 3' end of the outer primer, and the 3' end uses a specific primer sequence designed according to the sequence outside the target site.

4. The method for improving tumor detection sensitivity by pre-amplification of gene methylation signals according to claim 3, Features: The amplification method using the inner primers is as follows: all the inner primers are placed in a primer pool, a first round of amplification is performed in the same reaction system, and amplification of multiple target genes is completed simultaneously.

5. The method for improving tumor detection sensitivity by pre-amplification of gene methylation signals according to claim 1, Features: The outer primers include outer primer F and outer primer R, the outer primer F is the same as illumina Multiplexing PCR Primer 1.0 primer, and the outer primer R uses illumina RNA PCR Primer primer with 3' end truncated.

6. The method for improving tumor detection sensitivity by pre-amplification of gene methylation signals according to claim 1, Features: The sequences of the specific PCR detection primers are as follows: SMF: GATAGTTAGGTAATTTTCGTTTCG; SMR: CCTTCTAACCCGACTTAACGACG; AMF: GGGTGGTGATGGAGGAGGTT; AMR: TAACCACCACCCACACACAAT.

7. The method for improving tumor detection sensitivity by pre-amplification of gene methylation signals according to claim 1, Features: The sequence of the specific probe is as follows: SMP: FAM-GTACGACCCGATCG-MGB; AMP: VIC-TGGATTGTGAATTTGTG-MGB.

8. The method for improving tumor detection sensitivity by pre-amplification of gene methylation signals according to claim 1, Features: The reaction method of the RT-PCR reaction, The following steps are involved: S1: 95°C for 3 minutes; S2: Cool down to 58°C and hold for 20 seconds; S3: Heat to 72°C and hold for 30 seconds; S4: performing steps S2 and S3 for 50 cycles; S5: Maintain at 72°C for 1 minute.

Images