Microbacterium EW-2 and application thereof in degradation of organic pollutants

Abstract

The invention discloses microbacterium EW-2 and application thereof in degradation of organic pollutants, and belongs to the technical field of degradation of organic pollutants. On one hand, the invention provides the microbacterium EW-2, and on the other hand, the invention provides application of the microbacterium EW-2 in degradation of organic pollutants. Compared with the prior art, the microbacterium EW-2 has the following advantages: (1) the microbacterium EW-2 can take p-xylene, toluene and ethylbenzene as carbon sources and energy sources to realize efficient degradation of p-xylene, toluene and ethylbenzene, the degradation rate of p-xylene in 24 hours can reach 99% or above, the degradation rate of ethylbenzene in 28 hours can reach 99% or above, and the degradation rate of p-toluene can reach 70% or above; (2) the microbacterium EW-2 disclosed by the invention can adapt to a wide temperature range and a wide pH range, can grow and propagate at the temperature of 20-40 DEG C and the pH of 5.0-9.0, and can degrade p-xylene to a certain extent.

Description

Technical Field

[0001] The invention relates to a microbacterium and application thereof in degrading organic pollutants, belonging to the technical field of organic pollutant degradation. Background Art

[0002] The chemical industry is a pillar industry in my country, which is related to the national economy and people's livelihood, economic development and national security. However, the rapid development of the industry has also led to the emergence of environmental problems. The volatile organic compounds (VOCs) and other air pollutants emitted by it have become the focus of controlling the concentration of atmospheric ozone (O3) and improving the quality of the atmospheric environment in the surrounding and even regional areas. VOCs are not only important precursors of secondary organic aerosols (SOA) and particulate matter (PM), but also an important cause of photochemical smog, haze and greenhouse effect. From the perspective of human health, their toxicity and fine aerosols constitute carcinogenic and non-carcinogenic risks. At present, the emission of VOCs in my country is still at a high level, and has replaced sulfur dioxide as a binding indicator of atmospheric environmental quality.

[0003] Paraxylene (C8H 10 ) is an organic compound and one of the important aromatic compounds. It is a colorless and transparent liquid with an aromatic odor at room temperature. It is used as a raw material for polyester fibers and resins, coatings, dyes and pesticides in organic synthesis. It will be discharged into the environment through various wastes in the processing of spinning, production of polyester fibers, tire industry and some pharmaceutical production. When humans inhale paraxylene, it will irritate the upper respiratory tract. At high concentrations, it will have an anesthetic effect on the central nervous system, including dizziness, nausea, vomiting, chest tightness, convulsions and coma. Liquid paraxylene can cause eye, skin and respiratory irritation. Therefore, it is of great practical significance to carry out research on the purification of paraxylene waste gas.

[0004] The biological method of purifying VOCs is based on microorganisms, which can use specific target pollutants as carbon sources for their own growth and reproduction, thereby converting and degrading pollutants into simple inorganic substances (CO2, H2O, etc.) and cell components, thereby eliminating pollution. It has the advantages of low cost, high removal efficiency, and no secondary pollution, and has become one of the research hotspots in the field of air pollution control technology. However, there has been no report on the efficient degradation strains of Microbacterium that can use p-xylene as a carbon source and energy source, which hinders the efficient treatment of waste gas containing p-xylene by biological methods. Summary of the invention

[0005] In view of the problems existing in the prior art, the purpose of the present invention is to design and provide a technical solution for the application of Microbacterium EW-2 and its application in degrading organic pollutants. The Microbacterium EW-2 provided by the present invention can use p-xylene and its analogs as carbon sources and energy sources to achieve efficient degradation of p-xylene, which is of great significance to the engineering application of biological purification of p-xylene.

[0006] The present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of the present invention provides a strain of Microbacterium sp. EW-2, which has been deposited in the China Center for Type Culture Collection on January 22, 2024, with a deposit number of CCTCC No: M 2024174, and is classified as Microbacterium sp.

[0008] The above-mentioned Microbacterium was isolated from the activated sludge of a petrochemical enterprise in Ningbo, Zhejiang. It is an aerobic Gram-positive bacterium with a rod-shaped, light yellow, opaque, plump, smooth and moist colony, easy to pick up, and the bacterial moss grows along the streaks. After 16SrDNA sequencing, it was determined to be a Microbacterium genus and named Microbacterium sp. EW-2.

[0009] The microbacterium EW-2 of the present invention can grow and reproduce with p-xylene as a carbon source and energy source, efficiently degrade p-xylene, and can adapt to a wide range of temperature and pH. In addition, the microbacterium EW-2 can also grow and reproduce with toluene and ethylbenzene as carbon sources and energy sources, and efficiently degrade toluene and ethylbenzene.

[0010] The second aspect of the present invention provides the use of the Microbacterium EW-2 in degrading organic pollutants.

[0011] As a preferred embodiment of the above technical solution, the organic pollutant is one or more of p-xylene, toluene and ethylbenzene.

[0012] The third aspect of the present invention provides a method for degrading organic pollutants, which comprises the following steps:

[0013] a. Inoculate the Microbacterium EW-2 described in claim 1 into a solid slant culture medium, and culture at 25-30° C. for 48-72 hours to obtain slant bacteria;

[0014] b. Inoculate the slant bacteria into an inorganic salt culture medium and culture at 25-30°C for 24-36 hours to obtain an OD 600 = 0.1~0.2 bacterial solution;

[0015] c. mixing the bacterial solution and the organic pollutants to prepare a mixed solution;

[0016] d. subjecting the mixed solution to degradation reaction at 20-40°C.

[0017] Furthermore, the solid slant culture medium in step a comprises the following components in parts by weight: yeast powder 0.50-1.00 g / L, soluble starch 0.50-1.00 g / L, MgSO4·7H2O 0.50-1.00 g / L, tryptone 0.50-1.00 g / L, glucose 0.50-1.00 g / L, sodium pyruvate 0.30-0.60 g / L, K2HPO4·3H2O 0.45-0.90 g / L, agar 18-20 g / L, and the solvent is deionized water.

[0018] Furthermore, the inorganic salt culture medium in step b contains the following components in parts by mass: Na2HPO4·12H2O 1.0~5.0g / L, KH2PO4 0.2~1.2g / L, (NH4)2SO4 0.3~2.8g / L, MgSO4·7H2O 0.18~0.23g / L, CaCl2 0.022~0.24g / L, trace element mother solution 0.8~1.2mL / L, and the solvent is deionized water.

[0019] Furthermore, the pH of the inorganic salt culture medium in step b is 4.0-10.0.

[0020] Furthermore, the organic pollutants in step c are one or more of p-xylene, toluene and ethylbenzene.

[0021] Furthermore, the concentration of organic pollutants in step c is 20 to 600 mg / L.

[0022] Further, the trace element mother solution in step d comprises the following components: FeSO4·7H2O 0.8-1.2 g / L, CuSO4·5H2O 0.015-0.025 g / L, H3BO3 0.013-0.015 g / L, MnSO4·4H2O 0.08-0.13 g / L, ZnSO4·7H2O 0.08-0.13 g / L, Na2MoO4·2H2O 0.015-0.025 g / L, and CoCl2·6H2O 0.015-0.025 g / L, and the solvent is deionized water.

[0023] Compared with the prior art, the present invention has the following advantages:

[0024] (1) The Microbacterium EW-2 of the present invention can use p-xylene, toluene and ethylbenzene as carbon sources and energy sources to achieve efficient degradation of p-xylene, toluene and ethylbenzene. The degradation rate of p-xylene can reach more than 99% in 24 hours, the degradation rate of ethylbenzene can reach more than 99% in 28 hours, and the degradation rate of toluene can reach more than 70%;

[0025] (2) The Microbacterium EW-2 of the present invention can adapt to a wide range of temperature and pH, and can grow and reproduce at 20-40°C and pH 5.0-9.0 and degrade p-xylene to a certain extent. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a transmission electron micrograph of Microbacterium EW-2;

[0027] Figure 2 is the phylogenetic tree of Microbacterium EW-2;

[0028] Figure 3 It is the bacterial growth and p-xylene degradation curve of Microbacterium EW-2;

[0029] Figure 4 The bar graphs show the effects of different pH values ​​on the degradation performance (Figure A), mineralization efficiency (Figure B), and growth (Figure C) of Microbacterium EW-2.

[0030] Figure 5 The effects of different temperatures on the degradation efficiency (Figure A), mineralization efficiency (Figure B) and growth (Figure C) of Microbacterium EW-2;

[0031] Figure 6 The degradation performance of Microbacterium EW-2 on p-xylene with different initial concentrations;

[0032] Figure 7 This is the growth curve of Microbacterium EW-2 at different initial p-xylene concentrations. DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with the embodiments.

[0034] The components of each culture medium used in the following examples are as follows:

[0035] Inorganic salt culture medium: Na2HPO4·12H2O 4.5g / L, KH2PO4 1.0g / L, (NH4)2SO4 2.5g / L, MgSO4·7H2O 0.2g / L, anhydrous CaCl2 0.023g / L, trace element mother solution 1mL / L, pH 7.0, solvent is deionized water;

[0036] The components of the trace element mother solution are as follows: FeSO4·7H2O 1.0 g / L, CuSO4·5H2O 0.02 g / L, H3BO3 0.014 g / L, MnSO4·4H2O 0.10 g / L, ZnSO4·7H2O 0.10 g / L, Na2MoO4·2H2O 0.02 g / L, CoCl2·6H2O 0.02 g / L, and the solvent is deionized water.

[0037] R2A solid slant culture medium: yeast powder 0.50 g / L, soluble starch 0.50 g / L, MgSO4·7H2O0.50 g / L, tryptone 0.50 g / L, glucose 0.50 g / L, sodium pyruvate 0.30 g / L, K2HPO4·3H2O0.45 g / L, agar 18 g / L, solvent is deionized water, pH value is natural.

[0038] Example 1: Isolation, purification and identification of Microbacterium EW-2

[0039] (1) Isolation and purification of Microbacterium EW-2

[0040] Activated sludge was collected on-site from a petrochemical enterprise in Ningbo, Zhejiang Province. The lower layer of sludge after standing was mixed with inorganic salt culture medium at a ratio of 1:2 (v / v). 3L of the mixture was connected to a 5L sludge acclimation tank. p-Xylene was used as the only carbon source and energy source for the whole system. After acclimation and cultivation at room temperature (25°C) for nearly 20 days, 5mL of sludge was taken from the acclimation tank and added into a shake flask containing 50mL of inorganic salt culture medium. It was found that the acclimated sludge could stably degrade 100mg / L p-Xylene in the shake flask every day, and the degradation rate could reach more than 90% (shake flask experimental conditions: 30°C, 160r / min).

[0041] 5 mL of the sludge sample in the shake flask was transferred to other shake flasks to further test its degradation performance. It was found that the transferred sludge could stably degrade 100 mg / L of p-xylene per day in the shake flask. The sludge sample was transferred and enriched for 6 generations (5 mL for the first 3 times, 2 mL for the fourth time, and 1 mL for the last two times). Then the sludge after 6 generations of enrichment was transferred for 10 -1 ~10 -6 The bacteria were plated at multiple times, and single colonies were picked. The degradation performance of para-xylene was determined using para-xylene as a carbon source and energy source. The bacteria were separated and purified to obtain a strain with para-xylene degradation activity.

[0042] (2) Identification of Microbacterium EW-2

[0043] The colonies of Microbacterium EW-2 are rod-shaped, light yellow, opaque, plump, smooth and moist, easy to pick up, and the bacterial moss grows along the streaks. Figure 1 shown.

[0044] The physiological and biochemical characteristics of Microbacterium EW-2 are: aerobic, Gram staining positive.

[0045] The strain EW-2 was subjected to 16S rDNA sequencing, and the sequencing work was completed by Sangon Biotech (Shanghai) Co., Ltd. The 16S rDNA (SEQ ID NO.1) of the strain EW-2 is as follows (Genebank accession number is PP528765):

[0046] CAGGCTCAGGATGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGA

[0047]

[0048] GGTCCCAGTTCGGATTGAGGTCTGCAACTCGACCTCATGAAGTCGGAGTC

[0049] GCTAGTAATCGCAGATCAGCAACGCTGCGGTGAATACGTTCCCGGGTCTTG

[0050] TACACACCGCCCGTCAAGTCATGAAAGTCGGTAACACCTGAAGCCGGTGG

[0051] CCCAACCCTTGTGGAGGGAGCCGTCGAAGGTGGGATCGGTAATTAGGACTAAGTCGTAA.

[0052] The 16S rDNA sequence of strain EW-2 was uploaded to the Ezbiocloud.net website, compared with the standard strains on the website, and the bacterial phylogenetic tree was constructed using the Neighbor-Joining method using MEGA-X software, and evaluated using the Bootstrap method (repeated 1000 times). The constructed phylogenetic tree is shown in Figure 2 , thus determining that the strain EW-2 belongs to the genus Microbacterium, named Microbacterium sp. EW-2, and deposited in the China Center for Type Culture Collection on January 22, 2024, with a deposit number of CCTCC No: M 2024174, address: Wuhan University, Wuhan, China, Postal Code 430072.

[0053] Example 2: Expansion of Microbacterium EW-2

[0054] After the Microbacterium EW-2 is expanded and cultured, a bacterial solution containing Microbacterium EW-2 is obtained. The specific process is as follows:

[0055] 1) Slant culture: Inoculate Microbacterium EW-2 into R2A solid slant medium and culture at 30°C for 72 h to obtain slant cells;

[0056] 2) Expanded culture: Use an inoculation loop to pick the slant bacteria obtained in step 1) and inoculate them into an inorganic salt medium, culture at 30°C for 24 hours, and obtain the OD 600 =0.1 bacterial solution.

[0057] Example 3: Performance of Microbacterium EW-2 in degrading p-xylene

[0058] The bacterial solution prepared in Example 2 was inoculated into 50 mL of fresh inorganic salt medium (pH = 7) containing 100 mg / L p-xylene, and the initial bacterial cell concentration was OD 600 =0.02. Design 3 parallel samples and 1 blank control group without inoculation. Cultivate in a shaker at 30°C and 160r / min. Take samples every 4-6 hours to determine the degradation rate of p-xylene, and draw out a portion of the bacterial solution with a 5mL syringe to determine the bacterial OD value. The results are shown in Figure 3 .

[0059] from Figure 3 It can be seen that with the extension of time, the bacterial concentration gradually increased, and the bacterial concentration reached the maximum after 24 hours of cultivation (about OD 600 =0.20), the degradation rate of p-xylene reached more than 99%. This shows that Microbacterium EW-2 can use p-xylene as a carbon source and energy source for growth and reproduction, and has the ability to degrade p-xylene stably and efficiently.

[0060] Example 4: Effect of initial pH on the degradation of p-xylene by Microbacterium EW-2

[0061] The inorganic salt medium was adjusted to different pH values ​​(4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0) with 1 mol / L NaOH aqueous solution or 1 mol / L H2SO4 aqueous solution; the bacterial solution prepared in Example 2 was inoculated into 50 mL of fresh inorganic salt medium containing 100 mg / L p-xylene, and the initial bacterial cell concentration was expressed as OD 600 The sample was shaken and cultured in a constant temperature shaker at 30°C and 160r / min. After 24 hours of culture, samples were taken to measure the degradation rate of p-xylene and OD in the reaction solution. 600 Value and CO2 value, see Figure 4 .

[0062] from Figure 4It can be seen that within the range of pH = 5.0-9.0, Microbacterium EW-2 can grow and reproduce with p-xylene as carbon source and energy source, and degrade p-xylene to a certain extent; within the range of pH = 6.0-8.0, Exiguobacterium SLQ-1 has a high degradation rate of p-xylene (more than 95%). At the same time, the growth amount and CO2 value of Microbacterium EW-2 also show a trend consistent with the degradation rate of p-xylene.

[0063] Example 5: Effect of temperature on the degradation of p-xylene by Microbacterium EW-2

[0064] The bacterial solution prepared in Example 2 was inoculated into 50 mL of fresh inorganic salt medium (pH = 7) containing 100 mg / L p-xylene, and the initial bacterial cell concentration was OD 600 =0.02. Each sample was placed in a shaker at 20°C, 25°C, 30°C, 35°C, and 40°C for constant temperature shaking culture (the shaker speed was 160r / min). Three parallel samples and a blank control group without bacterial strains were designed at each temperature. Samples were taken after 24 hours of culture to measure the degradation rate of p-xylene and OD 600 Value and CO2 value, see Figure 5 .

[0065] from Figure 5 It can be seen that within the temperature range of 20-40°C, Microbacterium EW-2 can grow and reproduce using p-xylene as a carbon source and energy source, and degrade p-xylene to a certain extent; within the temperature range of 30-35°C, Microbacterium EW-2 has a high degradation rate of p-xylene (more than 90%), and the growth amount and CO2 value produced by Microbacterium EW-2 also have a trend consistent with the degradation rate of p-xylene.

[0066] Example 6: Effect of substrate concentration on the degradation of p-xylene by Microbacterium EW-2

[0067] Different concentrations of substrate p-xylene (initial concentrations were 100, 200, 300, 400, 500, and 600 mg / L, respectively) were added to fresh inorganic salt culture medium, and the bacterial solution prepared in Example 2 was inoculated to make the initial bacterial cell concentration measured in OD 600 The OD value of EW-2 was calculated as 0.02. Three parallel samples and a blank control group without inoculation were designed. The culture was carried out in a shaker at 30°C and 160 r / min. Samples were taken at regular intervals to measure the OD value of EW-2. 600 and p-xylene concentrations, the results are shown in Figure 6 and Figure 7 .

[0068] from Figure 6 and Figure 7It can be seen that when the concentration of the three p-xylenes is 100-400 mg / L, Microbacterium EW-2 can reproduce rapidly within 24 hours and can almost completely degrade p-xylene after 24 hours; with the increase of p-xylene concentration, the complete degradation time also increases to a certain extent.

[0069] Example 7: Degradation ability of Microbacterium EW-2 on different carbon source substrates

[0070] In addition to p-xylene, other substrates (substrate concentrations are shown in Table 1) were added to the fresh inorganic salt medium, and the bacterial solution prepared in Example 2 was inoculated to make the initial bacterial cell concentration measured in OD 600 The culture was performed in a shaker at 30°C and 160 r / min, and the OD was measured after 28 h. 600 The results are shown in Table 1. It was found that Microbacterium EW-2 could degrade toluene and ethylbenzene to varying degrees.

[0071] Table 1 Degradation ability of Microbacterium EW-2 on different carbon source substrates

[0072]

[0073] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0074] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. Microbacterium sp. EW-2, whose deposit number is CCTCC No: M 2024174.

2. Use of Microbacterium EW-2 according to claim 1 in degrading organic pollutants.

3. The use according to claim 2, characterized in that: The organic pollutants are one or more of p-xylene, toluene and ethylbenzene.

4. The method for degrading organic pollutants by Microbacterium EW-2 according to claim 1, characterized in that: The following steps are involved: a. inoculating the microbacterium into a solid slant culture medium, culturing at 25-35° C. for 48-72 hours, and obtaining slant bacteria; b. Inoculate the slant bacteria into an inorganic salt culture medium and culture at 25-30°C for 24-36 hours to obtain an OD 600 = 0.1~0.2 bacterial solution; c. mixing the bacterial solution and the organic pollutants to prepare a mixed solution; d. subjecting the mixed solution to degradation reaction at 20-40°C.

5. The method according to claim 4, characterized in that The solid slant culture medium in step a comprises the following components in parts by weight: 0.50-1.00 g / L yeast powder, 0.50-1.00 g / L soluble starch, 0.50-1.00 g / L MgSO4·7H2O, 0.50-1.00 g / L tryptone, 0.50-1.00 g / L glucose, 0.50-1.00 g / L sodium pyruvate, 0.30-0.60 g / L K2HPO4·3H2O, 0.45-0.90 g / L, and 18-20 g / L agar, and the solvent is deionized water.

6. The method according to claim 4, characterized in that The inorganic salt culture medium in step b comprises the following components in parts by mass: Na2HPO4·12H2O 1.0-5.0 g / L, KH2PO4 0.2-1.2 g / L, (NH4)2SO4 0.3-2.8 g / L, MgSO4·7H2O 0.18-0.23 g / L, CaCl2 0.022-0.24 g / L, and trace element mother solution 0.8-1.2 mL / L, and the solvent is deionized water.

7. The method according to claim 4 or 6, characterized in that: The pH of the inorganic salt culture medium in step b is 4.0-10.

0.

8. The method according to claim 4, characterized in that The organic pollutants in step c are one or more of p-xylene, toluene and ethylbenzene.

9. The method according to claim 4 or 8, characterized in that: The concentration of organic pollutants in step c is 20-600 mg / L.

10. The method according to claim 6, characterized in that The trace element mother solution in step d comprises the following components: FeSO4·7H2O 0.8-1.2 g / L, CuSO4·5H2O 0.015-0.025 g / L, H3BO3 0.013-0.015 g / L, MnSO4·4H2O 0.08-0.13 g / L, ZnSO4·7H2O 0.08-0.13 g / L, Na2MoO4·2H2O 0.015-0.025 g / L, and CoCl2·6H2O 0.015-0.025 g / L, and the solvent is deionized water.

Images