Method for improving stability of luciferase, mutant high-stability luciferase HS-Lu, gene and application of mutant high-stability luciferase HS-Lu

Abstract

The invention relates to the field of gene engineering, in particular to a method for improving the stability of luciferase, mutated high-stability luciferase HS-Lu, a gene and application of the mutant high-stability luciferase HS-Lu. Wild-type luciferase Ppy-Luc is extremely poor in stability and relatively low in expression quantity in recombinant pichia pastoris engineering bacteria, 115 amino acids at the C terminal of Ppy-Luc are cut off, and amino acids at the 296th site and the 326th site are mutated from Ala to Cly. The stability and expression quantity of the high-stability luciferase HS-Luc are greatly improved, and the high-stability luciferase HS-Luc is an excellent high-stability luciferase and can meet the requirements of various fields. After the high-stability luciferase HS-Luc is efficiently expressed through the pichia pastoris X33, a relatively high fermentation level can be achieved, the production cost can be greatly reduced, and the high-stability luciferase HS-Luc has relatively great application potential in various fields.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a method for improving the stability of luciferase, a mutant high-stability luciferase HS-Lu, a gene and an application thereof. Background Art

[0002] Luciferase is a general term for enzymes that can produce biological fluorescence in nature, and the luciferase from fireflies is the most representative. 2+ In the presence of ATP, it can catalyze the oxidative decarboxylation of D-luciferin into oxyluciferin and emit green to orange-yellow fluorescence.

[0003] The reaction principle is as follows:

[0004]

[0005] The most widely studied and applied one so far is the Photinus Pyralis from the east coast of the United States, the North American firefly luciferase, which has a molecular weight of about 62kb and is composed of 551 amino acid residues. The peptide chain contains a large number of hydrophobic amino acids.

[0006] Luciferase has the advantages of sensitive response, accurate results, simple operation, wide application range, and no toxic side effects. It is very suitable for application in various fields such as life science research, medicine, criminal investigation, pharmacology, and detection. For example, in life science research, luciferase can be used for research on reporter gene detection systems, RNA interference, protein-protein interactions, in vivo immune performance, and pathogenic genes.

[0007] In 1967, McElroy first applied firefly luciferase to determine ATP content and found that the luminescence intensity of the reaction was positively correlated with the concentration of ATP within a specific range. This detection method is now used in microbial detection. ATP fluorescence detection has a wide range of uses and can be applied to food safety, environmental sanitation, customs entry and exit quarantine detection and other fields.

[0008] Although luciferase has a wide range of uses, the currently developed luciferases have poor stability, are easily inactivated, and have low expression levels. Therefore, there is an urgent need to develop a luciferase with good stability and high expression levels.

[0009] The present invention conducts bioinformatics analysis on the wild-type luciferase Ppy-Luc from the North American firefly (Photinus pyralis), then optimizes and transforms it to obtain a suitable luciferase, and constructs a recombinant Pichia pastoris engineering strain to enable the highly stable luciferase to be efficiently expressed. Summary of the invention

[0010] The purpose of the present invention is to provide a high-stability luciferase HS-Luc obtained after optimization and mutation transformation.

[0011] Another object of the present invention is to provide the gene A296C / A326C-Luc encoding the above-mentioned high-stability luciferase HS-Luc.

[0012] Another object of the present invention is to provide a recombinant vector comprising the above-mentioned high-stability luciferase gene sequence.

[0013] Another object of the present invention is to provide a recombinant strain comprising the gene A296C / A326C-Luc encoding the above-mentioned high-stability luciferase HS-Luc.

[0014] Another object of the present invention is to provide a method for preparing the above-mentioned high-stability luciferase HS-Luc.

[0015] Another object of the present invention is to provide the application of the above-mentioned high-stability luciferase HS-Luc.

[0016] The invention provides a high-stability luciferase HS-Luc, which is obtained by transforming and mutating a wild-type luciferase Ppy-Luc produced by the North American firefly Photinus pyralis.

[0017] The wild-type luciferase Ppy-Luc encoding gene sequence is shown in SEQ ID No: 1:

[0018] 1atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatcctct agaggatgga

[0019] 61accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt

[0020] 121gcttttacag atgcacatat cgaggtgaac atcacgtacg cggaatactt cgaaatgtcc

[0021] 181gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta

[0022] 241tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0023] <h2 style=";text-align:left;direction:ltr"> 301gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgaacatt<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0024] <h2 style=";text-align:left;direction:ltr"> 361tcgcagccta ccgtagtgtt tgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0025] <h2 style=";text-align:left;direction:ltr"> 421aaaaaattac caataatcca gaaaattatt atcatggatt ctaaaacggga ttaccaggga<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0026] <h2 style=";text-align:left;direction:ltr"> 481tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0027] <h2 style=";text-align:left;direction:ltr"> 541tttgtaccag agtcctttga tcgtgacaaa acaattgcac tgataatgaa ttcctctgga<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0028] <h2 style=";text-align:left;direction:ltr"> 601tctactgggt tacctaaggg tgtggccctt ccgcatagaa ctgcctgcgt cagattctcg<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0029] <h2 style=";text-align:left;direction:ltr"> 661catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0030] <h2 style=";text-align:left;direction:ltr"> 721gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0031] <h2 style=";text-align:left;direction:ltr"> 781cgagtcgtct taatgtatag atttgaagaa gagctgtttt tacgatccct tcaggattac<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0032] <h2 style=";text-align:left;direction:ltr"> 841aaaattcaaa gtgcgttgct agtaccaacc ctattttcat tcttcgccaa aagcactctg<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0033] 901attgacaaat acgatttatc taatttacac gaaattgctt ctggggggcgc acctctttcg

[0034] 961aaagaagtcg gggaagcggt tgcaaaacgc ttccatcttc cagggatacg acaaggatat

[0035] 1021gggctcactg agctcatc agctattctg attackcccg agggggatga taaaccggggc

[0036] 1081gcggtcggta aagttgttcc attttttga gcgaaggttg tggatctgga taccgggaa

[0037] 1141acgctgggcg ttaatcagag aggcgaatta tgtgtcagag gacctatgat tatgtccggt

[0038] 1201tatgtaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct

[0039] 1261ggagacatag cttactggga cgaagacgaa cacttcttca tagttgaccg cttgaagtct

[0040] 1321ttattaat acaaaggata tcaggtggcc cccgctgaat tggaatcgat attgttacaa

[0041] 1381caccccaaca tcttcgacgc gggcgtggca ggtcttcccg acgatgacgc cggtgaactt

[0042] 1441cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat

[0043] 1501tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac

[0044] 1561gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagagagatcctcata1621aaggccaaga agggcggaaa gtccaaattg taa。

[0045] The amino acid sequence of Ppy-Luc is shown in SEQ ID No: 2:

[0046] 1.MEDAKNIKKG PAPFYPLEDG TAGEQLHKAM KRYALVPGTI AFTDAHIEVN51.ITYAEYFEMS VRLAEAMKRY GLNTNHRIVV CSENSLQFFM PVLGALFIGV 101.AVAPANDIYNERELLNSMNI SQPTVVFVSK KGLQKILNVQ KKLPIIQKII 151.IMDSKTDYQG FQSMYTFVTSHLPPGFNEYD FVPESFDRDK TIALIMNSSG 201.STGLPKGVAL PHRTACVRFS HARDPIFGNQIIPDTAILSV VPFHHGFGMF 251.TTLGYLICGF RVVLMYRFEE ELFLRSLQDY KIQSALLVPTLFSFF A KSTL 301.IDKYDLSNLH EIASGGAPLS KEVGEAVAKR FHLPGIRQGY GLTETTSAIL351.ITPEGDDKPG AVGKVVPFFE AKVVDLDTGK TLGVNQRGEL CVRGPMIMSG 401.YVNNPEATNALIDKDGWLHS GDIAYWDEDE HFFIVDRLKS LIKYKGYQVA 451.PAELESILLQ HPNIFDAGVAGLPDDDAGEL PAAVVVLEHG KTMTEKEIVD 501.YVASQVTTAK KLRGGVVFVD EVPKGLTGKLDARKIREILI KAKKGGKSKL。

[0047] The wild-type luciferase Ppy-Luc has extremely poor stability and low expression in the recombinant Pichia pastoris engineering bacteria. The present invention removes 115 amino acids at the C-terminus of Ppy-Luc and mutates the 296th and 326th amino acids from Ala to Cly.

[0048] The optimized, modified and mutated luciferase HS-Luc gene sequence A296C / A326C-Luc is shown in SEQ ID No: 3:

[0049] 1atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatcctct agaggatgga

[0050] 61accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt

[0051] 121gcttttacag atgcacatat cgaggtgaac atcacgtacg cggaatactt cgaaatgtcc

[0052] 181gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta

[0053] 241tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt

[0054] 301gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgaacatt

[0055] 361tcgcagccta ccgtagtgtt tgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa

[0056] 421aaaaaattac caataatcca gaaaattatt atcatggatt ctaaaacgga ttaccaggga

[0057] 481tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat

[0058] 541tttgtaccag agtcctttga tcgtgacaaa acaattgcac tgataatgaa ttcctctgga

[0059] 601tctactgggt tacctaaggg tgtggccctt ccgcatagaa ctgcctgcgt cagattctcg

[0060] 661catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt

[0061] 721gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt

[0062] 781cgagtcgtct taatgtatag atttgaagaa gagctgtttt tacgatccct tcaggattac

[0063] 841aaaattcaaa gtgcgttgct agtaccaacc ctattttcat tcttctgcaa aagcactctg

[0064] 901attgacaaat acgatttatc taatttacac gaaattgctt ctgggggcgc acctctttcg

[0065] 961aaagaagtcg gggaatgcgt tgcaaaacgc ttccatcttc cagggatacgacaaggatat1021gggctcactg agactacatc agctattctg attacacccg agggggatgataaaccgggc1081gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctggataccgggaaa1141acgctgggcg ttaatcagag aggcgaatta tgtgtcagag gacctatgattatgtccggt

[0066] 1201tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct

[0067] 1261ggagacatag cttactggga cgaagacgaa cacttcttca tagtttaa

[0068] The amino acid sequence of the optimized, modified and mutated luciferase HS-Luc is shown in SEQ ID No: 4:

[0069] 1.MEDAKNIKKG PAPFYPLEDG TAGEQLHKAM KRYALVPGTI AFTDAHIEVN

[0070] 51.ITYAEYFEMS VRLAEAMKRY GLNTNHRIVV CSENSLQFFM PVLGALFIGV

[0071] 101.AVAPANDIYN ERELLNSMNI SQPTVVFVSK KGLQKILNVQ KKLPIIQKII

[0072] 151.IMDSKTDYQG FQSMYTFVTS HLPPGFNEYD FVPESFDRDK TIALIMNSSG

[0073] 201.STGLPKGVAL PHRTACVRFS HARDPIFGNQ IIPDTAILSV VPFHHGFGMF

[0074] 251.TTLGYLICGF RVVLMYRFEE ELFLRSLQDY KIQSALLVPT LFSFF C KSTL

[0075] 301.IDKYDLSNLH EIASGGAPLS KEVGE C VAKR FHLPGIRQGY GLTETTSAIL

[0076] 351.ITPEGDDKPG AVGKVVPFFE AKVVDLDTGK TLGVNQRGEL CVRGPMIMSG

[0077] 401.YVNNPEATNA LIDKDGWLHS GDIAYWDEDE HFFIV.

[0078] The modified and mutated luciferase HS-Luc is composed of 436 amino acid residues, with a molecular weight of 48419 Da and an isoelectric point of 6.22.

[0079] The present invention provides a recombinant plasmid, preferably the plasmid is pPICZαA, the recombinant plasmid comprises a vector and a gene A296C / A326C-Luc obtained after transformation and mutation, wherein the vector includes but is not limited to the pPICZαA plasmid.

[0080] The present invention also provides a recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium contains the recombinant plasmid, and the host bacterium is preferably Pichia pastoris X33.

[0081] Compared with the existing luciferase Ppy-Luc derived from fireflies, the high-stability luciferase HS-Luc of the present invention has greatly improved stability and expression, and is an excellent high-stability luciferase that can meet the needs of various fields. After the high-stability luciferase HS-Luc of the present invention is efficiently expressed by Pichia pastoris X33, it can achieve a higher fermentation level, which can greatly reduce the production cost, and show greater application potential in various fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 shows conformational analysis of wild-type firefly luciferase Ppy-Luc;

[0083] Figure 2 Shows the analysis of firefly luciferase LucC mutation sites;

[0084] Figure 3 Shows the fermentation performance comparison between luciferase Ppy-Luc and HS-Luc in a 5L fermenter;

[0085] Figure 4 Shows the optimal reaction pH for luciferase Ppy-Luc and HS-Luc;

[0086] Figure 5 The pH stability of luciferase Ppy-Luc and HS-Luc was shown;

[0087] Figure 6 Shows the optimal reaction temperature of luciferase Ppy-Luc and HS-Luc;

[0088] Figure 7 Showing the thermostability of luciferase Ppy-Luc and HS-Luc. DETAILED DESCRIPTION

[0089] The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook, or according to the kits and product instructions. The reagents and biological materials, unless otherwise specified, can be obtained from commercial sources.

[0090] Experimental materials and reagents:

[0091] 1. Strains and vectors: Pichia pastoris X33, vector pPICZαA;

[0092] 2. Enzymes and kits: DNA Marker, Zeocin, plasmid DNA extraction kit, gel recovery kit, PCR purification kit, Taq DNA polymerase, restriction endonucleases EcoR I and Not I, T4 DNA ligase, DpnI endonuclease, Sac I;

[0093] 3. Culture medium:

[0094] YPD liquid medium: 1% yeast powder, 2% peptone, 2% glucose;

[0095] YPD solid medium: 1% yeast powder, 2% peptone, 2% glucose, 2% agar;

[0096] BSM fermentation medium (Basal Salts Medium): 26.7 mL of 85% phosphoric acid, 0.9 g of calcium sulfate dihydrate, 18.2 g of potassium sulfate, 14.9 g of magnesium sulfate heptahydrate, 4.13 g of potassium hydroxide, 4.4 mL of trace elements (PTM1), add water to make up to 1 L;

[0097] Trace elements PTM1: 65 g ferrous sulfate heptahydrate, 6 g copper sulfate pentahydrate, 0.08 g sodium iodide, 3.0 g manganese sulfate monohydrate, 0.5 g cobalt chloride, 20 g zinc chloride, 0.02 g boric acid, 0.2 g sodium molybdate dihydrate, 0.2 g biotin, 5 mL 98% concentrated sulfuric acid, dilute to 1 L with purified water, wherein biotin is sterilized at high temperature in PTM1 and added after cooling to room temperature;

[0098] 4. Detection substrate: D-LH2, ATP;

[0099] 5. Primer:

[0100] The primer sequences used below are shown in Table 1.

[0101] Table 1 Primer sequences

[0102]

[0104] Example 1: Amplification of 296C / A326CLuc gene and construction of expression vector

[0105] The specific process of mutating firefly luciferase is as follows: the firefly luciferase described in the present invention is expressed by constructing pPICZαA as a vector. In order to quickly and accurately construct a recombinant vector, primers are designed and the Escherichia coli Top10 strain containing the vector A296C / A326CLucC-pPICZαA is retained.

[0106] The specific implementation is as follows: Figure 1 By analyzing the conformation of wild-type firefly luciferase Ppy-Luc and other bioinformatics analyses, the C-terminal 115 amino acids of Ppy-Luc were removed. Figure 1 In the a part of the middle (A) figure, the LucC formed is as follows Figure 2 As shown in Figure a. Figure 2 As shown in Figure b, the 296th and 326th bases of LucC are mutated from Ala (alanine) to Cys (cysteine), as shown in Figure 2 As shown in Figure c, a new disulfide bond is formed. The position of the disulfide bond is as follows Figure 2 As shown in Figure d, A296C / A326CLucC was obtained. The amino acid sequence of A296C / A326CLucC finally obtained is shown in SEQ ID NO: 3, and the nucleic acid sequence is shown in SEQ ID NO: 4.

[0107] Primers LucC-F and LucC-R were designed based on the nucleic acid sequence of A296C / A326CLucC. The target fragment was amplified using pPICZαA (PpyLuc-pPICZαA) inserted with SEQ ID NO: 2 as a template and LucC-F and LucC-R as primers. The amplified product was subjected to agarose gel electrophoresis and recovered using a gel recovery kit. The recombinant plasmid LucC-pPICZαA was obtained.

[0108] According to the amino acid sequence of A296C / A326CLucC, primers A296C-F, A296C-R, A326C-F, and A326C-R were designed for the 296th and 326th amino acid mutation sites, respectively. The recombinant plasmid LucC-pPICZαA was used as a template, and the two mutation sites were reacted step by step.

[0109] After the PCR reaction was completed, the product was placed in an ice bath for 5 minutes, placed at room temperature, and 1 μL of DpnI enzyme was added to remove the non-mutated gene fragment. The product was subjected to agarose gel electrophoresis and gel recovery to obtain the recombinant plasmid A296C / A326CLucC-pPICZαA.

[0110] Example 2: Transformation of Pichia pastoris X33 with recombinant plasmid A296C / A326CLucC-pPICZαA and screening of engineered bacteria

[0111] Linearization of recombinant plasmid A296C / A326CLucC-pPICZαA: Since the luciferase target gene needs to be homologously recombined and integrated into the Pichia chromosome for stable genetic expression, the recombinant plasmid needs to be linearized to increase the success rate of recombination. A296C / A326CLucC-pPICZαA was linearized using Sac I enzyme. Pichia X33 competent cells were electroporated and coated with YPD plates containing different concentrations of Zeocin, cultured at 30°C for 2 days, and single colonies were randomly picked from the YPD plates containing different concentrations of Zeocin, and shake flask fermentation was carried out using YPD liquid medium.

[0112] Culture conditions: 50 mL of liquid in a 250 mL triangular bottle, temperature 30 ° C, rotation speed 220 rpm, after culturing for 24 hours, methanol was added every 12 hours for induction, each time the amount of methanol added was 0.5%, a total of 4 times, and the induction time was 48 hours. After the end of methanol induction, the fermentation broth was centrifuged, and the supernatant was taken for enzyme activity detection. The strain with the highest enzyme activity was selected and named A296C / A326CLucC-X33.

[0113] Example 3: High-efficiency expression of luciferase recombinant strains

[0114] The screened recombinant strain A296C / A326CLucC-X33 was subjected to high-density fermentation culture under the same conditions as the originally constructed and screened Pichia pastoris recombinant strain PpyLuc-pPICZαA-X33 expressing wild-type firefly enzyme.

[0115] Prepare 2L of basic salt culture medium, put it into a 5L automatic liquid fermenter, sterilize at 121℃ for 30min, and cool to 30℃. Adjust the pH value of the fermentation liquid to 4.6 with ammonia or phosphoric acid, control the dissolved oxygen to be greater than 20%, the fermentation temperature to 30℃, and the stirring speed to 500rpm.

[0116] The entire liquid fermentation process is divided into 3 stages:

[0117] The first stage is the bacterial culture stage, in which the recombinant engineered bacteria A296C / A326CLucC-X33 and the wild-type luciferase-expressing recombinant engineered bacteria PpyLuc-pPICZαA-X33 are inoculated into the fermenter, with an inoculation amount of 10% each. Then, 2L of sterilized 25% glucose is added and cultured for about 24 hours, until the glucose is replenished.

[0118] The second stage is the starvation stage. After glucose is replenished, no carbon source is added. When the dissolved oxygen rises to more than 80%, this stage ends, which lasts for about 30-60 minutes.

[0119] The third stage is the induction expression stage, in which the induction medium is fed and the dissolved oxygen is maintained above 20%. The entire fermentation culture time is 156 hours.

[0120] Samples were taken at different time points during the fermentation process to measure the enzyme activity. After the fermentation, the enzyme activity of the luciferase HS-Luc produced by A296C / A326CLucC-X33 was compared with the wild-type firefly luciferase Ppy-Luc. Under the same conditions, the enzyme activity at the end of the fermentation increased by about 30 times. The fermentation performance comparison results are as follows: Figure 3 shown.

[0121] Example 4. Comparison of the physicochemical properties of HS-Luc and wild-type luciferase Ppy-Luc

[0122] The fermentation broth was centrifuged at 10000×g for 5 min to remove the bacteria, and the supernatant was ultrafiltered and then washed with 0.1 mol·L -1 The enzyme solution was dialyzed against acetic acid-sodium acetate buffer (pH 5.5) at 4°C overnight. The dialyzed enzyme solution was subjected to column chromatography using 0.1 mol·L -1The luciferase components in the eluate were detected and collected, and the eluted luciferase was subjected to SDS-PAGE electrophoresis to verify the purity. After reaching the purity requirement, the collected eluted components were lyophilized and stored for later use.

[0123] The reaction solution composed of the solutions shown in Table 2 below was added to the cuvette in order and immediately placed in a fluorescence detector (Lu-mini from Vitl). The fluorescence intensity was measured in the integrate time 10s mode. The enzyme activity was measured under the following conditions: room temperature 25°C, pH 7.8, reaction time 10s, and the fluorescence intensity reading displayed on the screen was the relative enzyme activity measured in RLUs (Relative Light Units).

[0124] Table 2

[0125]

[0126]

[0127] The buffer system was as follows: 0.2 M Tris-HCl, 20 mM MgSO4, 4 mM EDTA, 20% glycerol, pH 7.8.

[0128] 1. Determination of optimal reaction pH and pH stability

[0129] (1) Determination of the optimal reaction pH of HS-Luc and Ppy-Luc

[0130] In the same reaction system, the same amount of HS-Luc and Ppy-Luc were taken at pH 5.0, 5.4, 5.8, 6.2, 6.6, 7.0, 7.4, 7.8, 8.2, 8.6 and 9.0 for activity detection.

[0131] Test results see Figure 4 The results showed that the optimal reaction pH for HS-Luc and Ppy-Luc was 7.8.

[0132] (2) pH stability determination of HS-Luc and Ppy-Luc

[0133] Buffer solutions of different pH values ​​(2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, 8.0, 8.5, 9.0, and 10.0) were prepared, and equal amounts of HS-Luc and Ppy-Luc enzymes were placed in the buffer solutions of different pH values, mixed, and stored at room temperature for 1 h. The untreated enzyme activity was recorded as 100%. After 1 h, the remaining enzyme activity was measured, and the relative enzyme activity was calculated to determine the pH stability of HS-Luc and Ppy-Luc.

[0134] The results of the experiment can be found in Figure 5 HS-Luc remained highly stable in the pH range of 5.0-8.5, and the residual enzyme activity could still reach more than 90% after 1 hour of treatment. After treatment at pH lower than 5.0 or higher than 8.5, the residual enzyme activity of each experimental group decreased to a certain extent, especially after treatment at pH 2.0 or pH 10.0, the residual enzyme activity dropped to 48% and 46% of the original, respectively.

[0135] Correspondingly, the enzyme activity of Ppy-Luc remained relatively stable only at pH 7.0-8.0, but could only reach about 80%. Outside this range, the enzyme activity dropped sharply, especially after treatment at pH 2.0 or pH 10.0, with only 8% and 5% remaining enzyme activity.

[0136] This shows that in terms of pH stability, the modified luciferase HS-Luc is significantly better than the wild-type luciferase Ppy-Luc.

[0137] 2. Optimum reaction temperature and thermal stability determination

[0138] The enzyme activity was measured at 15, 20, 25, 30, 35, 40, 45, 50, 55 and 60°C respectively. The enzyme activity was detected according to the above reaction system, and the relative enzyme activity was calculated by comparing with the highest enzyme activity to determine the optimal reaction temperature.

[0139] The results of the experiment can be found in Figure 6 The optimal reaction temperature of the luciferase HS-Luc produced by A296C / A326CLuc-X33 is 25°C. It can show activity in the temperature range of 15-60°C, and its activity relative to the optimal reaction temperature can reach more than 80% between 15-45°C. When reacting at 60°C, its relative enzyme activity can still reach 38.2% of the optimal reaction temperature.

[0140] The optimal reaction temperature of wild-type luciferase Ppy-Luc is 25°C. It can show activity at temperatures between 15 and 45°C, but almost no activity can be detected at temperatures above 55°C.

[0141] To further explore the thermal stability of the enzyme, the enzyme was heat-treated at different temperatures (40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90°C) for 10 min. The enzyme activity before treatment was 100%. The remaining enzyme activity after heat treatment was measured to determine the thermal stability of the recombinant enzyme.

[0142] The experimental results are shown in Figure 7The luciferase HS-Luc produced by A296C / A326CLuc-X33 showed activity after being treated at different temperatures for 10 minutes. Especially when the treatment temperature was lower than 80°C, the effect of heat treatment on the enzyme was small. However, when the treatment temperature was higher than 85°C, heat treatment had a certain effect on the enzyme activity. After being treated at 85°C and 90°C for 10 minutes, the enzyme activity still remained at 43.6% and 32.8%, respectively.

[0143] Correspondingly, a certain enzyme activity of the wild-type luciferase Ppy-Luc can be detected when the temperature is lower than 55°C, but when the treatment temperature is higher than 55°C, it is completely inactivated after 10 minutes of treatment.

[0144] Therefore, the heat stability of the optimized and modified luciferase HS-Luc is significantly better than that of the wild-type luciferase Ppy-Luc, which is extremely beneficial for the industrial application of the enzyme.

[0145] 3. Determination of the effects of different metal ions and some chemical reagents on luciferase

[0146] (1) Effects of different metal ions on luciferase Ppy-Luc and HS-Luc

[0147] Take 1.0 mL of the purified and appropriately diluted enzyme solution and add metal ions (Ca 2+ Mg 2+ , Fe 2+ , Cu 2+ 、Na + ), the final volume of each system was 5.0 mL, and the final concentration of each metal ion was 10 mmol·L -1 .

[0148] The experimental results are shown in Table 3. The high-stability luciferase HS-Luc performed the same as the wild-type luciferase Ppy-Luc. 2+ Mg 2+ 、Na + Both play a promoting role, Fe 2+ , Cu 2+ It has an inhibitory effect.

[0149] Table 3 Effects of different metal ions on luciferase Ppy-Luc and HS-Luc

[0150]

[0151] (2) Effects of EDTA and DTT on luciferase Ppy-Luc and HS-Luc

[0152] Take 1.0 mL of purified and appropriately diluted enzyme solution and add chemical reagents (EDTA, DTT) respectively. The final volume of each system is 5.0 mL, and the final concentration is 2 mmol·L -1 and 1mmol·L -1 .

[0153] The experimental results are shown in Table 4. EDTA and low concentration DTT promote the high stability luciferase HS-Luc and wild type luciferase Ppy-Luc, while high concentration DTT has a certain inhibitory effect on these two enzymes.

[0154] Table 4 Effects of EDTA and DTT on luciferase Ppy-Luc and HS-Luc

[0155]

[0156] The above embodiments are only used to understand the technical solution of the present application and do not limit the protection scope of the present application.

Claims

1. Mutated high-stability luciferase HS-Lu, It is characterized in that The amino acid sequence of the mutant high-stability luciferase HS-Lu is shown in SEQ ID No:

4.

2. A luciferase gene, It is characterized in that The luciferase gene encodes the mutated high-stability luciferase HS-Lu according to claim 1.

3. The luciferase gene according to claim 2, It is characterized in that The nucleotide sequence of the luciferase gene is shown in SEQ ID No:

3.

4. A method for improving the stability of luciferase, It is characterized in that The method comprises the steps of subjecting the protein with the amino acid sequence shown in SEQ ID No: 2 to the following operations: Cut off the C-terminal 115 amino acids; and The amino acids at positions 296 and 326 were mutated from Ala to Cly.

5. A recombinant expression vector comprising the luciferase gene according to claim 2.

6. A recombinant strain comprising the luciferase gene according to claim 2.

7. Use of the mutated high-stability luciferase HS-Lu according to claim 1.

8. A method for preparing luciferase, It is characterized in that The method comprises the following steps: A. transforming a host strain with the recombinant expression vector according to claim 5 to obtain a recombinant strain; Inducing and culturing the recombinant strain; The luciferase was isolated and purified from the fermentation broth.

9. The method for preparing luciferase according to claim 8, It is characterized in that The host strain is yeast.

10. The method for preparing luciferase according to claim 9, It is characterized in that The host strain is Pichia pastoris.

Images