KL2 type Acinetobacter baumannii phage, screening method thereof, phage composition, application and medicine thereof

Abstract

The present invention discloses a KL2-type Acinetobacter baumannii phage and a screening method thereof, a phage composition, an application and a medicine, and relates to the field of phage technology. The KL2-type Acinetobacter baumannii phage is named Friunavirus AB_SZL2, deposited in the China Center for Type Culture Collection, and the deposit number is CCTCC NO: M20241522; or, the KL2-type Acinetobacter baumannii phage is named Obolenskvirus AB_SZL3, deposited in the China Center for Type Culture Collection, and the deposit number is CCTCC NO: M 20241523. The KL2-type Acinetobacter baumannii phage provided by the present invention can accurately target KL2-type Acinetobacter baumannii and has an efficient bactericidal effect, thereby reducing the harm of KL2-type Acinetobacter baumannii and effectively solving the problem of antibiotic resistance of KL2-type Acinetobacter baumannii.

Description

Technical Field

[0001] The present invention relates to the technical field of bacteriophages, and in particular to a KL2 type Acinetobacter baumannii phage and a screening method thereof, a bacteriophage composition, and applications and medicines thereof. Background Art

[0002] Acinetobacter baumannii ( Acinetobacter baumannii ) has become a major challenge to global public health due to its high incidence and strong transmission ability in hospital environments, and its resistance to multiple antibiotics (resistance rate to routinely monitored antibiotics is as high as 70%). Especially in the Intensive Care Unit (ICU), due to the common underlying diseases and low immunity of patients, coupled with the frequent performance of various invasive procedures, the risk of infection by Acinetobacter baumannii increases. Once infection occurs, it may cause severe hospital-acquired pneumonia, bloodstream infection, etc., which are difficult to treat and have a high mortality rate. Among them, hospital-acquired Acinetobacter baumannii pneumonia is one of the biggest challenges facing doctors. Due to its severe resistance to antimicrobial drugs, treatment options are very limited and the prognosis is often poor. Caused by multidrug-resistant Acinetobacter baumannii (multidrug-resistant Acinetobacter baumannii Ventilator-associated pneumonia (VAP) caused by carbapenem-resistant Acinetobacter baumannii (CRAB) has a significantly lower successful ventilator weaning rate compared to susceptible strains. Currently, infections caused by carbapenem-resistant Acinetobacter baumannii (CRAB) are primarily treated with antibiotics. Guidelines for the treatment of antimicrobial resistance recommend the use of polymyxin B or tigecycline, either alone or in combination, for CRAB infections. Although antibiotics have shown some promise in treating CARB-induced pneumonia, the risk of resistance persists (CRAB can rapidly develop resistance to polymyxin B). Furthermore, polymyxin B can have severe nephrotoxicity and neurotoxicity, while tigecycline has difficulty achieving effective concentrations in the lungs, limiting the clinical use of both drugs. Furthermore, amid the severe antibiotic resistance crisis, the capital investment and pipeline size for the development of new antibiotics are insufficient to meet the growing clinical demand. Therefore, there are few clinically available antibiotics for infections caused by MDRAB, they are highly invasive and have a high disease burden. There is an urgent need for a new method to treat pneumonia caused by MDRAB.

[0003] Bacteriophages are a type of virus that can infect and kill bacteria. Leveraging this property, the clinical application of phages to treat bacterial infections is called phage therapy. In clinical practice, phage therapy typically involves the use of a cocktail of several phages to prevent the development of phage resistance in bacteria, thereby increasing the success rate of clearing bacterial infections. More importantly, phage cocktails composed of screened fixed phage combinations can lyse a wide range of common, clinically prevalent strains of specific bacteria, holding the potential for development into pharmaceuticals.

[0004] Acinetobacter baumannii possesses a thick capsular polysaccharide (CPS) on its surface, producing a highly diverse array of CPS. These CPS molecules, as the primary antigens on the surface of A. baumannii, play a key role in host recognition and phage infection. The CPS structure of A. baumannii is determined by the K locus (KL type) on its chromosome. Genome sequence analysis has identified as many as 237 KL types. Types KL2, KL3, and KL7 are particularly common and are associated with multidrug resistance. KL2, in particular, exhibits higher levels of drug resistance than other capsular types, leading to more severe clinical symptoms and a significantly increased risk of mortality, posing a significant public health threat. Therefore, the development of a phage specifically targeting KL2 is urgent and holds significant practical promise.

[0005] Therefore, the existing technology still needs to be improved and developed. Summary of the Invention

[0006] Based on the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a KL2 type Acinetobacter baumannii phage and its screening method, phage composition and application and medicine, which are intended to be used to kill KL2 type Acinetobacter baumannii and reduce the harm of KL2 type Acinetobacter baumannii.

[0007] The technical solutions of the present invention are as follows:

[0008] In a first aspect of the present invention, a KL2 type Acinetobacter baumannii phage is provided, wherein the KL2 type Acinetobacter baumannii phage is named Friunavirus AB_SZL2, deposited in China Center for Type Culture Collection, with the deposit number CCTCC NO: M 20241522; or, the KL2 type Acinetobacter baumannii phage is named Obolenskvirus AB_SZL3 was deposited in China Center for Type Culture Collection with the deposit number of CCTCC NO: M 20241523.

[0009] A second aspect of the present invention provides a method for screening the KL2-type Acinetobacter baumannii phage of the present invention, comprising the following steps:

[0010] Pour the host bacterial solution and culture medium onto a plate, then spot the KL2 type Acinetobacter baumannii phage onto the plate and culture overnight to obtain the first round of phage products;

[0011] Cultivating the first round of phage products with host bacteria to obtain phage-resistant strains;

[0012] The phage-resistant strain was subjected to a second round of screening using a phage library to obtain a KL2-type Acinetobacter baumannii phage that overcomes phage resistance.

[0013] A third aspect of the present invention provides a phage composition, wherein the phage composition comprises at least one KL2-type Acinetobacter baumannii phage of the present invention as described above.

[0014] A fourth aspect of the present invention provides a drug, wherein the active ingredient of the drug includes the KL2-type Acinetobacter baumannii phage of the present invention as described above and / or the phage composition of the present invention as described above.

[0015] Optionally, the drug further comprises a pharmaceutically acceptable carrier.

[0016] Optionally, the pharmaceutically acceptable carrier includes at least one of an excipient, a glidant, a diluent, a preservative, a colorant, a flavoring agent, a wetting agent, a suspending agent, a stabilizer, an isotonic agent, a solvent, and an emulsifier.

[0017] Optionally, the drug further comprises an antibiotic; and / or,

[0018] The dosage form of the drug is selected from one of solution, aerosol, pill, tablet, capsule, powder, lozenge and paste.

[0019] In a fifth aspect, the present invention provides a use of the KL2 type Acinetobacter baumannii phage as described above and / or the phage composition as described above in the present invention for treating KL2 type Acinetobacter baumannii phage in the biosphere, wherein the use is for non-disease treatment purposes.

[0020] Optionally, the application method comprises the steps of:

[0021] Sampling from the biosphere to obtain samples to be tested;

[0022] Detecting the presence of a preset amount of Acinetobacter baumannii KL2 in the sample by PCR;

[0023] If a predetermined amount of KL2 Acinetobacter baumannii is present, the KL2 Acinetobacter baumannii phage and / or the phage composition of the present invention as described above is applied to the biosphere to eliminate the KL2 Acinetobacter baumannii.

[0024] Optionally, the primer pair used in the PCR detection includes a first primer pair and a second primer pair;

[0025] The first primer pair is:

[0026] Forward: TTGCTATAGTCCCAACGTTTATATTCCCATC;

[0027] Reverse: CCTGTCCCTACATATTCCATATATATTGTAGAGTC;

[0028] The second primer pair is:

[0029] Forward: TGATTGCTAAAAAAGATCTTGGGAAAGTGG;

[0030] Reverse: ACAAAGGCAACCCTGCTAGC.

[0031] Beneficial effects: The KL2 type Acinetobacter baumannii phage provided by the present invention can accurately target KL2 type Acinetobacter baumannii and has a highly efficient bactericidal effect, thereby reducing the harm of KL2 type Acinetobacter baumannii and effectively solving the problem of antibiotic resistance of KL2 type Acinetobacter baumannii. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The pie chart is a capsular genotype diagram of the multidrug-resistant Acinetobacter baumannii isolated from the clinic in Example 1.

[0033] Figure 2 This is a graph showing the changes in phage sensitivity of the phage-resistant strain induced in vitro in Example 1.

[0034] Figure 3 For Example 1 Friunavirus AB_SZL2 and Obolenskvirus Sensitivity result plot of AB_SZ3.

[0035] Figure 4 For Example 2 Friunavirus AB_SZL2 and Obolenskvirus Genome map of AB_SZ3 phage.

[0036] Figure 5 For Example 2 Friunavirus Transmission electron microscopy image of AB_SZL2.

[0037] Figure 6 For Example 2 Obolenskvirus Transmission electron microscopy image of AB_SZL3.

[0038] Figure 7 A is a timeline diagram of clinically isolated pathogens in Example 3, and B is a diagram of changes in phage sensitivity of clinical strains.

[0039] Figure 8 The results of the genome comparison between the resistant strain and the original strain NAB01B in Example 4 are shown in Figure 4, where A is gtrOC3 The result of gene mutation is shown in Figure B. wzy A diagram showing the results of gene mutation.

[0040] Figure 9 These are the characterization results of the phage-resistant strains in Example 4, where A is a graph showing changes in antibiotic sensitivity of Acinetobacter baumannii; B is a graph showing changes in the growth of Acinetobacter baumannii; C is a graph showing changes in the cell wall integrity of Acinetobacter baumannii; D is a graph showing changes in the biofilm formation ability of Acinetobacter baumannii; E is a graph showing changes in the virulence of Acinetobacter baumannii strains against Hela cells; F is a graph showing changes in the virulence of Acinetobacter baumannii strains against A549 cells; and G is a scanning electron micrograph of the capsule of Acinetobacter baumannii.

[0041] Figure 10 For the clinical Acinetobacter baumannii strain in Example 5 gtr3 Gene positive test result diagram. DETAILED DESCRIPTION

[0042] The present invention provides a KL2-type Acinetobacter baumannii phage, a screening method thereof, a phage composition, and applications and medicines thereof. To clarify and clarify the objectives, technical solutions, and effects of the present invention, the present invention is described in further detail below. It should be understood that the specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention.

[0043] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0044] The embodiment of the present invention provides a KL2 type Acinetobacter baumannii phage, wherein the KL2 type Acinetobacter baumannii phage is named Friunavirus AB_SZL2, deposited in China Center for Type Culture Collection, Wuhan University, Wuhan, China, on July 8, 2024, with a deposit number of CCTCC NO: M 20241522; or, the KL2 type Acinetobacter baumannii phage is named Obolenskvirus AB_SZL3 was deposited in China Center for Type Culture Collection, Wuhan University, Wuhan, China. The deposit date is July 8, 2024, and the deposit number is CCTCCNO: M 20241523.

[0045] The KL2 type Acinetobacter baumannii phage provided in the embodiment of the present invention can accurately target KL2 type Acinetobacter baumannii and has a highly efficient bactericidal effect, thereby reducing the harm of KL2 type Acinetobacter baumannii and effectively solving the problem of antibiotic resistance of KL2 type Acinetobacter baumannii.

[0046] An embodiment of the present invention further provides a method for screening the KL2 type Acinetobacter baumannii phage of the present invention as described above, comprising the following steps:

[0047] Pour the host bacterial solution and culture medium onto a plate, then spot the KL2 type Acinetobacter baumannii phage on the plate and culture overnight to obtain the first round of phage products;

[0048] Cultivating the first round of phage products with host bacteria to obtain phage-resistant strains;

[0049] The phage-resistant strain was subjected to a second round of screening using a phage library to obtain a KL2-type Acinetobacter baumannii phage that overcomes phage resistance.

[0050] The CPS structure of Acinetobacter baumannii is determined by the capsule gene site K locus (KL type) on its chromosome. Through genome sequence analysis, as many as 237 KL types have been identified. In particular, KL2 type Acinetobacter baumannii, compared with other capsule typing, shows a higher level of drug resistance, leading to more severe clinical symptoms, and is significantly associated with an increased risk of death in patients, posing a major threat to public health. In view of this, the development of a fixed formula phage cocktail preparation specifically for KL2 type Acinetobacter baumannii is particularly urgent and has important practical application prospects. Based on this, an embodiment of the present invention also provides a phage composition, wherein the phage composition includes at least one KL2 type Acinetobacter baumannii phage as described above in the embodiment of the present invention. Specifically, the phage composition includes Friunavirus AB_SZL2 and Obolenskvirus AB_SZL3, at this time the phage composition can also be called a phage cocktail preparation.

[0051] The phage composition provided in the embodiment of the present invention can accurately target KL2 type Acinetobacter baumannii and can effectively kill KL2 type Acinetobacter baumannii. In vitro experiments have confirmed that the phage composition includes Friunavirus AB_SZL2 and ObolenskvirusThe AB_SZL3 phage combination has a broad spectrum of lytic activity against KL2 MDRAB, capable of lysing over 90% of bacteria. When used in humans, it can significantly improve clinical efficacy. When used in hospital settings, it can significantly reduce the presence of KL2 Acinetobacter baumannii in the hospital environment, thereby reducing the incidence of nosocomial infections.

[0052] An embodiment of the present invention further provides a drug, wherein the active ingredient of the drug includes the KL2 type Acinetobacter baumannii phage of the present invention as described above, or includes the phage composition of the present invention as described above, or includes the KL2 type Acinetobacter baumannii phage of the present invention as described above and the phage composition of the present invention as described above.

[0053] The drug provided in the embodiment of the present invention can accurately target KL2 Acinetobacter baumannii, efficiently kill KL2 Acinetobacter baumannii, and can be used to treat infections caused by KL2 Acinetobacter baumannii.

[0054] In some embodiments, the medicament further comprises a pharmaceutically acceptable carrier.

[0055] In some embodiments, the pharmaceutically acceptable carrier includes at least one of an excipient, a glidant, a diluent, a preservative, a colorant, a flavoring agent, a wetting agent, a suspending agent, a stabilizer, an isotonic agent, a solvent, and an emulsifier.

[0056] In some embodiments, the drug further comprises an antibiotic. In this way, combined therapy can be achieved to further enhance the therapeutic effect. In some specific embodiments, the antibiotic includes but is not limited to at least one of polymyxin, tigecycline, piperacillin / tazobactam, ceftazidime, cefoperazone, cefepime, cefotaxime, imipenem, meropenem, amikacin, tobramycin, ciprofloxacin, levofloxacin, minocycline, trimethoprim-sulfamethoxazole, fluconazole, esapamicin, cefoperazone sulbactam, oxacillin, etanercept, linezolid, isopamicin, and colestipol.

[0057] In some embodiments, the dosage form of the drug is selected from one of solution, aerosol, pill, tablet, capsule, powder, lozenge, and paste.

[0058] An embodiment of the present invention further provides an application of the KL2 type Acinetobacter baumannii phage as described above in an embodiment of the present invention for treating KL2 type Acinetobacter baumannii phage in a biosphere, or an embodiment of the present invention further provides an application of the phage composition as described above in an embodiment of the present invention for treating KL2 type Acinetobacter baumannii phage in a biosphere, or an embodiment of the present invention further provides an application of the KL2 type Acinetobacter baumannii phage as described above in an embodiment of the present invention and the phage composition as described above in an embodiment of the present invention for treating KL2 type Acinetobacter baumannii phage in a biosphere, wherein the application is for non-disease treatment purposes.

[0059] In this embodiment, the biosphere refers to the sum of all organisms on Earth and their environments. The KL2-type Acinetobacter baumannii phage or phage composition is used to kill KL2-type Acinetobacter baumannii for non-therapeutic purposes, such as killing KL2-type Acinetobacter baumannii in hospital environments, other environments, or on the surfaces of objects. In other words, when it is necessary to kill KL2-type Acinetobacter baumannii in the air environment or on the surfaces of certain objects, the KL2-type Acinetobacter baumannii phage or phage composition can be used.

[0060] In some embodiments, the method of application comprises the steps of:

[0061] Sampling from the biosphere to obtain samples to be tested;

[0062] Detecting the presence of a preset amount of Acinetobacter baumannii KL2 in the sample by PCR;

[0063] If a predetermined amount of KL2 Acinetobacter baumannii is present, the KL2 Acinetobacter baumannii phage and / or the phage composition described above in the embodiments of the present invention are applied to the biosphere to eliminate the KL2 Acinetobacter baumannii.

[0064] In this embodiment, PCR testing can be used to rapidly detect and identify KL2 Acinetobacter baumannii, and combined with a KL2 Acinetobacter baumannii phage (or phage combination), this allows for the timely elimination of KL2 Acinetobacter baumannii. Specifically, if PCR is used to detect that the KL2 Acinetobacter baumannii population in a given biosphere has reached a predetermined level, i.e., a predetermined level, and elimination is required, the KL2 Acinetobacter baumannii phage (or phage combination) can be used to promptly and effectively eliminate the bacteria.

[0065] In some embodiments, the primer pair used in the PCR detection includes a first primer pair and a second primer pair;

[0066] The first primer pair is:

[0067] Forward (denoted as gtr3_F):TTGCTATAGTCCCAACGTTTATAATTCCCATC;

[0068] Reverse (denoted as gtr3_R ):CCTGTCCCTACATATTCCATATATATTGTAGAGTC;

[0069] The second primer pair is:

[0070] Forward (denoted as pgt1_F ): TGATTGCTAAAAAAGATCTTGGGAAAGTGG;

[0071] Reverse ( pgt1_R ):ACAAAGGCAACCCTGCTAGC.

[0072] Currently, there is a lack of rapid and accurate detection methods for KL2 Acinetobacter baumannii, which limits the ability to quickly identify KL2 Acinetobacter baumannii in the early stages of infection, which may lead to delayed application of phage therapy, thereby missing the critical period of treatment. In this embodiment, the capsular polysaccharide synthesis gene cluster was analyzed using the Acinetobacter baumannii K locus database, and Kaptive software (version 2.0.4) was used to identify KL types. By comparing the gene clusters of different KLs in the Kaptive database, it was found that gtr3 and gtr4 The gene is specifically located in KL2 and KL81. Compared with KL2 and KL81, only pgt1 This gene, which indicates that gtr3 and pgt1 The gene has the potential to be used to identify KL2. Further, by designing the above primer pairs, the combined detection gtr3 and pgt1 The gene can accurately and rapidly identify Acinetobacter baumannii KL2.

[0073] The present invention will be further described below with reference to specific examples.

[0074] Example 1

[0075] (1) Capsular gene analysis of MDRAB strains:

[0076] A total of 136 MDRAB strains were collected from multiple hospitals. All strains were sequenced by next-generation sequencing, and the capsule genes of these strains were analyzed using Kaptive software (version 2.0.4). It was found that KL2, KL7, KL77, and KL3 types were the main types (such as Figure 1 shown).

[0077] (2) FriunavirusAB_SZL2 (hereinafter referred to as AB_SZL2) and Obolenskvirus Isolation and purification of AB_SZL3 (hereinafter referred to as AB_SZL3):

[0078] 6 mL of collected hospital wastewater was centrifuged at 8000 g for 10 min, and the supernatant was filtered through a 0.22 μm filter membrane to obtain the filtrate;

[0079] Take 2 mL of the filtrate and add 1 mL of 3×LB broth and 200 μL of overnight grown host bacteria (final OD 600 About 0.1), after culturing for 5 h, a mixed culture solution was obtained;

[0080] Take 1 mL of the mixed culture, centrifuge at 12,000 rpm / min for 3 minutes, filter through a 0.22 μm filter membrane, take 10 μL of the supernatant, and spot plate. The results can be observed after 6 hours (or overnight). At the same time, take 500 μL of the supernatant, add 3 mL of LB broth and 200 μL of the host bacterial solution for further enrichment. After 5 hours (or overnight), spot plate. Repeat the enrichment three times. If obvious plaques are seen in the spot plate test, the solution should be inoculated onto an LB plate containing the host bacteria and serially diluted or streaked (to find single plaques).

[0081] Pick a single plaque and inoculate it repeatedly three times. Finally, store the purified phage at 4°C.

[0082] (3) Phage screening

[0083] When screening phages, in addition to the conventional double-layer plate method to verify phage sensitivity, in order to overcome the development of phage resistance (the development of phage resistance is often the reason for the failure of phage therapy), this embodiment also conducted a second round of screening. First, the clinical isolate NAB01B (isolated from sputum culture in the hospital laboratory) was used to perform a phage sensitivity test using the drop method (specifically, the host bacteria NAB01B bacterial solution and 1.5% LB agar medium were mixed at a volume ratio of 1:100 and poured onto the plate, 5 μL of phage was spotted on the plate, and cultured overnight at 37°C to observe whether clear plaques could be formed. If clear plaques could be formed, they were considered sensitive), and the first round of phages AB_SZL3 and AB_SZL4 were obtained. Subsequently, the clinical isolate NAB01B was used with 10 10The first round of phages of PFU were cultured at 37 ° C with a shaking speed of 220 rpm for 24 hours to induce the production of phage-resistant strains. 10 μL of the mixed culture was spread on LB solid medium and cultured at 37 ° C for 12 hours. The ten resistant monoclonal strains selected were named NAB01B-R1, NAB01B-R2, NAB01B-R3, NAB01B-R4, NAB01B-R5, NAB01B-R6, NAB01B-R7, NAB01B-R8, NAB01B-R9 and NAB01B-R10. The phage library was then used to perform a second round of screening for resistant strains. These resistant strains were divided into four categories according to their sensitivity to phages (such as Figure 2 As shown, Figure 2 In the analysis, the plaque formation rate refers to the ratio of the phage titer against the resistant strain to the titer against the original isolate, NAB01B. From a large number of candidate phages, AB_SZL2 and AB_SZL3 (their accession numbers are described above) were screened and identified. Both phages exhibited high specificity for KL2-type MDRABs and showed high specificity for the resistant strains.

[0084] In vitro experiments (using the droplet method, see above) confirmed the broad spectrum cleavage ability of AB_SZL2 and AB_SZL3 against KL2-type MDRABs (e.g. Figure 3 shown).

[0085] Furthermore, combining these two phage strains, this example provides a phage composition (composed of AB_SZL2 and AB_SZL3, with the ratio of AB_SZL2 to AB_SZL3 being 1:1, i.e., 1 PFU:1 PFU). In vitro experiments (using the spotting method, see above) confirmed the broad-spectrum lytic ability of this phage composition against KL2-type MDRABs, capable of lysing over 90% of the tested bacteria.

[0086] Example 2 Characterization of phage

[0087] The genome length of AB_SZL2 is 41359 bp. Sequence analysis showed that it belongs to the order Autographiviridae. Friunavirus AB_SZL2 has the highest coverage (93%) and similarity (95%) at the nucleotide level with Acinetobacter baumannii phage SWH-Ab-3 (GenBank: NC_047883) and ABp57 (GenBank: OR578534). The circular gene map of AB_SZL2 is shown in Figure 2. Figure 4 As shown, the transmission electron microscope image of AB_SZL2 is as follows Figure 5 As shown, it can be seen that it belongs to a short-tailed phage.

[0088] The genome length of AB_SZL3 is 44398 bp. Sequence analysis showed that it belongs to Obolenskvirus AB_SZL3 has the highest coverage (91%) and similarity (98%) at the nucleotide level with the bacteriophage AbP2 (GenBank: NC_041998). The circular gene map of AB_SZL3 is shown in Figure 1. Figure 4 The transmission electron microscope image of AB_SZL3 is shown in Figure 2. Figure 6 As shown, it can be seen that it belongs to the myotail phage.

[0089] Furthermore, analysis of the entire genomes of both phages revealed a range of genes encoding common phage-associated features, including DNA polymerase, DNA helicase, and tail and head structural proteins. Both phages also possess genes encoding host lytic enzymes. In silico analysis of the phage genomes revealed no potential virulence, antibiotic resistance, or integrase sequences.

[0090] Example 3 Application of phage composition

[0091] Case 1:

[0092] In June 2022, a 55-year-old man was admitted to the hospital with worsening aspiration pneumonia. The patient was in a vegetative state due to a hemorrhagic stroke, and sputum bacterial culture revealed a polymicrobial flora, including Pseudomonas aeruginosa, Candida tropicalis, and Stenotrophomonas maltophilia. Despite intravenous antibiotic therapy, including amikacin, rifampin, meropenem, piperacillin / tazobactam, levofloxacin, imipenem, isepamicin, and fluconazole, the lung infection persisted. By July 2022, sputum cultures revealed nosocomial infection with Acinetobacter baumannii. The antibiogram of the isolated A. baumannii strain demonstrated extensive drug resistance, with intermediate susceptibility to polymyxin B, minocycline, and tigecycline. Despite intravenous antibiotic therapy containing polymyxin B, isepamicin, and imipenem, the lung infection remained difficult to eradicate. Long-term antibiotic therapy failed to resolve the lung infection, so the clinicians decided to try phage therapy. After approval from the local hospital ethics committee and family consent for this experimental treatment, phage therapy was initiated, specifically 3 × 10 AB_SZL2 and AB_SZL3, each. 9 PFU / dose, the solvent is normal saline, and the dose is inhaled twice a day. The timeline of strains isolated from patients is as follows Figure 7 As shown in Figure A (where D1 refers to the day when phage therapy started and NAB01B is the original strain isolated before the start of treatment), the susceptibilities of the isolated clinical strains to phages AB_SZL2 and AB_SZL3 are shown in Figure 4A (where D1 refers to the day when phage therapy started and NAB01B is the original strain isolated before the start of treatment). Figure 7As shown in Figure B (where the plaque formation rate refers to the ratio of the phage titer against the isolated clinical strain to the titer against the original isolate, NAB01B). Through a combination of antibiotics (cefoperazone and sulbactam, 2 g / day, intravenously) and three 38-day courses of phage therapy, the patient's pulmonary infection with drug-resistant bacteria was successfully cleared. The patient's clinical manifestations and microbiological test results gradually improved, and the infection was ultimately completely resolved.

[0093] Case 2:

[0094] An 89-year-old male patient with a history of diabetes was admitted to the hospital with altered consciousness following a fall. Since admission, repeated sputum cultures revealed the presence of multidrug-resistant Klebsiella pneumoniae, multidrug-resistant Pseudomonas aeruginosa, and multidrug-resistant Acinetobacter baumannii, leading to recurrent fever, pneumonia, and urinary tract infections. Various antibiotics, including piperacillin / tazobactam, cefoperazone / sulbactam, cefotaxime, and oxacillin, were used without efficacy. Tigecycline was attempted but resulted in liver damage, necessitating discontinuation. Although combined therapy with meropenem and linezolid alleviated clinical symptoms to some extent, the infection recurred after discontinuation of treatment and weaning from mechanical ventilation, requiring reintubation and mechanical ventilation. Therefore, the decision was made to initiate phage therapy. With informed consent from the patient and approval from the hospital ethics committee, the patient received phage therapy targeting Acinetobacter baumannii and Pseudomonas aeruginosa (3 × 10 each of AB_SZL2 and AB_SZL3). 9 PFU / dose, with normal saline as the solvent, twice daily via nebulized inhalation for 7 days) combined with antibiotics (meropenem 1.5g / day, intravenous push). Nebulized treatment was continued for seven consecutive days, accompanied by intravenous meropenem. The patient tolerated the treatment well throughout, experiencing no significant adverse reactions. Acinetobacter baumannii was effectively eliminated from the lungs, and the bacterial load of Pseudomonas aeruginosa was reduced. Simultaneously, the patient's clinical symptoms improved, and chest imaging showed a decrease in both lung infection and pleural effusion compared to the previous period.

[0095] Case 3:

[0096] An 83-year-old male patient with a history of coronary artery disease, diabetes, and kidney disease was admitted to the hospital after suddenly losing consciousness. During his hospitalization, he developed multiple lung infections, with pathogens including multidrug-resistant Klebsiella pneumoniae, multidrug-resistant Pseudomonas aeruginosa, Candida albicans, and multidrug-resistant Acinetobacter baumannii. The patient received multiple antibiotics, including cefotaxime, cefoperazone / sulbactam, etanercept, meropenem, linezolid, ciprofloxacin, amikacin, isopamicin, imipenem, ceftazidime, polymyxin B, piperacillin / tazobactam, and fluconazole. However, the lung infections failed to resolve, and the physicians decided to try phage therapy. After the patient's informed consent and approval from the hospital ethics committee, the patient received 9 days of antibiotic treatment (ciprofloxacin 0.2 g / day, intravenous push) and concurrently received phage therapy against Pseudomonas aeruginosa and Acinetobacter baumannii (specifically, 3 × 10 AB_SZL2 and 3 AB_SZL3, each). 9 (PFU / dose, with saline as the solvent, twice daily for 21 days). After several days of A. baumannii phage therapy, the patient's sputum cultured no longer contained A. baumannii. One week after A. baumannii phage therapy, P. aeruginosa phage therapy was initiated. Despite continued administration of P. aeruginosa phage, P. aeruginosa remained detectable in sputum cultures. However, the patient's condition gradually improved, becoming afebrile, his ventilator settings were reduced, and his alertness improved upon awakening.

[0097] Case 4:

[0098] A 91-year-old man with a history of severe hypertension, coronary heart disease, chronic heart failure, chronic pulmonary embolism, and type 2 diabetes was admitted to the hospital due to shortness of breath. Chest CT showed bilateral pneumonia and was diagnosed with "severe pneumonia". After admission, the patient was found to be positive for the new coronavirus during screening. Sputum culture detected filamentous rods, broad-spectrum resistant Acinetobacter baumannii, and Candida albicans. The patient received a variety of antibiotics, including piperacillin / tazobactam, minocycline, meropenem, vancomycin, cefoperazone / sulbactam, and colistin. However, none of these treatments completely eliminated lung pathogens, and sputum culture still showed a large number of Acinetobacter baumannii (+++), which was sensitive to polymyxins. Therefore, the doctor decided to try phage therapy. After the patient's informed consent and approval from the hospital ethics committee, the patient received antibiotic treatment (levofloxacin 0.5 g / day, intravenous push) for 13 days and concurrently received phage therapy against Acinetobacter baumannii (AB_SZL2 and AB_SZL3, 3 × 10 each). 9PFU / dose, with normal saline as the solvent, twice daily via nebulized inhalation for 14 days). After initiating phage therapy, the patient remained afebrile and hemodynamically stable. Inflammatory markers such as white blood cell count, C-reactive protein, interleukin-6, and procalcitonin rapidly decreased to normal ranges starting on the third day. Sputum cultures were negative starting on the third day and remained negative for two consecutive days. Although a small number of Acinetobacter baumannii (positive) were recovered on the sixth day, they were quickly cleared, and subsequent cultures were negative. On the tenth day of phage therapy, the patient's family requested transfer to a general ward for care.

[0099] In this example, the phage composition was applied to 4 patients with KL2-type MDRAB lung infection, and good therapeutic effects were achieved.

[0100] Example 4

[0101] Subsequent analysis of bacteria isolated from patient 1 in Example 3 (including NAB01B, NAB02B, NAB03B, NAB04B, NAB05B, NAB06B, and NAB07B) revealed that phage AB_SZL2 and AB_SZL3 resistant strains were induced in vitro. Whole genome sequencing (combined with second- and third-generation sequencing) and functional assays of the resistant strains in vitro and in vivo revealed that the resistant strains all harbored mutations in genes involved in the synthesis of extracellular lipopolysaccharide and capsule. Figure 8 ), Figure 8 middle, gtrOC3 Gene encoding glycosyltransferase involved in the synthesis of extracellular lipopolysaccharide, wzy The gene encodes a repeat unit polymerase involved in the synthesis of the extracellular capsule.

[0102] Sensitivity change test:

[0103] The MIC method was used to test the antibiotic sensitivity of Acinetobacter baumannii, which was completed by the hospital laboratory. The results were as follows: Figure 9 As shown in A. Figure 9 In Figure A, TZP denotes piperacillin / tazobactam; CAZ denotes ceftazidime; SCF denotes sulbactam and cefoperazone; IPM denotes imipenem; MEM denotes meropenem; TOB denotes tobramycin; CIP denotes ciprofloxacin; LEV denotes levofloxacin; MIN denotes minocycline; PB denotes polymyxin B; and SXT denotes trimethoprim-sulfamethoxazole.

[0104] Growth curve determination:

[0105] The logarithmic phase bacterial solution was kept in a shaking plate at 37℃, and the OD600 was measured every 10 minutes to obtain the growth curve. Figure 9 As shown in B.

[0106] Cell wall resistance assessment:

[0107] 1×10 7 The CFU bacterial solution was placed in a 0.2% sodium dodecyl sulfate (SDS) solution and incubated at 37°C for two hours. The bacterial concentration before and after incubation was measured and the survival rate was calculated. Figure 9 As shown in C.

[0108] Biofilm formation ability assay:

[0109] The overnight bacterial suspension was added to brain heart infusion broth (BHI) medium at a volume ratio of 1:100, and cultured at 37°C for 48 hours. The amount of biofilm was measured according to the instructions of crystal violet stain (Biyuntian). Figure 9 As shown in D.

[0110] Test of strain toxicity changes on Hela cells:

[0111] 1×10 4 After 24 hours of seeding HeLa cells, 2 × 10 4 The CFU bacterial solutions were incubated for 12 hours, and the LDH concentration of each group was measured according to the instructions of the lactate dehydrogenase (LDH) measurement kit (boxbio). The results are as follows Figure 9 As shown in E.

[0112] Test of the toxicity of strains to A549 cells:

[0113] 1×10 4 After 24 hours of seeding A549 cells, 2 × 10 4 After the CFU of each bacterial solution was incubated for 12 hours, the LDH concentration of each group was measured according to the instructions of the LDH measurement kit (boxbio). Figure 9 As shown in F.

[0114] Bacterial capsule scanning electron microscopy test:

[0115] NAB01B and NAB01B-R3 were fixed with 2.5% glutaraldehyde and resuspended in PBS. The fixed samples were sent to Tianjin Jingshi Testing Technology Co., Ltd. to photograph the surface structure of the strain using a scanning electron microscope. The results are as follows Figure 9 As shown in G.

[0116] Figure 9 In C, D, E and F, ns indicates no significant difference; * indicates P <0.05, ** indicates P <0.01, *** indicates P <0.001, **** indicates P <0.0001.

[0117] The above results show that these strains as a whole simultaneously exhibit the characteristics of decreased virulence, reduced biofilm formation ability, reduced cell wall integrity, and increased antibiotic sensitivity. This indicates that phage-resistant strains may be accompanied by antibiotic resensitization, weakened growth ability, weakened cell wall function, reduced biofilm formation ability, reduced cell virulence, and disappearance of capsule structure.

[0118] Example 5 Rapid identification of Acinetobacter baumannii KL2

[0119] Currently, there is a lack of rapid and accurate detection methods for KL2 type Acinetobacter baumannii, which limits the ability to quickly identify KL2 type MDRAB in the early stages of infection. This may lead to delayed application of phage therapy, thereby missing the critical period of treatment. Based on this, this example uses the Acinetobacter baumannii K locus database to analyze the capsular polysaccharide synthesis gene cluster and uses Kaptive software (version 2.0.4) for KL type identification. By comparing the gene clusters of different KLs in the Kaptive database, it was found that gtr3 and gtr4 The gene is specifically located in KL2 and KL81. Compared with KL2 and KL81, only pgt1 This gene, which indicates that gtr3 and pgt1 The gene has the potential to be used to identify KL2 (see Table 1). Furthermore, by designing primer pairs (as shown in Table 2), PCR (polymerase chain reaction) method was used to verify 149 clinical MDRAB isolates from multiple hospitals.

[0120] Among them, the reaction procedure of the PCR method is:

[0121] Initial denaturation: 95°C for 3 minutes;

[0122] Amplification: 30 cycles, one cycle of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 15 seconds;

[0123] Exhaustive extension: 72°C for 5 minutes.

[0124] Reaction system: double-distilled water 20.0 µL; 2× PCR reaction premix (Novozyme) 25.0 µL; primer gtr3_F (10 µM) 1.0 µL; primer gtr3_R (10 µM) 1.0 µL; primer pgt1_F (10 µM) 1.0 µL; primer pgt1_R (10 µM) 1.0 µL; bacterial culture 1.0 µL.

[0125] The results suggest that combined testing gtr3 and pgt1 Genes can accurately identify KL2-type MDRAB (such as Figure 10 and Table 3).

[0126] Table 1. Analysis of the capsular genotypes of Acinetobacter baumannii

[0127]

[0128] Table 2. Primer pairs

[0129]

[0130] Table 3. Kaptive software prediction results of clinical Baumanii strains and gtr3、pgt1 Comparison of genetic testing results

[0131]

[0132] Among them, + indicates positive; - indicates negative; ND indicates not detected.

[0133] In summary, the present invention utilizes a method of inducing phage-resistant strains in vitro and then screening for phages to effectively overcome phage resistance. This phage screening strategy is more forward-looking and has practical clinical therapeutic implications compared to existing technologies, significantly improving the efficacy of phage therapy. The phage composition provided by the present invention can efficiently kill KL2-type MDRAB in vitro and has demonstrated excellent efficacy in clinical compassionate use trials. It can be used in the clinical treatment of infections caused by KL2-type MDRAB (not limited to lung infections). The present invention also proposes the use of specific primer pairs for rapid detection of KL2-type MDRAB. Combined with a phage composition specifically targeting KL2-type MDRAB, the clinical application value of phages can be significantly improved. Overall, the phage composition provided by the present invention can accurately target KL2-type Acinetobacter baumannii, significantly improving clinical efficacy (it can also be used to kill KL2-type Acinetobacter baumannii in vitro in the environment). Combined with a method for rapid detection of KL2-type MDRAB, the pathogen can be quickly identified, allowing for timely treatment.

[0134] It should be understood that the application of the present invention is not limited to the above examples. For those skilled in the art, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A phage composition, characterized in that: The phage composition comprises two KL2 type Acinetobacter baumannii phages, wherein one KL2 type Acinetobacter baumannii phage is named Friunavirus AB_SZL2, deposited in China Center for Type Culture Collection, with the deposit number CCTCC NO: M 20241522; another KL2-type Acinetobacter baumannii phage is named Obolenskvirus AB_SZL3 was deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M20241523.

2. A drug, characterized in that The active ingredient of the medicine comprises the phage composition according to claim 1.

3. The drug according to claim 2, characterized in that The drug further includes a pharmaceutically acceptable carrier.

4. The drug according to claim 3, characterized in that The pharmaceutically acceptable carrier includes at least one of an excipient, a glidant, a diluent, a preservative, a colorant, a flavoring agent, a wetting agent, a suspending agent, a stabilizer, an isotonic agent, and an emulsifier.

5. The drug according to claim 2, characterized in that The drugs also include antibiotics; And / or, the dosage form of the drug is selected from one of solution, aerosol, pill, tablet, capsule, powder, lozenge, and paste.

6. Use of the phage composition according to claim 1 in treating KL2-type Acinetobacter baumannii phage in a biosphere, wherein the use is for non-disease treatment purposes.

7. The application according to claim 6, wherein the method of the application comprises the steps of: Sampling from the biosphere to obtain samples to be tested; Detecting the presence of a preset amount of Acinetobacter baumannii KL2 in the sample by PCR; If a predetermined amount of KL2 Acinetobacter baumannii is present, the bacteriophage composition of claim 1 is applied to the biosphere to eliminate the KL2 Acinetobacter baumannii.

8. The use according to claim 7, wherein the primer pair used in the PCR detection comprises a first primer pair and a second primer pair; The first primer pair is: Forward: TTGCTATAGTCCCAACGTTTATATTCCCATC; Reverse: CCTGTCCCTACATATTCCATATATATTGTAGAGTC; The second primer pair is: Forward: TGATTGCTAAAAAAGATCTTGGGAAAGTGG; Reverse: ACAAAGGCAACCCTGCTAGC.

Images