SNP-498 site related to ear number of single wheat plant and application of SNP-498 site

Abstract

The invention discloses an SNP-498 site related to the ear number of a wheat single plant and application of the SNP-498 site. The SNP site corresponds to the 498th basic group from the 5'tail end of a sequence shown in SEQ ID NO.1, and when the site is C / C homozygous, the corresponding genotype is A, when the site is C / C homozygous, the corresponding genotype is B, and when the site is C / C homozygous, the corresponding genotype is B; when the site is G / G homozygous, the corresponding genotype is B, and the ear number of a single plant is as follows: the wheat with the homozygous genotype A is less than or candidates less than the wheat with the homozygous genotype B. The SNP has high effectiveness and potential application value, the wheat with the high spike number per plant can be found by detecting the SNP, and the SNP has important value in research or application of cultivation of high-yield wheat varieties.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, in particular to a SNP-498 site related to wheat ear number per plant and an application thereof. Background Art

[0002] As one of the main food crops in the world, the increase in wheat yield and improvement in wheat quality are of great significance to the food security of the world. The number of spikes is one of the three factors that constitute the yield. Research on the number of wheat spikes is of great significance to high-yield breeding and germplasm resource creation. Therefore, discovering the QTL (quantitative trait loci) segment that controls the number of spikes per plant in wheat and its excellent allelic variation, and the QTL positioning analysis of different tillering traits in wheat are of great significance to understanding yield formation and molecular breeding for yield.

[0003] At present, predecessors have used different genetic segregation populations to analyze the genetic mechanism of ear number and located many QTLs related to ear number. Wan Jiale et al. (2021) used 135 DH populations of Annong 859 / Wunong 988 as research materials, measured the phenotypic values ​​of ear number per plant under five environments in two years, and conducted QTL analysis of ear number per plant based on the 55K chip data of the DH population, and developed CAPS molecular markers. The results showed that a total of 21 QTLs related to the number of ears per plant were detected on chromosomes 1B, 1D, 2A, 3D, 4A, 4B, 4D, 6A, and 7D. Among them, Qsn-ahau-4B.2 located on chromosome 4B was detected in five environments, with flanking markers AX-95004669-AX-109580651 and a physical interval of 2.65Mb, which could explain 16.92% to 49.98% of the expression variation, and an additive effect of 1.32 to 3.69 ears. The enhancing allele came from Annong 859, which is a major and stable QTL.

[0004] Yang Lin et al. (2013) used the F2 population obtained by hybridizing Chinese Spring (female parent) and Lankao Large Grain (male parent) as the mapping population and constructed a genetic linkage map containing 169 molecular markers. The F2:3 families were planted in Qianxian, Qishan and Yangling, Shaanxi Province, and the complete interval mapping method was used to conduct multi-environment joint QTL analysis on wheat tillering before winter, tillering in spring and number of spikes per plant, and a total of 21 related additive QTL loci were detected. Among them, 6 QTLs for tillering before winter were located on chromosomes 2A, 2D, 5D and 7A, and a single QTL could explain 1.38% to 6.73% of the phenotypic variation; 7 QTLs for tillering in spring were located on chromosomes 1A, 2D, 4B, 5D, 7A and 7D, and a single QTL could explain 1.97% to 2.60% of the phenotypic variation; 8 QTLs for spike number per plant were located on chromosomes 1A, 2B, 2D and 4B, and a single QTL could explain 2.29% to 41.21% of the phenotypic variation. A total of 30 pairs of additive × additive epistatic QTLs were detected. Among them, 1 pair controlled tillering before winter, which could explain 21% of the phenotypic variation; 20 pairs controlled tillering in spring, and a total of 30 pairs of additive × additive epistatic QTLs were detected. Among them, one pair controlled tillering before winter, which could explain 21% of the phenotypic variation; and 20 pairs controlled tillering in spring.

[0005] Although many QTLs related to wheat ear number have been located, most of them have small phenotypic contribution rates, require additive effects, and have poor repeatability between different years and environments, so these QTLs are difficult to apply to the genetic improvement of wheat ear number per plant. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a SNP-498 site related to the number of wheat spikes per plant and an application thereof.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] A SNP site associated with the number of ears per plant in wheat, the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the number of ears per plant is: wheat homozygous for genotype A is smaller than or is candidate to be smaller than wheat homozygous for genotype B.

[0009] On the other hand, the present invention includes a primer combination for detecting the single nucleotide polymorphism of the following SNP site in the wheat genome, wherein the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, and when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ IDNO.5; this primer combination is used to detect the SNP site described in claim 1.

[0010] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the number of ears per wheat plant, which is used to detect the SNP site described in claim 1 and at least includes the primer combination described in claim 2 and the necessary restriction endonuclease components.

[0011] As a preferred technical solution of the present invention, the restriction endonuclease is SmaI enzyme.

[0012] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0013] As a preferred technical solution of the present invention, the reagent or kit also includes template DNA, buffer required for PCR amplification, dNTPs and other necessary components for gene detection.

[0014] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the reagent or kit is designed to be 473-571 bp at the 5' end of SEQ ID NO.1.

[0015] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0016] On the other hand, the present invention also includes a method for identifying or assisting in identifying wheat genotypes, wherein any DNA fragment in the wheat genomic DNA to be tested, including the SNP site described in claim 1, is PCR amplified, and the PCR amplification product is enzyme digested and identified; the PCR amplified DNA fragment is the 473-571bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0017] As a preferred technical solution of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 to 50 times, using it as a template, and using primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using restriction endonuclease SmaI to digest the PCR product; if the PCR product cannot be cut, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product can be cut, the nucleotide polymorphic site is G / G and the genotype is B; the number of ears per plant is: wheat homozygous for genotype A is smaller than or candidate is smaller than wheat homozygous for genotype B.

[0018] In the last aspect, the present invention also includes the use of the SNP site in identifying or assisting in identifying the trait of the number of ears per plant in wheat.

[0019] The beneficial effect of adopting the above technical scheme is that: the research team of the present invention found 1 SNP through genetic variation analysis of genes of natural variation population of wheat, which corresponds to the 498th position from the 5' end of sequence table 1. By designing dCAPS marker for the SNP site, it was found that the SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis proved that in the homozygous types of these two genotypes, the number of spikes per plant is: wheat homozygous for genotype A < wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of spikes per plant can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in agricultural practice and / or related scientific research for cultivating high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a diagram of the gene structure pattern and SNP site;

[0021] Figure 2It is a schematic diagram of the electrophoresis detection results of the SNP development dCAPS marker digestion product of the present invention; wherein, M is used as a molecular weight standard; lane A is a band that can be cut by KpnI, lane C is a band that cannot be cut by SmaI, and lane G is a band that can be cut by SmaI;

[0022] Figure 3 This is a schematic diagram of the association analysis of the number of spikes per plant;

[0023] Figure 4 This is a schematic diagram of gene SNP sites and typing in 385 wheat population materials. DETAILED DESCRIPTION

[0024] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through market purchase. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can all be obtained from commercial sources. The wheat materials used in the following examples are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and the material information is available on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn. It should be understood that when used in the present application specification and the attached claims, the term "including" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the present application specification and the attached claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0025] As used in the specification of the present application and the appended claims, the term "if" can be interpreted as "when..." or "once" or "in response to determination" or "in response to detection" according to the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once it is determined" or "in response to determination" or "once [the described condition or event] is detected" or "in response to detection [the described condition or event]" according to the context. In addition, in the description of the specification of the present application and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. The reference "one embodiment" or "some embodiments" described in the specification of the present application means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Thus, the sentences "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in the specification are not necessarily all referring to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "include", "comprising", "having" and variations thereof all mean "including but not limited to", unless specifically emphasized otherwise.

[0026] Example 1: Detection of SNPs related to the number of wheat spikes per plant and their PCR-enzyme polymorphism

[0027] 1. Specific primers for amplifying the genome fragment containing the wheat SNP and sequence analysis

[0028] like Figure 1 As shown, a SNP was found in the gene coding region on the wheat genome, corresponding to the 498th position from the 5' end of SEQ ID NO.1 in the sequence list. By designing a dCAPS marker for the SNP site, it was found that there were two genotypes at this site in the natural variation population of wheat:

[0029] Genotype A: C

[0030] Genotype B: G

[0031] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0032] F1: CGACCATGCCGTACGCCGGC (SEQ ID NO: 2);

[0033] R1: CACATTAGTACGTGGTCCGT (SEQ ID NO: 3);

[0034] F2: ACCACAGGGGCCCGGGCGCCGGCCC (SEQ ID NO: 4);

[0035] R2: TGCTGCCGCGCACGTCCATC (SEQ ID NO: 5);

[0036] The target sequence amplified by PCR using F1 and R1 as primers is the 383-1441 sequence shown in Sequence 1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 473-571 sequence shown in Sequence 1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by SmaI respectively.

[0037] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0038] 1) Extracting genomic DNA of wheat to be tested;

[0039] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) is: 16.8 μL ddH2O, 0.2 μL KOD, 1 ul dNTP, 0.5 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (50-100 ng / μL).

[0040] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0041] 3) The PCR product of step 2) was diluted 20 to 50 times, and used as a template to perform PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) was: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).

[0042] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 10 s, 72°C for 10-12 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0043] 4) The PCR product obtained in step 3) is digested with SmaI to obtain the digestion product, and then the digestion product is detected by 4% agarose gel electrophoresis. It is recorded whether the PCR product is cut into two fragments, and the situation of the wheat to be tested at the said site is determined and recorded according to the following method:

[0044] If the enzyme cleavage product is one or larger fragments, the wheat to be tested is C homozygous (expressed as C / C) at the site (e.g. Figure 2 Lane C in the figure);

[0045] If the enzyme cleavage product is two or smaller fragments, the wheat to be tested is G homozygous (expressed as G / G) at the site (e.g. Figure 2 Lane G in Figure 5).

[0046] According to the result of step 4), the wheat is divided into two types, I and II, as follows:

[0047] I: C / C (i.e., homozygous for genotype A);

[0048] II: G / G (i.e., homozygous for genotype B);

[0049] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0050] 3. Use dCAPS markers to genotype natural populations and conduct association analysis with the number of spikes per plant trait

[0051] Each wheat in the natural population consisting of 320 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0052] Table 1 The situation of the polymorphic sites in natural wheat populations

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 2

[0059] Our technical team conducted exon capture sequencing on 385 materials and performed specific genotyping on these materials, including genotype A homozygous C / C and genotype B homozygous G / G. Figure 4 Among all 385 materials, 363 materials could be clearly distinguished as homozygous C / C of genotype A or homozygous G / G of genotype B, and the remaining 22 materials could not complete genotyping.

[0060] In addition, 320 of the 385 materials have multi-year and multi-point agronomic trait data, while the remaining 65 materials cannot meet the requirements of subsequent analysis due to insufficient data. Figure 3 As shown in Figure 1, only these 320 data points were used in the association analysis between the status of the natural population gene polymorphism sites and the number of spikes per plant. However, among these 320 data points, 18 materials were not genotyped, so the actual number of samples for association analysis was 302.

[0061] In 2018, the above-mentioned natural population wheat was planted in the arid-hot land, dry land and hydrothermal land of the Luancheng Experimental Station of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng, Hebei); in 2019, the arid-hot land, dry land, hydrothermal land and water land of the Hengshui Experimental Farm of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng and Hengshui, Hebei); in 2020, the arid land and arid-hot land of the Institute of Crop Sciences of the Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station) were planted. The number of ears per plant of each wheat variety was investigated, and the Tassel2.1 software was used to perform association analysis on the number of ears per plant and the polymorphic loci. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, and P<0.05 was set as the significance level. The results are shown in Table 2 and Table 2. Figure 3 shown.

[0062] Table 2 Results of association analysis between the status of gene polymorphisms in natural populations and the number of spikes per plant

[0063]

[0064] The results of association analysis in Table 2 show that the difference in the number of spikes per plant between the two types of natural populations composed of 320 hexaploid wheats shown in Table 1 reached a significant level in 8 environmental points (P<0.05). Among them, the number of spikes per plant of wheat in type I is less than that of wheat in type II. In several environments, the number of spikes per plant of wheat materials in type I is 0.30, 0.54, 0.44, 0.43, 0.72, 0.43, 0.07, 0.32, 0.25 and 0.62 less than that of wheat in type II, respectively. Studies on natural populations have shown that type II is an excellent genotype for increasing the number of spikes per plant of wheat.

[0065] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0066] From the above embodiments, it can be seen that the present invention discloses a SNP site related to the number of ears per plant of wheat and its application. Through the genetic variation analysis of the gene coding region of the natural variation population of wheat, the present invention finds a SNP, corresponding to the 498th position from the 5' end of Sequence Table 1, and the SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis proves that in the homozygous types of these two genotypes, the number of ears per plant is: wheat homozygous for genotype A < wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of ears per plant can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research.

[0067] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A SNP locus associated with the number of wheat spikes per plant, characterized in that: The SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the number of ears per plant is: the wheat homozygous for genotype A is smaller than or is candidate to be smaller than the wheat homozygous for genotype B.

2. A primer combination, characterized in that: Used to detect the single nucleotide polymorphism of the following SNP site in the wheat genome, the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence table, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

3. A reagent or kit for identifying or assisting in identifying the trait of number of ears per plant of wheat, characterized in that: The reagent or kit is used to detect the SNP site described in claim 1, and at least comprises the primer combination described in claim 2 and necessary restriction endonuclease components.

4. The reagent or kit according to claim 3, characterized in that: The restriction endonuclease is SmaI enzyme.

5. The reagent or kit according to claim 3 or 4, characterized in that: The reagent or kit also includes template DNA, buffer required for PCR amplification, dNTPs and other necessary components for gene detection.

6. The reagent or kit according to claim 3, 4 or 5, characterized in that: The target DNA fragment amplified by PCR in the reagent or kit is designed to be 473-571 bp at the 5' end of SEQ ID NO.

1.

7. The reagent or kit according to claim 3, 4, 5 or 6, characterized in that: The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

8. A method for identifying or assisting in identifying wheat genotypes, characterized in that: A DNA fragment containing the SNP site of claim 1 in any section of the wheat genomic DNA to be tested is amplified by PCR, and the PCR amplification product is identified by enzyme digestion; the DNA fragment amplified by PCR is 473-571bp at the 5' end of SEQ ID NO.1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

9. The method according to claim 8, characterized in that: The enzyme digestion comprises the following steps: The PCR product was obtained by using wheat genomic DNA as template and primers 1F and 1R as primer pair; The PCR product was diluted 20 to 50 times, used as a template, and primers 2F and 2R were used as a primer pair to amplify the PCR product; the PCR product was digested with restriction endonuclease SmaI; If the PCR product cannot be cut, the nucleotide polymorphism site is C / C and the genotype is A; if the PCR product can be cut, the nucleotide polymorphism site is G / G and the genotype is B; the number of ears per plant is: the wheat homozygous for genotype A is smaller than or is candidate to be smaller than the wheat homozygous for genotype B.

10. Use of the SNP locus according to claim 1 in identifying or assisting in identifying the trait of number of ears per plant in wheat.

Images