Porcine circovirus type 3 epitope nanoparticle antigen and vaccine and application thereof

Abstract

The invention relates to a porcine circovirus type 3 epitope nanoparticle antigen. The porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 (porcine circovirus type 3) fusion epitope or a SpyCatcher-PCV2 (porcine circovirus type 3) nanoparticle with a PCV3 fusion epitope. The invention also relates to a porcine circovirus type 3 nano-particle vaccine, and the nano-particle vaccine comprises an immunizing dose of the porcine circovirus type 3 epitope nano-particle antigen and a pharmaceutically acceptable carrier. The porcine circovirus type 3 epitope nanoparticle vaccine provided by the invention can be used for preventing PCV3 infection, and has good protection capability.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to porcine circovirus type 3 epitope nanoparticle antigens and vaccines and applications thereof. Background Art

[0002] Porcine circovirus type 3 (PCV3) is a non-enveloped, icosahedral, single-stranded DNA (ssDNA) virus belonging to the genus Circovirus of the family Circoviridae. PCV3 was first discovered and reported in the United States in 2016, and has become one of the important pathogens affecting my country's pig industry in recent years. PCV3 can escape the host's natural immune system response, leading to clinical manifestations similar to those of PCV2 infection, such as porcine dermatitis and nephropathy syndrome (PDNS) and sow reproductive disorder syndrome (SRDS). However, PCV3 is a new type of porcine circovirus that is distantly related to PCV2 in genetic evolution and has great differences. The PCV3 genome is about 2000bp long and encodes two major open reading frames (ORFs), of which ORF1 encodes the replication-related protein (Rep) and ORF2 encodes the viral capsid (Cap) protein that determines the antigenic properties of the virus. The Cap gene has only 26% amino acid identity between the two viruses, so PCV2 vaccines cannot provide protection against PCV3 in clinical practice.

[0003] The size of the nanoparticles is between 20-200 nm, which is the optimal size for drainage to lymph nodes and direct interaction with B cells. The highly repetitive structure on the surface of the nanoparticles induces efficient cross-linking of B cell receptors, which is an early and critical step in B cell activation. In addition, this repetitive structure binds natural antibodies and fixed complement, further enhancing B cell activation and transport and deposition to follicular dendritic cells. The nanoparticles carry ligands for toll-like receptors 7 / 8 or 9, which directly activate B cells for isotype switching and activate dendritic cells for T cell priming.

[0004] As an immunogen that causes effector cell immune response in vivo, peptides have become a new type of vaccine. Cap protein is the main antigen protein of PCV3, but PCV3 Cap expressed by E. coli is not assembled into VLP, and the immune effect is poor, which is a bottleneck for commercialization. Therefore, it is expected that the effective epitope of PCV3 Cap can be displayed by nanoparticles, and the epitope nanoparticle vaccine can become an effective antigen for preventing PCV3.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] One of the objectives of the present invention is to provide a PCV3 epitope nanoparticle antigen.

[0007] One of the objectives of the present invention is to provide a PCV3 epitope nanoparticle vaccine.

[0008] One of the purposes of the present invention is to provide a method for preparing PCV3 epitope nanoparticle antigen.

[0009] One of the purposes of the present invention is to provide an application of a PCV3 epitope nanoparticle antigen in the preparation of a medicament for preventing porcine circovirus-related diseases, wherein the porcine circovirus-related diseases are related diseases caused by single infection or mixed infection of porcine circovirus type 2 and porcine circovirus type 3.

[0010] The invention relates to a porcine circovirus type 3 epitope nanoparticle antigen. The porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope or a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope.

[0011] The porcine circovirus type 3 fusion epitope comprises B cell epitopes P10 73-87aa, P21 161-175aa, P26 201-214aa, and T cell epitopes P20 153-167aa, P21 161-175aa, P24 185-199aa, wherein the amino acid sequences of P10, P20, P21, P24, and P26 are SEQ ID NOs. 6, 7, 8, 9, and 10, respectively. Preferably, the PCV3 fusion epitope-SpyTag sequence is a nucleotide sequence as shown in SEQ.ID NO 4.

[0012] The porcine circovirus type 3 epitope nanoparticle antigen of the present invention, wherein the SpyCatcher-PCV2 nanoparticle having the PCV3 fusion epitope is a VLP (virus-like particle) nanoparticle.

[0013] A method for preparing a porcine circovirus type 3 epitope nanoparticle antigen, wherein the porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope, comprising the following steps: constructing SpyCatcher-E2pCD nanoparticles; using SpyCatcher-E2pCD nanoparticles to display the PCV3 fusion epitope and form a nanoparticle antigen. In one embodiment, using SpyCatcher-E2pCD nanoparticles to display the PCV3 fusion epitope comprises: constructing the PCV3 fusion epitope; soluble expression and purification of the PCV3 fusion epitope; mixing the SpyCatcher-E2pCD nanoparticles with the PCV3 fusion epitope, preferably mixing them at a molar ratio of 1:3.

[0014] A method for preparing a porcine circovirus type 3 epitope nanoparticle antigen, wherein the porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope, and the preparation method comprises the following steps: using SpyCatcher-PCV2 to display the PCV3 fusion epitope in cells to form VLP nanoparticles. In one embodiment, using SpyCatcher-PCV2 to display the PCV3 fusion epitope in cells comprises: amplifying the SpyCatcher-PCV2 Cap fragment; amplifying the PCV3 fusion epitope-SpyTag fragment; sequentially connecting to a plasmid, and transforming the recombinant plasmid into competent cells; and co-expressing SpyCatcher-PCV2 Cap and PCV3 fusion epitope-SpyTag.

[0015] The present invention relates to a porcine circovirus type 3 nanoparticle vaccine, wherein the nanoparticle vaccine comprises an immunizing amount of the porcine circovirus type 3 epitope nanoparticle antigen and a pharmaceutically acceptable carrier; wherein the porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope or a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope.

[0016] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content is ≥30 μg / ml.

[0017] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content is 20 μg / ml to 150 μg / ml, preferably 30 μg / ml to 100 μg / ml.

[0018] In the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content can also be selected from 30 μg / ml to 50 μg / ml, or 50 μg / ml to 100 μg / ml.

[0019] The pharmaceutically acceptable carrier includes an adjuvant, and the adjuvant includes: (1) mineral oil, aluminum gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide, Montanide ISA 206, Montanide ISA 201, Gel adjuvant; preferably, the saponin is Quil A, QS-21, GPI-0100; the adjuvant content is 5%-60% V / V, preferably from 30%-60% V / V, more preferably 50% V / V.

[0020] According to a preferred embodiment, the adjuvant is Montanide ISA 201. Preferably, the adjuvant content is 50% V / V.

[0021] The present invention realizes the expression of PCV3 Cap in E.coli through genetic engineering recombination technology, and the purified Cap can produce specific antibodies against PCV3 Cap after immunizing pigs. 26 overlapping polypeptides are chemically synthesized, and dot hybridization with positive serum after protein immunization is performed, and P10 73-87aa, P26 201-214aa, and P21 161-175aa are screened as B cell epitopes. The peripheral blood lymphocytes of pigs after protein immunization are stimulated by polypeptides, and ELISpot-γ experiments are performed, and P24 185-199aa, P21 161-175aa, and P20 153-167aa are screened as T cell epitopes. The SpyCatcher / SpyTag system was used to construct a new nanoparticle carrier SpyCatcher-E2pCD, and the SpyCatcher-E2pCD nanoparticle carrier was used to display the PCV3 fusion epitope and form a nanoparticle vaccine. The nanoparticle vaccine can repeatedly display the epitope, which is beneficial to the recognition of immune cells and enhance the immune effect. The diameter of the nanoparticle is about 22nm, which is beneficial to the recognition and phagocytosis of antigen-presenting cells, and promotes the proliferation of CD4+CD8+T lymphocytes. After immunizing pigs, strong humoral immunity and cellular immunity can be generated. Furthermore, SpyCatcher-PCV2 is used to display the PCV3 fusion epitope in the cell to form VLP nanoparticles. The vaccine using this nanoparticle has the potential to prevent PCV2 and PCV3 at the same time.

[0022] The PCV3 epitope nanoparticles of the present invention can be used to prepare PCV3 subunit vaccines to prevent PCV3 infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the dot hybridization reaction diagram of serum and polypeptide;

[0024] Figure 2 Results of ELISpot-γ screening of T cell epitopes for peptide-stimulated peripheral blood mononuclear cells (PBMCs);

[0025] Figure 3 Results of ELISpot-γ screening of T cell epitopes for peptide-stimulated splenic lymphocytes (SSLs);

[0026] Figure 4 Transmission electron microscopy (TEM) identification image of SpyCatcher-E2pCD

[0027] Figure 5 This is the TEM identification image of the E2pCD-PCV3 fusion epitope;

[0028] Figure 6 To show the results of the detection of CD4+CD8+T lymphocyte proliferation level after immunization of pigs with nanoparticles containing PCV3 fusion epitopes;

[0029] Figure 7 This is the TEM identification image of the PCV2-PCV3 fusion epitope in VLP nanoparticles. DETAILED DESCRIPTION

[0030] Below, the specific implementation methods of the present application are described in detail with reference to the accompanying drawings.

[0031] Hereinafter, embodiments of the present invention will be described.

[0032] The invention relates to a porcine circovirus type 3 epitope nanoparticle antigen. The porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope or a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope.

[0033] The present invention relates to a porcine circovirus type 3 epitope nanoparticle vaccine (or PCV3 nanoparticle vaccine), wherein the nanoparticle vaccine comprises an immunizing amount of the porcine circovirus type 3 epitope nanoparticle antigen and a pharmaceutically acceptable carrier; wherein the porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope.

[0034] The term "immunizing amount" should be understood as an "immunologically effective amount", also known as an immunoprotective amount or an effective amount for producing an immune response, which is an amount of antigen that can effectively induce an immune response in the recipient, and this amount is sufficient to prevent or improve the signs or symptoms of the disease, including adverse health effects or its complications. The immune response may be sufficient for diagnostic purposes or other tests, or may be suitable for preventing signs or symptoms of the disease, including adverse health consequences or complications caused by infections caused by pathogens. Humoral immunity or cell-mediated immunity or both can be induced. The immune response of animals to the immunogenic composition can be indirectly assessed by, for example, measuring antibody titers, lymphocyte proliferation analysis, or directly assessed by monitoring signs or symptoms after attacking with wild-type strains, and the protective immunity provided by the immunogenic composition can be assessed by measuring, for example, clinical signs of the test animal, such as a reduction in healthy litters, an increase in the number of stillbirths, the overall physiological condition of the test animal, and the overall health and performance of the test animal. The immune response may include, but is not limited to, inducing cellular and / or humoral immunity.

[0035] The term "pharmaceutically acceptable carrier" refers to all other ingredients in the vaccine composition of the present invention except the circovirus antigen, a carrier or diluent that does not stimulate the body and does not hinder the biological activity and properties of the used compound, preferably an adjuvant. The term "adjuvant" may include alumina adjuvants; saponins (saponin), such as Quil A, QS-21 (Cambridge Biotech Incorporation, Cambridge MA), GPI-0100 (Galenica Pharmaceuticals Incorporation, Birmingham AL); water-in-oil emulsions; oil-in-water emulsions; water-in-oil-in-water emulsions; polymers of acrylic acid or methacrylic acid; copolymers of maleic anhydride and alkenyl derivatives. The term "emulsion" may be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oils resulting from olefin oligomerization, such as squalane or squalene oil, especially isobutylene or decene; linear alkyl-containing esters of acids or alcohols, more particularly vegetable oils, ethyl oleate, propylene glycol di-(caprylate / decene), glycerol tri-(caprylate / decene) or propylene glycol dioleate; esters of branched fatty acids or alcohols, especially isostearates. The oil is used in combination with an emulsifier to form an emulsion. Emulsifiers are preferably nonionic surfactants, especially esters of sorbitan, esters of mannide (such as anhydrous mannitol oleate), esters of fatty glycols, esters of polyglycerols, esters of propylene glycol and esters of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene block copolymers, especially Pluronic products, in particular L121. See Hunter et al., The theory and practical application of adjuvants (Ed. by DES Stewart-Tull, John Wiley and Sons, New York, 1995: 51-94) and Todd et al., Vaccine (1997, 15: 564-570). For example, the SPT emulsion described on page 147 and the MF59 emulsion described on page 183 of "Vaccine design, the Subunit and adiuvant approach" edited by Powell M and Newman M (Plenum Press, 1995) can be used.The term "polymer of acrylic acid or methacrylic acid" is preferably a crosslinked acrylic acid or methacrylic acid polymer, in particular crosslinked with a polyalkenyl ether of sugar or a polyol, such compounds being known as carbomers (Carbopol, trade name) (Phameuropa, 1996, 8 (2)). A person skilled in the art may also refer to U.S. Pat. No. 2,909,462, which describes such acrylic acid polymers crosslinked with polyhydroxylated compounds having at least 3 hydroxyl groups, preferably not more than 8, wherein the hydrogen atoms of at least 3 hydroxyl groups are replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. Preferred groups are those containing 2-4 carbon atoms, such as vinyl, allyl and other ethylenically unsaturated groups. The unsaturated groups themselves may contain other substituents, such as methyl. These products are sold under the name Carbopol, (BF Goodrich, Ohio, USA) being particularly suitable. They are crosslinked with allyl sucrose or with allyl pentaerythritol. Among these, Carbopol 974P, 934P and 971P may be mentioned, with Carbopol 971P being most preferred. The term "copolymers of maleic anhydride and alkenyl derivatives" may also consider copolymers of maleic anhydride and ethylene EMA (Monsanto), which polymers dissolve in water to produce an acidic solution, which is neutralized, preferably to physiological pH, in order to produce an adjuvant solution into which the immunogenic, immunogenic or vaccine composition itself can be incorporated. The term "adjuvant" also includes, but is not limited to, RIBI adjuvant system (Ribi Incorporation), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin (recombinant or other), cholera toxin, IMS 1314, muramyl dipeptide, Gel adjuvant, etc. Preferably, the adjuvant comprises one or more of mineral oil, aluminum gel adjuvant, saponin, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymer of acrylic acid or methacrylic acid, copolymer of maleic anhydride and alkenyl derivative, RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide, Montanide ISA 206, Montanide ISA 201 or Gel adjuvant.

[0036] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 fusion epitope (PCV3 fusion epitope) comprises B cell epitopes P10 73-87aa, P21 161-175aa, P26 201-214aa and T cell epitopes P20153-167aa, P21 161-175aa, P24 185-199aa. The PCV3 fusion epitope-SpyTag sequence is a nucleotide sequence as shown in SEQ.ID NO 4.

[0037] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content is ≥30 μg / ml.

[0038] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content is 30 μg / ml to 100 μg / ml.

[0039] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content is 50 μg / ml.

[0040] In the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content can also be selected from 30 μg / ml to 50 μg / ml, or 50 μg / ml to 100 μg / ml.

[0041] In the nanoparticle vaccine of the present invention, the porcine circovirus type 3 epitope nanoparticle antigen content is 30 μg / ml, 40 μg / ml, 50 μg / ml, 60 μg / ml, 70 μg / ml, 80 μg / ml, 90 μg / ml or 100 μg / ml.

[0042] According to the present invention, SpyCatcher-PCV2 is used to display PCV3 fusion epitopes in cells to form VLP nanoparticles, and the vaccine using the nanoparticles has the potential to prevent PCV2 and PCV3 at the same time.

[0043] The present invention relates to a porcine circovirus type 3 VLP nanoparticle vaccine, wherein the VLP nanoparticle vaccine comprises an immunizing amount of the porcine circovirus type 3 VLP nanoparticle antigen and a pharmaceutically acceptable carrier; wherein the porcine circovirus type 3 VLP nanoparticle antigen is a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope.

[0044] As an embodiment of the present invention, in the VLP nanoparticle vaccine of the present invention, the porcine circovirus type 3 fusion epitope comprises B cell epitopes P10 73-87aa, P21 161-175aa, P26 201-214aa and T cell epitopes P20 153-167aa, P21161-175aa, P24 185-199aa. The PCV3 fusion epitope-SpyTag sequence is the nucleotide sequence shown in SEQ.ID NO4.

[0045] As an embodiment of the present invention, in the VLP nanoparticle vaccine of the present invention, the porcine circovirus type 3 VLP nanoparticle antigen content is ≥30 μg / ml.

[0046] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 VLP nanoparticle antigen content is 30 μg / ml to 100 μg / ml.

[0047] As an embodiment of the present invention, in the nanoparticle vaccine of the present invention, the porcine circovirus type 3 VLP nanoparticle antigen content is 50 μg / ml.

[0048] In the nanoparticle vaccine of the present invention, the porcine circovirus type 3 VLP nanoparticle antigen content can also be selected from 30 μg / ml to 50 μg / ml, or 50 μg / ml to 100 μg / ml.

[0049] In the nanoparticle vaccine of the present invention, the porcine circovirus type 3 VLP nanoparticle antigen content is 30 μg / ml, 40 μg / ml, 50 μg / ml, 60 μg / ml, 70 μg / ml, 80 μg / ml, 90 μg / ml or 100 μg / ml.

[0050] According to a preferred embodiment, the pharmaceutically acceptable carrier includes an adjuvant, and the adjuvant includes: (1) mineral oil, aluminum gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide, Montanide ISA 206, Montanide ISA 201, Gel adjuvant; preferably, the saponin is Quil A, QS-21, GPI-0100; the adjuvant content is 5%-60% V / V, preferably from 30%-60% V / V, more preferably 50% V / V.

[0051] According to a preferred embodiment, the adjuvant is Montanide ISA 201. Preferably, the adjuvant content is 50% V / V.

[0052] According to a preferred embodiment, the pharmaceutically acceptable carrier includes drugs, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants and preservatives; the immunostimulants include α-interferon, β-interferon, γ-interferon, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF) and interleukin 2 (IL2).

[0053] To prepare such a vaccine, methods known in the art can be used.

[0054] The vaccine according to the present invention can be prepared into an oral dosage form or a non-oral dosage form.

[0055] Preferred are non-oral dosage forms that can be administered by intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal or epidural routes.

[0056] The present invention also relates to the use of the nanoparticle antigen in the preparation of a drug for preventing porcine circovirus-related diseases, wherein the porcine circovirus-related diseases are related diseases caused by infection with porcine circovirus type 2 and porcine circovirus type 3 alone or by a mixed infection thereof.

[0057] As an embodiment of the present invention, the application of the drug for preparing a drug for preventing porcine circovirus-related diseases is the application of the drug for preparing a drug for preventing multisystemic wasting syndrome in weaned piglets, porcine dermatitis and nephropathy syndrome, proliferative necrotizing pneumonia, reproductive disorders, and inflammatory responses of the heart and multiple systems.

[0058] The term "porcine circovirus-related disease" used in the present invention refers to diseases caused by single or mixed infection of porcine circovirus type 2 and type 3. Non-exhaustive examples include dermatitis and nephropathy, reproductive disorders, and inflammatory reactions of the heart and multiple systems in pigs, but are not limited thereto.

[0059] The term "prevention" when referring to diseases associated with porcine circovirus type 2 and type 3 infection alone or in combination means inhibiting the replication of porcine circovirus type 2 and type 3, inhibiting the transmission of porcine circovirus type 2 and type 3, or preventing porcine circovirus type 2 and type 3 from establishing in their hosts, as well as alleviating the symptoms of diseases or conditions caused by porcine circovirus type 2 and type 3 infection.

[0060] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0061] The chemical reagents used in the examples of the present invention are all analytically pure and purchased from Sinopharm Group. The experimental methods described in the present invention are all conventional methods unless otherwise specified; the biological materials described can be obtained from commercial channels unless otherwise specified.

[0062] Example 1 Construction of E. coli strain expressing PCV3 Cap protein and protein preparation

[0063] 1.1 Gene synthesis

[0064] The optimized gene sequence of PCV3 Cap (GenBank: UYE91634.1) was used for gene synthesis to obtain the optimized Cap gene sequence: improved-PCV3 Cap (SEQ ID NO. 1).

[0065] 1.2 Primer design

[0066] Upstream and downstream primers were designed based on the improved-PCV3 sequence and synthesized by GeneWeichi.

[0067] Upstream primer F: 5'-TATACCATGGGCATGCGTCACAGAGCTATATTTC-3'

[0068] Downstream primer R: 5'-TACGCTCGAGCAGAACGGACTTGTAACGAATCC-3',

[0069] 1.3 Strain construction

[0070] The improved-PCV3Cap target gene fragment with restriction sites added at both ends was obtained by PCR amplification. After gel recovery, the improved-PCV3 Cap and the pET28a vector were double-digested with NcoI / XhoI, and ligated overnight after gel recovery. The ligation products were transformed into Escherichia coli competent DH5α cells, positive clones were screened, and the recombinant plasmid with correct sequencing was named PET28a-improved-PCV3 Cap.

[0071] 1.4 Protein expression and purification

[0072] The recombinant plasmid was transformed into competent E. coli BL21 (DE3) cells (kanamycin resistance), and monoclonal colonies were selected and expanded at 37°C until OD600 = 1. The final concentration of 0.5mM chemical inducer isopropylthiogalactoside (IPTG) was added at 28°C to induce the expression of the target protein, and the uninduced group without IPTG was set as the control. After 28°C, 16-20h induction, the induced group and the uninduced group were collected, and the cells were resuspended by adding 20mM PB, 500mM NaCl, pH8.0, and crushed at 800bar for 3-5 times. The supernatant was centrifuged for SDS-PAGE analysis. The supernatant of the induced group was added to a final concentration of 40% saturated ammonium sulfate, stirred at 4°C for 30 minutes, and then centrifuged to collect the precipitate, which was resuspended in a solution made of 20mM PB, 500mM NaCl, pH8.0. The reconstituted solution was centrifuged to obtain the supernatant, which was filtered through a 0.45μm filter membrane to remove fine impurities. The filtered supernatant was purified by conventional nickel column affinity chromatography; washing buffer (50mM imidazole, 20mM PB, 500mM NaCl); elution buffer (500mM imidazole, 20mM PB, 500mM NaCl); the eluate was collected and dialyzed overnight with dialysis buffer (20mM PB, 500mM NaCl, pH8.0) at 4°C to obtain the target protein, which was analyzed by SDS-PAGE. The results showed that compared with the supernatant band of the uninduced group, a clear target band of 27 kD appeared in the supernatant of the induced group, which was consistent with expectations, indicating that PCV3 Cap was soluble and expressed, and the purity of the purified protein was about 80%.

[0073] Example 2 Preparation of PCV3 Cap-positive serum

[0074] 2.1 Cap subunit vaccine preparation

[0075] The prepared antigen protein PCV3-Cap was sterile filtered, mixed and emulsified with Montanide ISA 201 adjuvant to obtain porcine circovirus type 3 subunit vaccine with a protein concentration of 0.1 mg / ml. After passing the sterility test, viscosity test and stability test as required by the appendix of the current edition of the Chinese Pharmacopoeia of Veterinary Medicine, it was placed at 2-8°C for use.

[0076] 2.2 Cap subunit vaccine immunization

[0077] The 21-27-day-old experimental pigs were collected, and the anti-PCV3 antibodies were measured using an ELISA kit (Establishment and application of an indirect ELISA for porcine circovirus 3, DOI: 10.1007 / s00705-017-3607-7). All were negative. The 10 antibody-negative pigs were randomly divided into two groups. Among them, the blank control group had 5 pigs, and 1 ml of sterilized PBS was injected into the neck muscle; the experimental group had 5 pigs, and 1 ml of Cap subunit vaccine was injected into the neck muscle. At 21 days after immunization, the same vaccine and the same dose were used for two immunizations. The serum samples of the experimental pigs were collected 14 days after the second immunization (35 days after the first immunization).

[0078] 2.3 Antibody level detection after the second immunization

[0079] Antibodies were detected using an ELISA kit. The results are shown in Table 1

[0080] Table 1 Note: Negative sample OD 450 Average = 0.057

[0081] According to the results of the classic indirect ELISA, P / N < 1.6 is antibody negative; 2.1 > P / N ≥ 1.6 is antibody suspicious; P / N ≥ 2.1 is antibody positive. According to the above judgment criteria, the experimental group can reach the antibody positive standard after the second immunization, and the antibody positive rate is 100%.

[0082] Example 3 Solid Phase Synthesis and Purity Detection of Peptides

[0083] According to the amino acid sequence of the Cap protein, 26 overlapping polypeptides were chemically synthesized. The polypeptides were synthesized by Jiangsu GenScript Biotechnology Co., Ltd., and the purity of the final polypeptide purification product was >90%.

[0084] Example 4 Screening of B cell epitopes using dot blot hybridization

[0085] Cut 5 groups of NC membranes of appropriate size and mark 1cm×1cm squares on the NC membranes; dissolve and dilute the 26 synthetic polypeptides in Example 3 to a concentration of 1mg / ml; use a pipette to draw 10μl of polypeptide solution and dot it in the squares in turn. After drying, add 5% skimmed milk powder blocking solution and block for 2h. Put the blocked NC membranes into five groups of 1:25 diluted immunized pig sera (from step 2.2) respectively, and incubate at room temperature for 1h. Discard the reaction solution and wash three times with PBST buffer for 5min each time. Put the washed NC membrane into 1:2000 diluted HRP-labeled goat anti-pig IgG and incubate at room temperature for 1h. Discard the reaction solution and wash three times with PBST buffer for 5min each time. Then use the DAB color development kit for color development. After the colored spots appear, wash the membrane with water to terminate the reaction, observe and take pictures to record the results. See the results. Figure 1 ,Depend on Figure 1 The results showed that P10 73-87aa, P21 161-175aa, and P26 201-214aa were B cell epitopes.

[0086] Example 5 Screening of T cell epitopes using ELISpot-γ

[0087] 5.1 Isolation of porcine peripheral blood mononuclear cells

[0088] 5 ml of pig anterior vena cava blood from the five immunized pigs in Example 2 was collected using EDTA anticoagulation vacuum blood collection tubes and transferred into 15 ml centrifuge tubes. According to the operation steps of the pig peripheral blood lymphocyte separation kit (Tianjin Haoyang Biology), 5 ml of sample diluent was added, inverted and mixed, 5 ml of diluted blood was transferred into a clean 15 ml centrifuge tube, 5 ml of separation solution was added, inverted and mixed, and centrifuged at 20°C, 600g for 25 min. After centrifugation, the annular milky white lymphocyte layer in the centrifuge tube was carefully transferred to a new centrifuge tube, 10 ml of washing solution was added, the cells were mixed, centrifuged at 250g for 10 min, the supernatant was discarded, 5 ml of washing solution was used to resuspend the obtained cells with a pipette, centrifuged at 250g for 10 min, the supernatant was discarded, and after repeated washing twice, the obtained cells were resuspended with CTL serum-free medium (CTL ImmunoSpot kit).

[0089] 5.2 Isolation of porcine spleen lymphocytes

[0090] The five immunized pigs in Example 2 were euthanized and their spleens were removed after dissection. The pig spleens were sterile treated with 75% alcohol, washed three times with PBS, cut into small pieces, placed in folded two layers of sterile gauze, ground in a dish containing PBS, and filtered into a centrifuge tube. Lymphocytes were then separated according to the operating steps in 5.1.

[0091] 5.3 ELISpot-γ screening of T cell epitopes

[0092] Take the cells from step 5.1 and 5.2 respectively, count the cells after DAPI staining, and adjust the cell concentration to 3×10 5 Cells / mL for standby use. According to the operating procedures of the CTL ImmunoSpot kit (CTL, USA), the peptide solution was diluted with CTL culture medium 1:1. Take out the ELISpot plate, add 150μl / well PBS to wash once, add 100μl / well diluted peptide solution to the experimental group, add culture medium to the control group, and then add 100μl / well CTL culture medium diluted lymphocytes (300,000 cells / well). Place in a CO2 incubator, culture at 37℃ for 24h, then take out, wash the plate twice with phosphate buffered saline (PBS), wash the plate twice with PBST (which is a solution prepared by adding PBS and 0.05% Tween-20), add 80μl / well porcine IFN-γ detection solution, incubate at room temperature for 2h, wash the plate three times with PBST, add 80μl / well labeled antibody and incubate at room temperature for 30min, wash the plate twice with PBST, wash the plate twice with distilled water, add 80μl / well colorimetric solution, incubate at room temperature for 15min, rinse with tap water to stop the reaction, and then rinse thoroughly and dry the plate. The number of spots was detected and counted using a CTL enzyme-linked immunospot analyzer. The results are shown in Figure 2 and Figure 3 .Depend on Figure 2 and Figure 3 The results showed that P20 153-167aa, P21 161-175aa, and P24 185-199aa were T cell epitopes.

[0093] Example 6 Determination of B cell epitopes and T cell epitopes

[0094] According to the screening test results of Example 4 and Example 5, it was determined that there were 5 epitope-displaying polypeptides among the 26 synthesized polypeptides, and the information was as follows:

[0095] P10 73-87aa SEQ: ETAISFEYYKILKMK (SEQ ID NO. 6) purity 91.5%

[0096] P20 153-167aa SEQ: GTTSAHPGQSLFFFS (SEQ ID NO. 7) purity 97.7%

[0097] P21 161-175aa SEQ: QSLFFFSRPTPWLNT (SEQ ID NO. 8) purity 94.4%

[0098] P24 185-199aa SEQ: LLWSIYVPEKTGMTD (SEQ ID NO. 9) purity 91.7%

[0099] P26 201-214aa SEQ: YGTKEVWIRYKSVL (SEQ ID NO. 10) purity 95.5%

[0100] Example 7 Construction of SpyCatcher-E2pCD Nanoparticles

[0101] 7.1 Gene Synthesis

[0102] Codon optimization and gene synthesis were performed according to the gene sequence of SpyCatcher (GenBank: MH425516) and the gene sequence of E2pCD (GenBank: X53560.1) in GenBank. The optimized SpyCatcher gene sequence: improved-SpyCatcher (SEQ ID NO.2) and the E2pCD gene sequence: improved-E2pCD (SEQ ID NO.3) were obtained respectively, and the genes were synthesized by GENEWIZ.

[0103] 7.2 Primer design

[0104] Overlapping PCR primers were designed based on improved-SpyCatcher and improved-E2pCD sequences and synthesized by Genewise.

[0105] Primer F1: 5'-GCCGCCATGGGCCATCATCATCATCATCACGGAAGTTCAGATTCTGCTACACACAT-3'(SEQID NO.11)

[0106] Primer R1: 5'-AGCTTTTTCTTCAGCAGCAGCCGGGGAGCCTCCCGAGCCGCC CGAGCCACCGGAACCGCCGATGTGAGCATCGCCTTTCGTGGC-3' (SEQ ID NO. 12)

[0107] Primer F2: 5'-GCCACGAAAGGCGATGCTCACATCGGCGGTTCCGGTGGCTCG GGCGGCTCGGGAGGCTCCCCGGCTGCTGCTGAAGAAAAAGCT-3' (SEQ ID NO. 13)

[0108] Primer R2: 5'-GCCGCTCGAGTTAAGCTTCCATCAGCAGCAG-3'(SEQ IDNO.14)

[0109] 7.3 Strain construction

[0110] The SpyCatcher-E2pCD target gene fragment with restriction sites added at both ends was obtained by overlapping PCR amplification. After gel recovery, SpyCatcher-E2pCD and pET28a vector were double-digested with NcoI / XhoI, and ligated overnight after gel recovery. The ligation products were transformed into Escherichia coli competent DH5α cells, positive clones were screened, and the recombinant plasmid with correct sequencing was named pET28a-SpyCatcher-E2pCD.

[0111] 7.4 Protein expression and purification

[0112] The recombinant plasmid was transformed into Escherichia coli competent BL21 (DE3) cells, and shake flask culture and nickel column purification were performed according to the protein expression and purification steps in Example 1. The results showed that compared with the supernatant band of the uninduced group, a clear target band of about 40 kD appeared in the supernatant of the induced group, which was consistent with expectations, indicating that SpyCatcher-E2pCD was soluble and expressed, and the purity of the purified protein was about 90%.

[0113] 7.5 Negative staining transmission electron microscopy

[0114] SpyCatcher-E2pCD protein was diluted to a concentration of 0.1 mg / mL with ddH2O. 10 μl of protein was pipetted onto a clean plastic film. The carbon-coated copper mesh after discharge was placed in the protein solution for 2 minutes, gently blotted with filter paper, and then gently washed twice with double distilled water. The filter paper was blotted, and then incubated with 2% uranyl acetate for 2 minutes and naturally air-dried. The size and morphology of the particles of the stained protein sample were observed by transmission electron microscopy. The results are shown in Figure 4 It can be seen that the fusion protein formed cage-like nanoparticles with a diameter of about 22 nm and uniform size, indicating that the constructed SpyCatcher-E2pCD can be used as a new type of nanoparticle carrier.

[0115] Example 8 Display of PCV3 fusion epitopes using SpyCatcher-E2pCD nanoparticles

[0116] 8.1 Construction of PCV3 fusion epitopes

[0117] The PCV3 fusion epitope-SpyTag sequence is shown in SEQ ID NO.4.

[0118] Primer F3: 5'-GCCGCATATGGAAACCGCGATCTCCTTTGAGTATTACAAGAT CCTGAAAATGAAAGGTGGTGGTGGTTCTGGCACCACTAGTGCA CATC-3'(SEQ ID NO.15)

[0119] Primer R3: 5'-AACCATCACGATGTGAGCCCCAGACCCTCCTGAACCGCCACTTCCCAGAACGGACTTGTAACGAAT-3'(SEQ ID NO.16)

[0120] Primer R4: 5'-GCCGCTCGAGTTATTTGGTCGGCTTGTACGCGTCAACCATCA CGATGTGAGCCCC-3'(SEQ IDNO.17)

[0121] The PCV3 fusion epitope PCV3 P1073-87aa-linker-153-214aa-SpyTag was amplified by overlapping PCR, wherein the sequence of the linker was GGTGGTGGTGGTTCT. According to the molecular cloning steps in Example 1, the plasmid pET28a-PCV3 fusion epitope-SpyTag with correct sequencing was obtained.

[0122] 8.2 Expression and purification of PCV3 fusion epitopes

[0123] The recombinant plasmid was transformed into Escherichia coli competent BL21 (DE3) cells, and shake flask culture and purification were performed according to the protein expression and purification steps in Example 1. The results showed that the PCV3 fusion epitope was soluble and expressed, and the purity of the purified target protein was about 90%. The protein concentration was adjusted to 0.5 mg / ml after BCA quantification.

[0124] 8.3 Display of PCV3 fusion epitopes

[0125] SpyCatcher-E2pCD nanoparticles and PCV3 fusion epitopes were mixed at a molar ratio of 1:3, reacted at 25°C for 2 hours, and then subjected to electrophoresis identification and negative staining transmission electron microscopy. The size and morphology of the particles were observed by transmission electron microscopy of the stained protein sample according to the steps in Example 1. The results are shown in FIG. Figure 5 As can be seen from the figure, the SpyCatcher-E2pCD nanoparticles displaying the PCV3 fusion epitope formed nanoparticles of about 22 nm.

[0126] Example 9 Detection of humoral immunity level after immunization of pigs with nanoparticles displaying PCV3 fusion epitope

[0127] 9.1 Preparation of Nanoparticle Vaccines

[0128] The nanoparticles displaying the PCV3 fusion epitope were sterile filtered, and the concentration was measured. They were mixed and emulsified with Montanide ISA 201 adjuvant to a final protein concentration of 0.1 mg protein / mL vaccine. After passing the sterility test, viscosity test, and stability test required by the appendix of the current edition of the Chinese Pharmacopoeia of Veterinary Medicine, they were placed at 2-8°C for use.

[0129] 9.2 Animal Evaluation of Nanoparticle Vaccines

[0130] The experimental pigs aged 21-27 days were taken, and the serum was collected and the anti-PCV3 antibody was determined by ELISA kit, which was negative. The 9 antibody-negative pigs were randomly divided into 9 groups. Among them, 3 pigs in the blank control group were injected with 1ml of sterilized PBS in the neck muscle; 3 pigs in the Cap protein vaccine group were injected with 1ml of Cap subunit vaccine in the neck muscle; 3 pigs in the nanoparticle vaccine group were injected with 1ml of nanoparticle vaccine in the neck muscle. At 21 days after immunization, the same vaccine and the same dose were used for two immunizations. The serum samples of the experimental pigs were collected 14 days after the second immunization (35 days after the first immunization). The antibody level was detected using an indirect ELISA kit, and the antibody test results are shown in Table 2.

[0131] Table 2 Note: Negative sample OD 450 Average = 0.069

[0132] According to the results of the classic indirect ELISA, P / N < 1.6 is negative for antibodies; 2.1 > P / N ≥ 1.6 is suspicious for antibodies; P / N ≥ 2.1 is positive for antibodies. According to the above judgment criteria, both the Cap protein vaccine group and the nanoparticle vaccine group can reach the antibody positive standard after the second immunization, and the antibody positive rate is 100%. Among them, the SpyCatcher-E2pCD display PCV3 epitope nanoparticle vaccine antibody P / N value is the largest, and the antibody level is the highest.

[0133] Example 10 Detection of CD4+CD8+T lymphocyte proliferation level after immunization of pigs with nanoparticle vaccine

[0134] 10.1 Isolation of porcine spleen lymphocytes

[0135] The spleen lymphocytes of pigs immunized with nanoparticle vaccine were isolated according to the steps in Example 5, and the cell concentration was adjusted to 1×10 6 cells / ml.

[0136] 10.2 Lymphocyte proliferation detection

[0137] After staining with CFSE, the prepared spleen cells were seeded into 24-well plates (1×10 6 cells / well), and resuspend the cells in buffer II (10 6 cells / 100 μl), and added cell membrane surface antibodies R-PE-labeled mouse anti-swine CD4+ and SPRD-labeled mouse anti-swine CD8+, and incubated on ice for 30 minutes. The proliferation of PCV3 antigen-specific spleen cells was detected by flow cytometry.

[0138] Figure 6 This is a flow cytometry data statistical diagram of lymphocyte proliferation after nanoparticle vaccine immunization. It can be seen from the figure that compared with single immunization with Cap, the positive rate after nanoparticle vaccine immunization has been significantly improved, which can significantly promote the proliferation of CD4+CD8+T lymphocytes and improve the level of cellular immunity.

[0139] Example 11 Preparation of porcine circovirus type 3 nanoparticle vaccine

[0140] The nanoparticles displaying the PCV3 fusion epitope are slowly added to the adjuvant, and the emulsifier is continuously stirred at a speed of 800 rpm for 12 minutes to mix. The adjuvant suitable for the present invention can be an adjuvant known to those skilled in the art. In the present invention, the adjuvant is selected as a biphasic adjuvant (water-in-oil-in-water emulsion), for example, Montanide ISA 201 adjuvant. The specific formula is shown in Table 3.

[0141] Table 3 Porcine circovirus type 3 nanoparticle vaccine ratio Components Vaccine 1 Vaccine 2 Vaccine 3 PCV3 nanoparticles (μg / ml) 30 50 100 Biphasic adjuvant (V / V%) 50％ 50％ 50％

[0142] Example 12 Immunogenicity test of porcine circovirus type 3 nanoparticle vaccine

[0143] Twenty healthy piglets aged 28 to 30 days, whose PCV2 and PCV3 antigens and antibodies were negative by ELISA, were randomly divided into 4 groups, 5 piglets / group, and immunized with porcine circovirus type 3 nanoparticle vaccine. Piglets in groups 1 to 3 were immunized with vaccines 1 to 3, respectively, and piglets in group 4 were not immunized as the challenge control group. Piglets in each immunization group were injected with 2 ml of vaccine / head, and piglets in the challenge control group were inoculated with 2 ml of normal saline / head. Each group was challenged 28 days after immunization, and the challenge dose was porcine circovirus type 3 SG strain (Porcine Circovirus type 3, strain SG, deposited in the China Center for Type Culture Collection, with the deposit number CCTCCNO.V201712, the deposit date is March 23, 2017, and the deposit address is Wuhan University, Wuhan, China), 10 5.0 TCID 50 / head. After the infection, the piglets in each group were observed continuously. All the experimental pigs were killed on day 25. The clinical symptoms, pathological changes and virus detection results of the piglets in each group were used for judgment. The specific results are shown in Table 4.

[0144] Table 4 Results of immunogenicity test of porcine circovirus type 3 nanoparticle vaccine

[0145] The results showed that the porcine circovirus type 3 nanoparticle vaccine could provide 100% (5 / 5) protection to piglets after immunization, while all piglets in the challenge control group became ill after challenge, indicating that the porcine circovirus type 3 nanoparticle vaccine provided by the present invention has good protective power.

[0146] Example 13 Intracellular display of PCV3 fusion epitopes using SpyCatcher-PCV2

[0147] 13.1 Primer Design

[0148] Primer F4: 5'-GCCGGGATCCGATTCTGCTACACACATAAAAT-3'(SEQ ID NO.18)

[0149] Primer R5: 5'-GCCGAAGCTTTTACGGATTAAGCCGGCGGAT-3'(SEQ ID NO.19)

[0150] 13.2 Strain construction and expression

[0151] According to the PCV2 Cap sequence (AY556475.1), the codon-optimized gene improved-PCV2 Cap (SEQID NO.5) was synthesized, the SpyCatcher-PCV2 Cap fragment was amplified using primers F4 and R5, the PCV3 fusion epitope-SpyTag fragment was amplified using primers F3 and R4, and they were sequentially connected to the pRSFDuet-1 plasmid, and the recombinant plasmid was transformed into Escherichia coli competent BL21 (DE3) cells, and shake flask culture and nickel column purification were performed according to the protein expression and purification steps in Example 1. The results showed that the co-expression of SpyCatcher-PCV2Cap and PCV3 fusion epitope-SpyTag formed a PCV2-PCV3 fusion epitope protein, and the expression was soluble. The purity of the purified target protein was about 90%. The size and morphology of the particles of the stained protein sample were observed by transmission electron microscopy according to the steps in Example 1. The results are shown in FIG. Figure 7, as can be seen from the figure, the PCV3 fusion epitope displayed by SpyCatcher-PCV2 Cap can be used in the cell to form VLP nanoparticles with a diameter of about 25 nm. The vaccine using the nanoparticles has the potential to prevent both PCV2 and PCV3.

[0152] Example 14 Preparation of porcine circovirus type 2 and type 3 nanoparticle vaccines

[0153] Porcine circovirus type 2 and type 3 nanoparticles are slowly added to the adjuvant, and the emulsifier is continuously stirred at a speed of 800 rpm for 12 minutes to mix. The adjuvant suitable for the present invention can be an adjuvant known to those skilled in the art. In the present invention, the adjuvant is selected as a biphasic adjuvant (water-in-oil-in-water emulsion), for example, Montanide ISA 201 adjuvant. The specific formula is shown in Table 5.

[0154] Table 5 Ratios of porcine circovirus type 2 and type 3 nanoparticle vaccines Components Vaccine 4 Vaccine 5 Vaccine 6 PCV2 / 3 nanoparticles (μg / ml) 30 50 100 Biphasic adjuvant (V / V%) 50％ 50％ 50％

[0155] Example 15 Immunogenicity test of porcine circovirus type 2 and type 3 nanoparticle vaccine

[0156] 40 healthy piglets at 28 to 30 days of age, which were negative for PCV2, PCV3 antigens and antibodies detected by ELISA, were randomly divided into 8 groups, 5 pigs / group, and immunized with the porcine circovirus type 2 and type 3 nanoparticle vaccines prepared in Example 14. Groups 5 to 6 were immunized with vaccine 4, groups 7 to 8 were immunized with vaccine 5, groups 9 to 10 were immunized with vaccine 6, and groups 11 to 12 were not immunized as the challenge control group. Each immunized group was injected with 2 ml / head of the immunogenic composition, and the control group was inoculated with 2 ml / head of normal saline. The challenge was carried out 28 days after immunization. Groups 5, 7, 9, and 11 were challenged with porcine circovirus type 2 HH3 strain (Porcine Circovirus type 2, strain HH3, deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC NO.V201726, a deposit date of June 4, 2017, and a deposit address of Wuhan University, Wuhan, China). 5.0 TCID 50 / head, Group 6, Group 8, Group 10, Group 12 were challenged with Porcine Circovirus type 3, strain SG (Porcine Circovirus type 3, strain SG, deposited in China Center for Type Culture Collection, with the deposit number of CCTCC NO.V201712, the deposit date of March 23, 2017, and the deposit address: Wuhan University, Wuhan, China), 10 5.0 TCID 50 / head. After the infection, each piglet was observed continuously and judged based on the clinical symptoms, pathological changes and virus detection results of each piglet. The specific results are shown in Table 6.

[0157] Table 6 Results of immunogenicity test of porcine circovirus type 2 and type 3 nanoparticle vaccines

[0158] The results showed that the porcine circovirus type 2 and type 3 nanoparticle vaccines could provide 100% (5 / 5) protection to piglets after one immunization with the piglets, while all the piglets in the challenge control group became ill after the challenge. This shows that the porcine circovirus type 2 and type 3 nanoparticle vaccines provided by the present invention have good protective efficacy. Moreover, the virus could not be detected in the pigs after the porcine circovirus type 2 and type 3 nanoparticle vaccines with different contents of the present invention were challenged, which means that after the porcine circovirus type 2 and type 3 nanoparticle vaccines of the present invention are immunized, even if the wild virus infects the immunized pigs, it will not affect the pigs' development, growth, eating and weight gain.

[0159] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes using the technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still falls within the scope of the technical solution of the present invention.

Claims

1. A porcine circovirus type 3 epitope nanoparticle antigen, wherein: The porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope or a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope.

2. The porcine circovirus type 3 epitope nanoparticle antigen according to claim 1, wherein The PCV3 fusion epitope comprises B cell epitopes P10 73-87aa, P21 161-175aa, P26 201-214aa and T cell epitopes P20 153-167aa, P21 161-175aa, P24185-199aa, wherein the amino acid sequences of P10, P20, P21, P24, P26 are SEQ ID NO. 6, 7, 8, 9 and 10, respectively; preferably, the PCV3 fusion epitope-SpyTag sequence is a nucleotide sequence as shown in sequence SEQ.ID NO 4.

3. The porcine circovirus type 3 epitope nanoparticle antigen according to claim 1, wherein The SpyCatcher-PCV2 nanoparticles having PCV3 fusion epitopes are VLP nanoparticles.

4. A method for preparing porcine circovirus type 3 epitope nanoparticle antigen, wherein: The porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope, and the preparation method comprises the following steps: constructing SpyCatcher-E2pCD nanoparticles; using SpyCatcher-E2pCD nanoparticles to display the PCV3 fusion epitope and form a nanoparticle antigen.

5. A method for preparing porcine circovirus type 3 epitope nanoparticle antigen, wherein: The porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope. The preparation method comprises the following steps: using SpyCatcher-PCV2 to display the PCV3 fusion epitope in cells to form VLP nanoparticles.

6. A porcine circovirus type 3 nanoparticle vaccine, wherein: The nanoparticle vaccine comprises an immunizing amount of the porcine circovirus type 3 epitope nanoparticle antigen and a pharmaceutically acceptable carrier; wherein the porcine circovirus type 3 epitope nanoparticle antigen is a SpyCatcher-E2pCD nanoparticle with a PCV3 fusion epitope or a SpyCatcher-PCV2 nanoparticle with a PCV3 fusion epitope.

7. The porcine circovirus type 3 nanoparticle vaccine according to claim 6, wherein The content of porcine circovirus type 3 epitope nanoparticle antigen is ≥30 μg / ml; Preferably, the porcine circovirus type 3 epitope nanoparticle antigen content is 20 μg / ml to 150 μg / ml, more preferably 30 μg / ml to 100 μg / ml; or Preferably, the porcine circovirus type 3 epitope nanoparticle antigen content is selected from 30 μg / ml to 50 μg / ml, or 50 μg / ml to 100 μg / ml.

8. The porcine circovirus type 3 nanoparticle vaccine according to claim 6, wherein The pharmaceutically acceptable carrier includes an adjuvant, and the adjuvant includes: (1) mineral oil, aluminum gel adjuvant, saponin, avridine, DDA; (2) water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion; or (3) polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives; and one or more of RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS 1314, muramyl dipeptide, Montanide ISA 206, Montanide ISA 201, Gel adjuvant; preferably, the saponin is QuilA, QS-21, GPI-0100; the adjuvant content is 5%-60% V / V, preferably from 30%-60% V / V, more preferably 50% V / V.

9. The porcine circovirus type 3 nanoparticle vaccine according to claim 8, wherein The adjuvant is Montanide ISA 201 adjuvant, and preferably, the adjuvant content is 50% V / V.

10. Use of the porcine circovirus type 3 epitope nanoparticle antigen according to any one of claims 1 to 3 in the preparation of a drug for preventing porcine circovirus-related diseases, wherein: The porcine circovirus-related disease is a related disease caused by single infection or mixed infection of porcine circovirus type 2 and porcine circovirus type 3.

Images