Monoclonal antibody for resisting porcine delta coronavirus and hybridoma cell strain, antigen epitope peptide and application thereof

Abstract

The invention discloses an anti-porcine delta coronavirus monoclonal antibody as well as a hybridoma cell strain, an antigen epitope peptide and application thereof, and belongs to the technical field of biological detection. The hybridoma cell strain PDCoV-S2-2E9 is preserved in the China Center for Type Culture Collection, the address is Wuhan University, Wuhan, China, the preservation date is August 14, 2024, and the preservation number is CCTCC NO: C2024224. The monoclonal antibody 2E9 secreted by the cell strain can specifically recognize PDCoV S2 protein, has excellent specificity and reactivity, has no cross reaction with other common porcine enteroviruses, and can be applied to laboratories and clinical detection.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a monoclonal antibody against porcine delta coronavirus and a hybridoma cell line, an antigenic epitope peptide and application thereof. Background Art

[0002] Porcine deltacoronavirus (PDCoV) belongs to the genus deltacoronavirus of the family Coronaviridae. It is an enveloped single-stranded positive-strand RNA virus with an envelope diameter of 60-180nm and a genome size of approximately 25.4kb (excluding the PolyA tail). The genome is arranged in the following order: 5' non-coding region, open reading frame 1a / 1b (ORF1a / 1b), S (spike protein), E (envelope protein), M (membrane protein), non-structural protein 6 (NS6), N (nucleocapsid protein), non-structural protein 7 (NS7) and 3' UTR. The coronavirus spike protein (S) is the main structural component of the viral envelope. The S protein of the S2 subunit is responsible for mediating the fusion between the host and viral membranes, and plays a vital role in mediating the virus binding to cell surface receptors and entering host cells.

[0003] The PDCoV virus mainly causes diarrhea, vomiting, dehydration and even death in newborn piglets. The clinical symptoms are very similar to those caused by porcine epidemic diarrhea virus (PEDV) and transmissible gastroenteritis virus (TGEV), causing great harm to the global pig industry. Studies have shown that PDCoV not only infects pigs, but also other species, including humans, birds, chickens and cattle, with potential cross-species transmission risks. So far, the pathogenesis of PDCoV is still unclear, and there is no commercial vaccine or therapeutic drug for PDCoV. In addition, the clinical and pathological symptoms of PDCoV are similar to those of other porcine enteric coronaviruses and are difficult to distinguish. So far, the diagnosis of porcine enteric coronavirus infection mainly relies on viral nucleic acid detection, including RT-PCR, RT-LAMP, RT-qPCR, nested RT-PCR, microfluidic RT-LAMP chip, new reverse transcription droplet digital PCR detection, etc. Although sensitive and reliable, the cost is relatively high. Serological detection methods mainly include indirect ELISA, immunohistochemistry, IF and virus neutralization test. Among them, ELISA method is more convenient and rapid, but false positive reactions often occur during the detection process of serological method, and the detection sensitivity is low. Therefore, in order to further control the spread of PDCoV, reduce its potential threat to public health, and effectively conduct virus detection and antiviral treatment, it is necessary to establish a rapid and accurate diagnostic method to monitor PDCoV. Summary of the invention

[0004] The purpose of the present invention is to provide a monoclonal antibody against porcine delta coronavirus and its hybridoma cell line, antigenic epitope peptide and application to solve the problems existing in the above-mentioned prior art. The present invention harvests a hybridoma cell line PDCoV-S2-2E9, and the monoclonal antibody 2E9 secreted by the cell line can specifically recognize the PDCoV S2 protein, has excellent specificity and reactivity, has no cross reaction with other common porcine enteroviruses, and can be used in laboratory and clinical detection.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a hybridoma cell line PDCoV-S2-2E9, which is deposited in China Center for Type Culture Collection, address: Wuhan University, Wuhan, China, with a deposit date of August 14, 2024 and a deposit number of CCTCC NO: C2024224.

[0007] The present invention also provides an anti-PDCoV virus S2 subunit monoclonal antibody 2E9 secreted by the hybridoma cell line PDCoV-S2-2E9, wherein the monoclonal antibody 2E9 can specifically bind to the PDCoV virus antigen.

[0008] Preferably, the heavy chain subtype of the monoclonal antibody 2E9 is IgG1, and the light chain subtype is Kappa.

[0009] The present invention also provides a method for preparing the monoclonal antibody 2E9, wherein the hybridoma cell line PDCoV-S2-2E9 is secreted and proliferated in the peritoneal cavity of a mouse, and the ascites is separated and purified to obtain the monoclonal antibody 2E9.

[0010] The present invention also provides the use of the hybridoma cell line PDCoV-S2-2E9, the monoclonal antibody 2E9 or the monoclonal antibody 2E9 prepared by the preparation method in the preparation of a reagent or a kit for detecting porcine delta coronavirus.

[0011] The present invention also provides the use of the hybridoma cell line PDCoV-S2-2E9, the monoclonal antibody 2E9 or the monoclonal antibody 2E9 prepared by the preparation method in the preparation of a drug for preventing and treating porcine delta coronavirus infection.

[0012] The present invention also provides an antigen epitope peptide specifically recognized by the monoclonal antibody 2E9 or the monoclonal antibody 2E9 prepared by the preparation method, wherein the amino acid sequence of the antigen epitope peptide is shown in SEQ ID NO.51.

[0013] The present invention also provides the use of the antigen epitope peptide in the preparation of porcine delta coronavirus vaccine.

[0014] The present invention discloses the following technical effects:

[0015] The present invention uses lymphocyte hybridoma technology to harvest a hybridoma cell line PDCoV-S2-2E9, which can stably secrete a 2E9 monoclonal antibody (mAb) against the S2 subunit of the PDCoV virus. 2E9 was detected by using an antibody subtype kit, and its heavy chain was identified as IgG1 type, and the light chain was Kappa type, showing an alpha helical structure. The truncated PDCoV S2 protein was used to perform Western blot identification of the 2E9 monoclonal antibody on the recognized B cell epitope, and the minimum fragment recognized by mAb 2E9 was located on amino acid 21-PSAF-24. Importantly, the epitope of monoclonal antibody 2E9 is highly conserved in PDCoV strains. In addition, 3D structural analysis shows that the mAb 2E9 epitope is a linear peptide chain structure and is exposed on the surface of the S2 protein. These results indicate that the monoclonal antibody 2E9 against the PDCoV S2 protein prepared by the present invention has good specificity, and the identified epitope provides some basic information for further characterizing the antigenic structure of the PDCoVS2 protein, and lays a foundation for subsequent antiviral research on the fusion process of PDCoV and host cells and the establishment of a simple, rapid and accurate diagnostic method for PDCoV. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1The expression and identification results of PDCoV S2 recombinant protein; A is the PDCoV S2-PCR identification result, M is DL8000DNA marker, lane 1 is the pET-32a-PDCoV S2 recombinant protein expression plasmid, and lane 2 is the pET-32a empty vector; B is the SDS-PAGE identification of the bacterial solution after the pET-32a-PDCoV S2 recombinant protein expression plasmid was induced to express, M is the protein molecular mass marker, lane 1 is the PDCoV S2 recombinant protein band after SDS-PAGE of the bacterial solution supernatant collected after ultrasonic lysis, and lane 2 is the PDCoV S2 recombinant protein band after SDS-PAGE of the bacterial solution precipitate collected after ultrasonic lysis; C is the SDS-PAGE identification of the purified PDCoV S2 recombinant protein, M is the protein molecular mass marker, and lane 1 is the SDS-PAGE band of the purified PDCoV S2 recombinant protein; D is the Western blotting of the purified PDCoV S2 recombinant protein. Blot result diagram, M is the protein molecular mass marker, lane 1 is the pET-32a-PDCoV S2 recombinant protein, and lane 2 is the pET-32a empty vector;

[0018] Figure 2 The identification results of the monoclonal antibody 2E9 of the PDCoV S2 recombinant protein; wherein A is the IFA identification result diagram of PDCoV S2-2E9; B is the ELISA identification result diagram of PDCoV S2-2E9; C is the SDS-PAGE identification result after the monoclonal antibody 2E9 is purified, M is the protein molecular weight marker, and lane 1 is the purified pET-32a-PDCoV S2 recombinant protein; D is the PDCoV S2-2E9 antibody subtype identification result diagram;

[0019] Figure 3 The working concentration results of PDCoV S2-2E9 antibody IFA, ELISA and Western Blot are shown in Figure 1. A is the IFA working concentration diagram of PDCoV S2-2E9; B is the ELISA working concentration diagram of PDCoV S2-2E9; C is the Western Blot working concentration diagram of PDCoV S2-2E9;

[0020] Figure 4 The specific reaction test results of antibody 2E9; A is the test result of the indirect ELISA test method; B is the test result of the immunoblotting method, M is the protein molecular mass marker, lane 1 is PDCoV, lane 2 is TGEV, lane 3 is PEDV, lane 4 is PSV, and lane 5 is PAstV5; C is the test result of the specific IFA test method;

[0021] Figure 5 The figure shows the process and results of the identification of the hydrophilicity and recognized antigenic epitopes of antibody 2E9; A is the truncation process of the PDCoVS2 protein gene; B is 2E9 recognizing the S2-1 protein, M is the protein molecular weight marker, lane S2-1 is the PDCoV truncation S2-1, lane S2-2 is the PDCoV truncation S2-2, and lane S2-3 is the PDCoV truncation S2-3; C is 2E9 recognizing the S2-A-1 protein, M is the protein Molecular mass marker, lane 1 is PDCoV truncated S2-A-1, lane 2 is PDCoV truncated S2-A-2, lane 3 is PDCoV truncated S2-A-3, lane 4 is PDCoV truncated S2-A-4, lane 5 is PDCoV truncated S2-A-5, lane 6 is PDCoV truncated S2-A-6; D is 2E9 recognition of S2-B-4 and S2-B-5 proteins, M is the protein molecular mass marker ker, lane 1 is PDCoV truncated S2-B-1, lane 2 is PDCoV truncated S2-B-2, lane 3 is PDCoV truncated S2-B-3, lane 4 is PDCoV truncated S2-B-4, lane 5 is PDCoV truncated S2-B-5, lane 6 is PDCoV truncated S2-B-6; lane 7 is PDCoV truncated S2-B-7, lane 8 is PDCoV truncated S2-B-8, lane 9 is PDCoV truncation S2-B-9; E is 2E9 recognition of S2-D-3 protein, M is protein molecular mass marker, lane 1 is PDCoV truncation S2-D-1, lane 2 is PDCoV truncation S2-D-2, lane 3 is PDCoV truncation S2-D-3, lane 4 is PDCoV truncation S2-D-4, lane 5 is PDCoV truncation S2-D-5, lane 6 is PDCoV truncation S2-D-6;

[0022] Figure 6 This is the affinity test result of antibody 2E9 and PDCoV S2 antigen;

[0023] Figure 7 Figure 3 is the analysis result of the conservation and spatial structure of the S2 antigen epitope recognized by antibody 2E9; A is the phylogenetic analysis result based on the S gene of PDCoVHNZK-02 strain and 18 PDCoV reference strains in GenBank; B is the comparison result of the S2 antigen epitope recognized by antibody 2E9 with other strains; C is the spatial structure of the S2 antigen epitope recognized by antibody 2E9 on the PDCoV S2 protein. DETAILED DESCRIPTION

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0026] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0027] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0029] Example 1

[0030] 1. Materials

[0031] Strains, bacteria, cells, experimental animals and reagents:

[0032] PDCoV HNZK-02 strain (GenBanK accession number MH708124), TGEV HN-2012 strain (GenBanK accession number OP434397), PEDV HN-2021 strain (GenBanK accession number OR707084), PSV HNHB-01 strain (GenBanK accession number MN939541) and PAstV5 HNPDS-01 strain (GenBanK accession number OQ781001) were all deposited by the Animal Molecular Pathogenesis Laboratory of Henan Agricultural University. pET-32a(+) plasmid, LLC-PK1 cells and SP2 / 0 cells were all deposited by the Animal Molecular Pathogenesis Laboratory of Henan Agricultural University; BALB / c mice were purchased from Henan Provincial Experimental Animal Center; mouse monoclonal antibody subtype identification kit was purchased from Wuhan Sanying Biotechnology Co., Ltd.

[0033] 2. Methods

[0034] 1. Select the dominant region of PDCoV S2 antigen

[0035] DNA Star software was used to analyze the antigenicity of PDCoV S2, and the S2 antigen dominant region 1-608aa was selected.

[0036] 2. Construction and identification of pET-32a-PDCoV S2 recombinant vector

[0037] The total RNA of PDCoV was extracted by Trizol method and transcribed into cDNA using reverse transcription kit. According to the sequence of PDCoV HNZK-02 strain published by GenBank, primers were designed for amplification, and PCR amplification was performed using PDCoV cDNA as template. The primers are as follows:

[0038] F: GCCATGGCTGATATCGGATCCCTCCACATTACAGAATACTCGACCATC (SEQ ID NO. 1);

[0039] R: TTGTCGACGGAGCTCGAATTCCTACCATTCCTTAAACTTAAAGGACG (SEQ ID NO. 2).

[0040] Reaction program: 95°C for 5 min; 95°C for 1 min, 58°C for 30 s, 72°C for 1 min for a total of 34 cycles; 72°C for 10 min.

[0041] Reaction system (20 μL in total): Green Taq Mix 10 μL, ddH 2 O 7μL, primers 0.5μL each, cDNA 2μL.

[0042] The gene fragment and pET-32a(+) vector amplified by endonuclease Hind III and Xho I were ligated with T4 DNALigase and transformed into Escherichia coli BL-21. Single colonies were picked for bacterial liquid PCR identification. The strain with positive identification result (named as pET-32a-PDCoV S2) was sent to Shangya Biotechnology Co., Ltd. for sequencing, and the strain with correct sequence was retained for subsequent experiments.

[0043] 3. Expression and purification of recombinant PDCoV S2 protein

[0044] The frozen pET-32a-PDCoV S2 expression strain was inoculated into LB liquid medium with ampicillin resistance and shaken at 37°C. When it grew to the logarithmic phase (OD = 0.6), IPTG with a final concentration of 0.1 mmol / L was added to induce the expression of PDCoV S2 recombinant protein. The protein was treated with an ultrasonic disruptor for 40 minutes, and a protein purification experiment was performed. The purified protein solution was concentrated by ultrafiltration tube to obtain PDCoV S2 recombinant protein. The protein concentration was determined, and the protein was packaged and stored in a -80°C refrigerator. The identification results of the protein are as follows Figure 1 As shown in AD, Figure 1 The expression and identification results of PDCoV S2 recombinant protein; A is the PDCoV S2-PCR identification result, M is DL8000 DNA marker, lane 1 is pET-32a-PDCoV S2 recombinant protein expression plasmid, and lane 2 is pET-32a empty vector; B is the SDS-PAGE identification of the bacterial solution after the pET-32a-PDCoV S2 recombinant protein expression plasmid was induced to express, M is the protein molecular mass marker, lane 1 is the PDCoV S2 recombinant protein band after SDS-PAGE of the bacterial solution supernatant collected after ultrasonic lysis, and lane 2 is the PDCoV S2 recombinant protein band after SDS-PAGE of the bacterial solution precipitate collected after ultrasonic lysis; C is the SDS-PAGE identification of the purified PDCoV S2 recombinant protein, M is the protein molecular mass marker, and lane 1 is the SDS-PAGE band of the purified PDCoV S2 recombinant protein; D is the purified PDCoV The results of Western blot of S2 recombinant protein, M is the protein molecular mass marker, lane 1 is pET-32a-PDCoV S2 recombinant protein, and lane 2 is pET-32a empty vector.

[0045] 4. Screening of positive hybridoma cell lines

[0046] Four BALB / c mice were immunized with purified PDCoV S2 recombinant protein for a total of three immunizations, with an interval of 2 weeks between each immunization. The first immunization was 100 μg / mouse, emulsified with an equal volume of Freund's complete adjuvant suspension and protein solution, and the second and third immunization doses were 100 μg / mouse, emulsified with an equal volume of Freund's complete adjuvant suspension and protein solution, and the immunization route was subcutaneous immunization. A booster immunization was performed 3 days before fusion, with a booster immunization dose of 50 μg / mouse, without adding adjuvant, and injected intraperitoneally. When the serum titer was high, the spleen cells of the mouse with the highest serum titer were taken for cell fusion with myeloma cells (SP2 / 0), cultured with HAT selective medium, and then indirect ELISA detection was performed using recombinant PDCoV S2 recombinant protein coated ELISA plates to screen positive hybridoma cell lines, and subcloned to single cells by limiting dilution method, and then expanded to obtain a hybridoma cell line that stably secreted monoclonal antibodies, named PDCoV-S2-2E9, which was frozen in a liquid nitrogen tank.

[0047] The hybridoma cell line has been sent to the China Center for Type Culture Collection for preservation. The preservation date is August 14, 2024, and the preservation number is: CCTCC NO: C2024224.

[0048] 5. Preparation and purification of monoclonal antibody ascites

[0049] Healthy BALB / c mice were selected and 500 μL of liquid paraffin was injected into the peritoneal cavity one week before the cell injection. The hybridoma cells were injected into the peritoneal cavity of the mice. When the abdomen of the mice swelled, the ascites was extracted, and the excess fat tissue was removed by centrifugation and stored in a -40°C refrigerator. The monoclonal antibodies in the ascites were purified by caprylic acid-ammonium sulfate precipitation method, and the purified antibodies were verified by SDS-PAGE. The results are shown in the figure. Figure 2 As shown in C.

[0050] 6. Labeling of Antibody 2E9

[0051] The HRP coupling kit (periodate method, item number D601047) purchased from Shanghai Bioengineering Co., Ltd. was used for labeling according to the operating steps in the kit manual to obtain the HRP-labeled 2E9 antibody.

[0052] 7. Identification of monoclonal antibodies

[0053] 7.1 Identification by indirect immunofluorescence (IFA), the specific steps are as follows: LLC-PK1 cells were plated in 12-well plates and incubated at 37°C CO 2 The cells were placed in an incubator for 12 h and then inoculated with the PDCoV strain. A control group of cells not inoculated with the strain was set up and placed in a 37°C CO 2Place in the incubator for 10-12 hours, fix in 4% paraformaldehyde at room temperature for 15 minutes, wash 3 times with PBST, permeabilize with 0.5% Triton-X-100, incubate at room temperature for 10 minutes, wash 3 times with PBST, and then use antibody 2E9 (1:500 dilution) as the primary antibody of the experimental group, negative mouse serum (1:500 dilution) in the control group, and PDCoV-N antibody 6B7 (1:500 dilution) in the positive group (this antibody was prepared and preserved for this experiment, deposit number: CCTCC NO: C202178), incubate at 4°C for 12 hours, wash 5 times with PBST, and then use FITC-labeled goat anti-mouse IgG (1:500 dilution) as the secondary antibody. Then wash 5 times with PBST, add a mounting medium containing DAPI, observe and take pictures with an inverted fluorescence microscope, and the results are as follows Figure 2 As shown in A.

[0054] 7.2 The PDCoV S2-2E9 antibody was identified by the indirect ELISA experimental method. The PDCoV S2 recombinant protein (coated at 4°C for 12h) and PDCoV virus (coated at 37°C for 4h) were coated, and the plates were blocked with 2.5% BSA at 37°C for 2h. The PDCoVS2-2E9 antibody was used as the positive plate of the protein plate and the virus plate, and the negative mouse serum and blank culture medium MEM were used as the negative plate. The plates were incubated at 37°C for 1h, and then incubated with HRP-goat anti-mouse at 37°C for 1h. 100 μL of the color developing solution was added to each well, and the plates were incubated at 37°C for 10min. The stop solution was added to read the OD on a microplate reader. 450nm Value, the result is Figure 2 As shown in B.

[0055] Using the indirect ELISA method, the ELISA plate coated with PDCoV S2 recombinant protein was incubated at 4°C for 12h, blocked with 2.5% BSA, and PDCoV S2-2E9 was diluted at a ratio of 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, 1:256000, 1:512000, 100 μL per well, incubated at 37°C for 1h, incubated with secondary antibody goat anti-mouse at 37°C for 1h, added 100 μL of colorimetric solution per well, incubated at 37°C for 10min, and added stop solution to read OD on a microplate reader. 450nm The working concentration of PDCoV S2-2E9 antibody was optimized. Figure 3 As shown in B.

[0056] 7.3 The working concentration of PDCoV S2-2E9 antibody was optimized by Western Blot technology. The specific experimental steps are as follows: LLC-PK1 cells were plated in 12-well plates and incubated at 37°C CO 2The cells were placed in an incubator for 12 h and then inoculated with the PDCoV strain. A control group of cells not inoculated with the strain was set up and placed in a 37°C CO 2 Place in the incubator for 10-12 hours, collect the cell samples, add 6XLoading buffer and boil for 10 minutes to prepare PK cell samples infected with PDCoV virus and PK cell control samples. After the prepared gel is subjected to SDS-PAGE electrophoresis, the proteins on the protein gel are transferred to a nitrocellulose membrane, and the PDCoVS2-2E9 antibody is diluted with 5% skim milk in multiples, with dilution ratios of 1:2000, 1:4000, 1:8000, and 1:12000, respectively. Incubate on a shaker at 4°C for 12 hours, wash 5 times with TBST, and then use HRP-goat anti-mouse IgG antibody (diluted 1:5000) as the secondary antibody, incubate on a shaker at room temperature for 1 hour, wash 5 times with TBST, and develop. The results are as follows Figure 3 As shown in C, Figure 3 C represents different dilution multiples of 2E9 antibody (1:2000, 1:4000, 1:8000, 1:12000), lane 1 is PK cell samples infected with PDCoV virus, and lane 2 is PK cells.

[0057] 7.4 Optimization of IFA working concentration of PDCoV S2-2E9 antibody. The specific experimental steps are as shown in 7.1. The primary antibody of the experimental group was diluted in multiples, with dilution multiples of 1:400, 1:800, 1:1600, 1:3200, and 1:6400. The control group used negative mouse serum at a dilution of 1:400, and the positive group used PDCoVN-6B7 antibody (1:400 dilution). The cells were incubated at 4°C for 12 h, and FITC-labeled goat anti-mouse IgG (1:500 dilution) was used as the secondary antibody for incubation at room temperature for 1 h. Then, a mounting medium containing DAPI was added, and the cells were observed and photographed under an inverted fluorescence microscope. The results are shown in Figure 2. Figure 3 As shown in A.

[0058] 7.5 Identify the subtype of monoclonal antibody 2E9 according to the steps in the Wuhan Mitaka Mouse Monoclonal Antibody Subtype Identification Kit (Cat. No.: PK20002). The steps are as follows: Dilute the purified antibody 2E9 to 50 ng / mL with PBST and add 50 μL / well to the ELISA plate. Add 1× goat anti-mouse IgM+IgG-HRP to the ELISA plate at 50 μL / well. Incubate at room temperature for 1 hour, wash the plate 3 times with PBST, prepare the developer according to the ratio of A solution: B solution = 1:100, add 100 μL to each well, develop at room temperature in the dark for 15 minutes, add 100 μL of stop solution to each well, and read the OD with an ELISA reader 450nm Value, OD 450nm The well with the highest value corresponds to the corresponding subtype. Figure 2As shown in D, the heavy chain subtype of monoclonal antibody 2E9 is IgG1, and the light chain subtype is Kappa.

[0059] 8. Evaluation of the specific reactivity of antibody 2E9

[0060] PDCoV S2, PDCoV, TGEV, PEDV, PSV and PASTV5 proteins (all of the above proteins were stored in the Animal Molecular Pathogenesis Laboratory of Henan Agricultural University) were used for detection, and the indirect ELISA detection method was used to detect the reactivity of antibody 2E9 to different strains. The results are shown in Figure 4 As shown in A, it shows that antibody 2E9 has good specificity.

[0061] The reactivity of antibody 2E9 with LLC-PK1 cells infected with PDCoV, TGEV, PEDV, PSV, and PASTV5 was analyzed by immunoblotting. Figure 4 As shown in B, lanes 1 to 5 are the verification results of PDCoV, TGEV, PEDV, PSV and PASTV5, respectively, indicating that antibody 2E9 has good antibody specificity.

[0062] The specific IFA detection method was used to detect the specificity of 2E9 against LLC-PK1 cells infected with PDCoV, TGEV, PEDV, PSV, and PASTV5. Figure 4 As shown in C. It shows that the antibody 2E9 has good antibody specificity.

[0063] Among them, the detection method of specific IFA, the steps are as follows:

[0064] LLC-PK1 cells were inoculated with PDCoV, PAstV5, TGEV, PEDV, and PSV strains, respectively, and fixed with anhydrous ethanol at 4°C for 8 hours. A control group of cells without inoculation of strains was set up at the same time. Antibody 2E9 (1:500 dilution) was used as the primary antibody in each group, and FITC-goat anti-mouse IgG (1:500 dilution) was used as the secondary antibody. The positive control group used PDCoVN-6B7 as the primary antibody, and the negative control used negative mouse serum (1:500 dilution) as the primary antibody, and FITC-goat anti-mouse IgG (1:500 dilution) as the secondary antibody. After incubation with antibodies and washing with PBST, a mounting medium containing DAPI was added, and the cells were observed and photographed with an inverted fluorescence microscope.

[0065] 9. Identification of the hydrophilicity and recognized antigenic epitopes of monoclonal antibodies

[0066] The B cell epitope recognized by antibody 2E9 was identified through a large number of experiments. The amino acid sequence of PDCoV S2 protein was analyzed using DNA Star software. More accurate antigen epitopes were screened through continuous screening of truncations (see truncation method for details). Figure 5 A). The complete S gene was divided into three overlapping fragments by the first truncation and cloned into the pET-32a(+) vector, respectively named S2-1, S2-2 and S2-3. The generated 2E9 was used for protein prokaryotic expression and Western blot identification. The results showed that 2E9 was recognized in S2-1 (see Figure 5 B). S2-1 was truncated into S2-A1, S2-A2, S2-A3, S2-A4 and S2-A5, and these five truncations were verified by prokaryotic expression and SDS-PAGE. The results showed that 2E9 recognized S2-A-1 protein (see Figure 5 C). Then the S2-A-1 corresponding to 2E9 was expressed in prokaryotes as S2-B1, S2-B2, S2-B3, S2-B4, S2-B5, S2-B6, S2-B7, S2-B8, and S2-B-9, and these 9 fragments were verified by SDS-PAGE. The results showed that 2E9 could recognize S2-B-4 and S2-B-5 proteins (see Figure 5 The position of 2E9 at 21-25AA was detected by Western blot analysis. Then the corresponding truncation of 2E9 was extended forward and backward to design new truncations, which were divided into S2-D-1, S2-D-2, S2-D-3, S2-D-4, S2-D-5, and S2-D-6, respectively. These 6 truncated fragments were expressed in prokaryotic form and verified by SDS-PAGE. The results showed that 2E9 recognized the S2-D-3 protein (see Figure 5 E), combined with previous data, it was determined that 2E9 recognizes the position of 21-24AA.

[0067] The primer information used in the above truncation process is shown in Table 1.

[0068] Table 1 Primer sequence information

[0069]

[0070]

[0071]

[0072] 10. Affinity analysis of antibody 2E9

[0073] The Biacore X100 protein interaction analysis system was used at 25°C. The buffer exchange of the protein used for kinetic analysis was PBST (pH 7.0), and the PDCoV S2 recombinant protein (1 mg / mL) was immobilized on a CM5 chip using a standard EDC / NHS coupling method. The Biacore X100 protein interaction analysis system was used to analyze the binding affinity and kinetic parameters between the PDCoV S2 recombinant protein and antibody 2E9 by surface plasmon resonance (SPR). The results are shown in Tables 2 and Figure 6 The affinity of this antibody to PDCoV S2 antigen is 4.146×10 -9 M.

[0074] Table 2 Test results

[0075] mAbs ka(1 / Hs) Kd(1 / s) KD(M) Rmax(RU) Chi2(RU2) U-value mAb-2E9 <![CDATA[5.29×10 4 ]]> <![CDATA[2.196×10 -4 ]]> <![CDATA[4.146×10 -9 ]]> 15.47 1.32 15

[0076] 11. Prediction of the spatial structure of antigen epitopes

[0077] To analyze the conservation of the PDCoV S2 antigenic epitope, the S gene sequences of 18 PDCoV strains from different regions were obtained from NCBI (see Table 3). The neighbor joining (NJ) method in the Molecular Evolutionary Genetics Analysis (MEGA) software (version 7.0) was used with the p-distance model and 1000 bootstrap replicates. The S2 epitope identified by mAb 2E9 was compared with different virulent strains using DNAstar MegAlign software, and it was found that the epitope was conserved among PDCoV (see Figure 7 A), and clarified that the antigenic epitope peptide is PSAF (SEQ ID NO.51) (see Figure 7 In order to clarify the spatial location of the epitope on the PDCoV S2 protein, the three-dimensional structure of the PDCoV S2 protein was predicted on the Swiss model website (https: / / swissmodel.expasy.org), and its antigenic epitopes were marked using the Chimera software (see Figure 7 C).

[0078] Table 3 Epitope sequence information of PDCoV strains collected from NCBI for comparison and identification

[0079]

[0080]

[0081] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A hybridoma cell line PDCoV-S2-2E9 that secretes anti-PDCoV virus S2 subunit monoclonal antibodies is deposited in the China Center for Type Culture Collection, address: Wuhan University, Wuhan, China, the deposit date is: August 14, 2024, and the deposit number is CCTCC NO: C2024224.

2. An anti-PDCoV virus S2 subunit monoclonal antibody 2E9 secreted by the hybridoma cell line PDCoV-S2-2E9 according to claim 1, characterized in that: The monoclonal antibody 2E9 can specifically bind to the PDCoV viral antigen.

3. The monoclonal antibody 2E9 according to claim 2, characterized in that The heavy chain subtype of the monoclonal antibody 2E9 is IgG1, and the light chain subtype is Kappa.

4. A method for preparing the monoclonal antibody 2E9 according to claim 2 or 3, characterized in that: The hybridoma cell line PDCoV-S2-2E9 described in claim 1 is secreted and proliferated in the peritoneal cavity of mice, and the ascites is separated and purified to obtain the monoclonal antibody 2E9.

5. Use of the hybridoma cell line PDCoV-S2-2E9 according to claim 1, the monoclonal antibody 2E9 according to claim 2, or the monoclonal antibody 2E9 prepared by the preparation method according to claim 3 in the preparation of a reagent or kit for detecting porcine delta coronavirus.

6. Use of the hybridoma cell line PDCoV-S2-2E9 according to claim 1, the monoclonal antibody 2E9 according to claim 2, or the monoclonal antibody 2E9 prepared by the preparation method according to claim 3 in the preparation of a drug for preventing and treating porcine delta coronavirus infection.

7. An antigen epitope peptide specifically recognized by the monoclonal antibody 2E9 according to claim 2 or the monoclonal antibody 2E9 prepared by the preparation method according to claim 3, characterized in that: The amino acid sequence of the antigen epitope peptide is shown as SEQ ID NO.

51.

8. Use of the antigen epitope peptide according to claim 7 in the preparation of a porcine delta coronavirus vaccine.

Images