Beta-galactosidase mutant with improved thermal stability and application thereof

Abstract

The invention discloses a beta-galactosidase mutant with improved thermal stability and application of the beta-galactosidase mutant. The amino acid sequence of wild type beta-galactosidase Bgal1-3 is used as a parent, and the beta-galactosidase mutant with improved thermal stability is obtained by performing single-point mutation and combined mutation on amino acid at a specific site of the amino acid sequence of the wild type beta-galactosidase Bgal1-3. The thermal stability is improved, the lactase activity of part of mutants is also improved, and lactose in milk can be rapidly hydrolyzed under the high-temperature condition. The beta-galactosidase mutant disclosed by the invention can be used for degrading lactose and producing low / no-lactose dairy products, and has a promoting effect on the development of the low / no-lactose dairy product industry.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and enzyme engineering, and more specifically, relates to a β-galactosidase mutant with improved thermal stability and its application. Background Art

[0002] Lactose intolerance is a common physiological problem. After drinking lactose-containing dairy products, patients cannot decompose the lactose, which leads to adverse reactions such as intestinal rumbling, abdominal pain and diarrhea. Using lactase to degrade lactose in dairy products in advance can effectively solve the problem of lactose intolerance.

[0003] β-galactosidase (EC.3.2.1.23), also known as lactase, is an important glycoside hydrolase that can hydrolyze lactose into galactose and glucose and is widely used in the food industry. The lactase currently used in the production of low / lactose-free dairy products is mainly room-temperature lactase, and its optimum temperature is around 37°C, which is very suitable for microbial growth and reproduction, increasing the safety risk of dairy products. If a low-temperature hydrolysis method (i.e., adding lactase under refrigerated conditions (4°C)) is used, although microbial contamination can be reduced, the hydrolysis efficiency of lactase under low temperature conditions is low, which prolongs the production cycle of dairy products, increases energy consumption, and increases costs. If high-temperature hydrolysis is used, although the above problems can be effectively solved, the requirements for the thermal stability of lactase will be higher accordingly. Therefore, a lactase with better thermal stability is needed. In addition, when hydrolyzing lactose in milk, the optimal reaction temperature of lactase is not the higher the better. It is generally believed that 55-65℃ is more suitable. Too high a hydrolysis temperature will cause changes in the flavor and color of milk and cannot be compatible with pasteurization conditions. On the basis of the good thermal stability of lactase, if a lactase with a moderate optimal reaction temperature and high lactose hydrolysis activity can be provided, it will be more conducive to the production of low / lactose-free dairy products.

[0004] Although there are reports on improving the thermal stability of lactase by amino acid mutation, the amino acid sequences of different lactases are different, and there is no universal method to improve their thermal stability. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the existing method for improving the thermal stability of wild-type β-galactosidase Bgal1-3, and to provide a β-galactosidase mutant with improved thermal stability and its application.

[0006] The first object of the present invention is to provide a method for improving the thermal stability of β-galactosidase.

[0007] The second object of the present invention is to provide a β-galactosidase mutant with improved thermal stability.

[0008] The third object of the present invention is to provide a gene encoding the β-galactosidase mutant.

[0009] The fourth object of the present invention is to provide a recombinant vector containing a gene encoding the β-galactosidase mutant.

[0010] The fifth object of the present invention is to provide a recombinant bacterium containing the recombinant vector.

[0011] The sixth object of the present invention is to provide the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in degrading lactose.

[0012] The seventh object of the present invention is to provide the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in the preparation of a preparation for degrading lactose.

[0013] The eighth objective of the present invention is to provide the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in the production of low-lactose or lactose-free dairy products.

[0014] The ninth objective of the present invention is to provide the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in the preparation of a preparation for producing a low-lactose or lactose-free dairy product.

[0015] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0016] β-galactosidase Bgal1-3 has the excellent property of completely hydrolyzing lactose in milk into glucose and galactose, but its thermal stability is poor. The present invention uses wild-type β-galactosidase Bgal1-3 as a parent, and obtains a β-galactosidase mutant with improved thermal stability by performing single-point mutation and combined mutation of amino acids at specific sites. In addition to improved thermal stability, the lactase activity of some mutants is also improved, and lactose in milk can be quickly hydrolyzed under high temperature (55-65°C). The good thermal stability makes the β-galactosidase mutant of the present invention have great application potential in the production of low / lactose-free dairy products. Therefore, the present invention requests protection for the β-galactosidase mutant and its application.

[0017] The present invention provides a method for improving the thermal stability of beta-galactosidase, which comprises: mutating one or more of the amino acids at positions 66, 80, 277, 378, 396, 398, 414, 418, 462, 552, 578, 613, 632, 633, 676 and 689 of the amino acid sequence of beta-galactosidase.

[0018] Specifically, the β-galactosidase of the present invention is β-galactosidase Bgal1-3, whose amino acid sequence is shown in SEQ ID NO.1, and whose gene sequence is shown in SEQ ID NO.2, GenBank: KC521353.

[0019] Specifically, the method for improving the thermal stability of β-galactosidase is:

[0020] Mutate alanine (Ala) at position 66 to valine (Val);

[0021] or mutate the glutamine (Gln) at position 80 to glycine (Gly);

[0022] or replace the serine (Ser) at position 277 with methionine (Met);

[0023] or replace the serine (Ser) at position 277 with valine (Val);

[0024] or replace valine (Val) at position 378 with threonine (Thr);

[0025] or replacing valine (Val) at position 396 with alanine (Ala);

[0026] or replace tyrosine (Tyr) at position 398 with cysteine ​​(Cys);

[0027] or replace tyrosine (Tyr) at position 398 with asparagine (Asn);

[0028] or replace phenylalanine (Phe) at position 414 with tyrosine (Tyr);

[0029] or replacing asparagine (Asn) at position 418 with serine (Ser);

[0030] or replacing glutamic acid (Glu) at position 462 with glutamine (Gln);

[0031] or replace glutamic acid (Glu) at position 462 with glycine (Gly);

[0032] or replace asparagine (Asn) at position 552 with aspartic acid (Asp);

[0033] or replace lysine (Lys) at position 578 with arginine (Arg);

[0034] or replace the serine (Ser) at position 613 with proline (Pro);

[0035] or replacing aspartic acid (Asp) at position 632 with threonine (Thr);

[0036] or replace phenylalanine (Phe) at position 633 with leucine (Leu);

[0037] or replace the serine (Ser) at position 676 with phenylalanine (Phe);

[0038] or replace arginine (Arg) at position 689 with leucine (Leu);

[0039] Or mutate the 462nd glutamic acid (Glu) to glutamine (Gln), and the 676th serine (Ser) to phenylalanine (Phe);

[0040] Or mutate the 277th serine (Ser) to valine (Val), the 462nd glutamic acid (Glu) to glutamine (Gln), and the 676th serine (Ser) to phenylalanine (Phe);

[0041] Or mutate the 277th serine (Ser) to valine (Val), the 462nd glutamic acid (Glu) to glutamine (Gln), the 676th serine (Ser) to phenylalanine (Phe), and the 689th (Arg) to leucine (Leu);

[0042] Or mutate the 277th serine (Ser) to valine (Val), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu);

[0043] Or mutate the 277th serine (Ser) to valine (Val), the 398th tyrosine (Tyr) to cysteine ​​(Cys), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu);

[0044] Or mutate the 80th glutamine (Gln) to glycine (Gly), the 277th serine (Ser) to valine (Val), the 398th tyrosine (Tyr) to cysteine ​​(Cys), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu);

[0045] Or mutate the 80th glutamine (Gln) to glycine (Gly), the 277th serine (Ser) to valine (Val), the 378th valine (Val) to threonine (Thr), the 398th tyrosine (Tyr) to cysteine ​​(Cys), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu);

[0046] Or mutate the 80th glutamine (Gln) to glycine (Gly), the 277th serine (Ser) to valine (Val), the 378th valine (Val) to threonine (Thr), the 398th tyrosine (Tyr) to cysteine ​​(Cys), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 633rd phenylalanine (Phe) to leucine (Leu), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu);

[0047] Or the 80th glutamine (Gln) is mutated to glycine (Gly), the 277th serine (Ser) is mutated to valine (Val), the 378th valine (Val) is mutated to threonine (Thr), the 398th tyrosine (Tyr) is mutated to cysteine ​​(Cys), the 462nd glutamic acid (Glu) is mutated to glutamine (Gln), the 578th lysine (Lys) is mutated to arginine (Arg), the 632nd aspartic acid (Asp) is mutated to threonine (Thr), the 633rd phenylalanine (Phe) is mutated to leucine (Leu), the 676th serine (Ser) is mutated to phenylalanine (Phe), and the 689th arginine (Arg) is mutated to leucine (Leu).

[0048] The present invention also provides a β-galactosidase mutant with improved thermal stability, and the mutant is obtained by using the above method.

[0049] Although the present invention does not specifically provide the amino acid or gene sequence of each mutant, based on the amino acid and gene sequence of the parent, the amino acid and gene sequence of the corresponding mutant can be obtained by knowing the amino acid after mutation. In addition to mutating the parent, the corresponding mutant can also be obtained by artificial synthesis based on the sequence of the mutant.

[0050] The present invention provides a gene encoding the beta-galactosidase mutant. The gene can be used to obtain the corresponding mutant through recombinant expression.

[0051] Therefore, the present invention claims protection for a recombinant vector containing a gene encoding the β-galactosidase mutant of the present invention.

[0052] Optionally, the recombinant vector is an expression vector.

[0053] The present invention also claims protection for the recombinant bacteria containing the recombinant vector of the present invention.

[0054] Optionally, when constructing the recombinant bacteria, Escherichia coli, yeast, Bacillus or Lactobacillus can be selected as the host bacteria.

[0055] The present invention also claims to protect the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in degrading lactose.

[0056] Specifically, the lactose includes lactose in dairy products.

[0057] The present invention also claims to protect the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in the preparation of a preparation for degrading lactose.

[0058] The present invention also claims to protect the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in the production of low-lactose or lactose-free dairy products.

[0059] The present invention also claims to protect the use of the β-galactosidase mutant, the gene, the recombinant vector or the recombinant bacteria in the preparation of a preparation for producing low-lactose or lactose-free dairy products.

[0060] The present invention has the following beneficial effects:

[0061] The present invention uses wild-type β-galactosidase Bgal1-3 as a parent, and obtains β-galactosidase mutants with improved thermal stability by performing single-point mutation and combined mutation of amino acids at specific sites. In addition to improved thermal stability, the lactase activity of some mutants is also improved, and they can quickly hydrolyze lactose in milk under high temperature conditions, and can be used to degrade lactose and produce low / lactose-free dairy products, which has a promoting effect on the development of the low / lactose-free dairy product industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 is the half-inactivation temperature of β-galactosidase Bgal1-3 (wild type), mutants M9 and M10, and T m The results of the half-inactivation temperature determination of Bgal1-3 (wild type) and mutant M9 are shown in Figure A; the T values ​​of Bgal1-3 (wild type) and mutant M9 are shown in Figure B. m The results of the half-inactivation temperature determination of Bgal1-3 (wild type) and mutant M10 are shown in Figure C; the T values ​​of Bgal1-3 (wild type) and mutant M10 are shown in Figure D. m Value determination results.

[0063] Figure 2 The results of the optimal temperature determination of β-galactosidase Bgal1-3 (wild type) and mutant M9.

[0064] Figure 3 These are the thin layer chromatography (TLC) detection results of the enzymatic hydrolysis products obtained after lactose was hydrolyzed by β-galactosidase Bgal1-3 (wild type), combined mutants M9, M10 and commercial enzyme Maxilact LGi5000. DETAILED DESCRIPTION

[0065] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0066] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0067] Half-life (t 1 / 2 ): “Half-life” is defined as the time when the remaining activity of lactase is 50% of the initial enzyme activity when incubated at a certain temperature.

[0068] Half inactivation temperature (T 50 10 ): The “half-inactivation temperature” is defined as the temperature at which lactase loses 50% of its initial activity within 10 min.

[0069] LB liquid culture medium: 5 g / L yeast powder, 10 g / L tryptone, 10 g / L NaCl; on the basis of LB liquid culture medium, add 20 g / L agar to obtain LB solid culture medium.

[0070] 8×Binding buffer: NaCl 23.376 g, Tris base 1.9676 g, imidazole 0.2723 g, add ultrapure water to make up to 100 mL, pH 7.9.

[0071] 8×Wash buffer: NaCl 23.376 g, Tris base 1.9676 g, imidazole 3.2678 g, add ultrapure water to make up to 100 mL, pH 7.9.

[0072] 4×Elute buffer: NaCl 11.668 g, Tris base 0.96912 g, imidazole 27.232 g, add ultrapure water to make up to 100 mL, pH 7.9.

[0073] 1×Binding buffer, 1×Wash buffer and 1×Wash buffer are all obtained by diluting their mother solutions.

[0074] The detection method involved in the embodiments of the present invention is as follows:

[0075] Drawing of the glucose standard curve: first prepare a 2.5 g / L glucose solution stock solution (0.1 M, pH 7.0) with a phosphate buffer, and dilute the glucose solution stock solution into glucose solutions with concentrations of 0.025%, 0.05%, 0.075%, 0.100%, 0.125%, 0.150%, 0.175%, and 0.200% (w / v), respectively; take 10 μL of the diluted glucose solution and add it to 750 μL of the glucose kit test solution, mix well and incubate at 37°C for 15 min, then take 300 μL to measure its absorbance at a wavelength of 492 nm, and use the glucose concentration C as the horizontal axis and the absorbance value A as the vertical axis to draw the standard curve A=a×C+b.

[0076] Determination of β-galactosidase activity: Mix 50 μL of enzyme with 450 μL of lactose solution (5%, w / v), incubate at 40°C for 15 min, and then inactivate in a 90°C water bath for 10 min; after oscillation and mixing, take out 10 μL of the reaction solution and add it to 750 μL of the glucose oxidation kit reaction solution, and react in a 37°C water bath for 15 min; after the reaction, take 300 μL of the reaction solution and measure the absorbance at a wavelength of 492 nm; perform 3 parallel reactions for each reaction.

[0077] The enzyme activity unit (U) is defined as the amount of enzyme required to decompose lactose to produce 1 μmol of glucose per minute under these reaction conditions;

[0078]

[0079] C: Glucose concentration calculated based on the glucose standard curve;

[0080] 20: Convert the enzyme activity in 50 μL of enzyme solution to the enzyme activity in 1 mL of enzyme solution;

[0081] 50: The glucose content in 10 μL of the mixed solution is converted to the glucose content in 500 μL of the mixed solution;

[0082] 15: reaction time 15min;

[0083] 1000: Convert 1 nmol to 1 μmol.

[0084] Half-life (t 1 / 2 ) determination: the purified enzyme was incubated in a water bath at a certain temperature and the residual enzyme activity was determined at different times.

[0085] Half inactivation temperature (T 50 10 ) determination: the purified enzyme was incubated at different temperatures for 10 min and the remaining enzyme activity was determined.

[0086] Melting temperature (T m ) was measured using a real-time fluorescence quantitative PCR instrument. First, 5 μg of purified enzyme was mixed with 1× protein thermal shift dye in a total volume of 20 μL. Then the program was set to Melt Curve, and the temperature was increased from 25°C to 99°C at a rate of 1.6°C / s. Finally, the temperature was derived by plotting a curve using the fluorescence intensity to determine T m value.

[0087] Thin layer chromatography was used to detect the sugar content in the solution: first, the TLC plate was activated in an oven at 80°C for 20 min, and then 1 μL of sample was placed on the plate every 1 cm; then, it was dried at 37°C for 3 min, and then placed in a chromatography bar containing 50 mL of chromatography liquid, and dried every 1 h for a total of 4 chromatography steps; finally, the color developing solution was evenly sprayed on the TLC plate using a spray bottle, and the plate was placed in an oven at 80°C for 6 min.

[0088] Example 1 Construction and screening of β-galactosidase mutant library

[0089] 1. Construction of random mutation library

[0090] The invention uses the recombinant plasmid pET-28a-Tac-Bgal1-3 as a template and randomly mutates the lactase gene Bgal1-3 (the gene sequence is shown in SEQ ID NO.2) through error-prone PCR.

[0091] The sequences (5'-3') of the primers used for error-prone PCR are as follows:

[0092] Bgal1-3-BamHI-F:TTATTGGATCCATGCGTCCCCTGATCGACTTCAATTBgal1-3-HindⅢ-R:GGCGGAAGCTTGTTCGCCGTGAGCGTGATGGACTG The error-prone PCR reaction system is shown in Table 1:

[0093] Table 1 Error-prone PCR reaction system

[0094]

[0095] The error-prone PCR reaction conditions are: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 2 min 30 s (the extension rate of the enzyme used in the present invention is 1 min / Kb), for a total of 30 cycles; and finally extension at 72°C for another 10 min.

[0096] The PCR products were detected by 1% agarose gel electrophoresis. After confirming the size of the amplified fragment, the plasmid pET-28a and the error-prone PCR product were double-digested with restriction endonucleases (Thermo Fisher) BamHI and HindIII, and the reaction was carried out at 37°C for 1.5h.

[0097] The double enzyme digestion reaction system is shown in Table 2:

[0098] Table 2 Double enzyme digestion reaction system

[0099]

[0100] After the enzyme digestion was completed, the digestion product was purified using the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes. The error-prone PCR fragment and the vector pET-28a were mixed at a molar ratio of 3:1 and then ligated with T4 DNA ligase (Thermo Fisher) at 22°C for 1 h.

[0101] The connection system is shown in Table 3:

[0102] Table 3 Connection system

[0103]

[0104] The connection products are made of OMEGA Recycling with MicroElute DNA Clean-Up Kit. Take 5 μL of ligation product and mix with 100 μL of E. coli DH5α competent cells, put into a sterile electroporation cup (0.1 cm), use 1500V voltage for electroporation (time is about 5 ms), then add 900 μL of SOC medium, and culture the transformant at 37°C and 200 rpm for 1 hour; spread the culture on LB solid medium supplemented with 20 μM IPTG and 50 μg / mL kana, and culture in a 30°C constant temperature incubator for 36 hours, which is the random mutation library.

[0105] 2. Construction of site-directed saturation mutagenesis library

[0106] The recombinant plasmid pET-28a-Tac-Bgal1-3 was used as a template and the degenerate codon NNK was used to construct a saturation mutation library. The PCR primers used for site-directed saturation mutagenesis are shown in Table 4 below:

[0107] Table 4 Primer sequences used for site-directed saturation mutagenesis

[0108]

[0109]

[0110] The PCR reaction system used for site-directed saturation mutagenesis is shown in Table 5:

[0111] Table 5 PCR reaction system used for site-directed saturation mutagenesis

[0112]

[0113] The PCR reaction conditions used for site-directed saturation mutagenesis were: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 1 min 30 s (the extension rate of the enzyme used in the present invention is 10 s / Kb), for a total of 30 cycles, and finally extension at 72°C for another 3 min.

[0114] The PCR product was detected by 1% agarose gel electrophoresis. After confirming that the size of the amplified fragment was correct, the product was purified by using the FastPure Gel DNA Extraction mini kit from Nanjing Novozymes. The ends of the PCR amplified product were phosphorylated using the Blunting Kination Ligation (BKL) Kit from TaKaRa, and the reaction was carried out at 37°C for 10 minutes and then inactivated at 70°C for 5 minutes.

[0115] The phosphorylation reaction system is shown in Table 6 below:

[0116] Table 6 Phosphorylation reaction system

[0117]

[0118] The phosphorylated PCR products were ligated with Thermo Fisher's T4 ligase and reacted at 22°C for 1 h.

[0119] The ligation reaction system is shown in Table 7 below:

[0120] Table 7 Ligation reaction system

[0121]

[0122] After the connection is completed, take 10 μL of the connection product and mix it with 100 μL of E. coli DH5α competent cells, then heat shock it at 42°C for 45 seconds, place it on ice for 2 minutes, add 900 μL of LB medium, and culture the transformant at 37°C and 200 rpm for 1 hour; spread the culture on LB solid medium supplemented with 20 μM IPTG and 50 μg / mL kana, and culture it in a 30°C incubator for 36 hours to obtain the site-directed saturation mutation library.

[0123] 3. Screening of β-galactosidase mutants

[0124] Initial screening: E. coli DH5α strain containing pET-28a-Tac-Bgal1-3 plasmid was spread on LB solid medium containing 50 μg / mL kana and 20 μM IPTG, and cultured at 30°C for 36 hours to induce enzyme production. The plate containing the above-mentioned random mutation library and site-directed saturation mutation library of the present invention was heat-treated at 70°C for 30 minutes, then cooled for 10 minutes, and 15 mL of the upper culture medium containing 0.75 μM X-gal was poured in for color development to screen positive clones.

[0125] Second screening: Select positive clones and use OMEGA's Plasmid Mini Kit was used to extract the plasmid from the colony. The extracted plasmid was mixed with competent E. coli BL21 (DE3) cells, heat-shocked at 42°C for 45s, placed on ice for 2min, and then 900μL LB medium was added. The transformant was cultured at 37°C and 200rpm for 1h. The culture was spread on LB solid medium containing 50μg / mL kanamycin. The culture was cultured in a 37°C incubator overnight until a single colony was formed.

[0126] Pick a single colony into LB liquid culture medium containing 50 μg / mL kana, culture overnight at 37°C and 220rpm, take 3% of the bacterial solution and transfer it to 20mL LB culture medium, culture at 37°C and 200rpm until the bacterial OD600 is 0.8-1.0, add 0.2mL of inducer IPTG (final concentration is 1mM), continue to culture at 25°C and 200rpm for 14h, collect the bacteria by centrifugation (5000g, 10min, 4°C), add an equal volume of 50mM pH 7.0 potassium dihydrogen phosphate-potassium hydrogen phosphate buffer to the bacteria, fully resuspend the bacteria, use an ultrasonic disruptor to break the cell wall, centrifuge at 14000rpm for 1min, and collect the supernatant to obtain the crude enzyme solution.

[0127] The half-inactivation temperature (T 50 10 ) and enzyme activity were detected, and the relative enzyme activity was calculated with the activity of wild-type β-galactosidase Bgal1-3 as 100%. 50 10 The improved positive mutations are sequenced to determine the mutation site and mutant sequence.

[0128] Example 2 Analysis of β-galactosidase mutants, thermal stability and crude enzyme activity

[0129] The present invention is based on the random mutation library and the site-directed saturation mutation library constructed in Example 1, and obtains 19 β-galactosidase mutants with improved thermal stability and mutation at only a single site, which are A66V, Q80G, S277M, S277V, V378T, V396A, Y398N, Y398C, F414Y, N418S, E462Q, E462G, N552D, K578R, S613P, D632T, F633L, S676F and R689L; wherein Q80G indicates that the 80th position of the amino acid sequence of β-galactosidase Bgal1-3 is mutated from Q to G, and the rest are analogous. The half-inactivation temperature (T 50 10 ) and crude enzyme activity are shown in Table 8:

[0130] Table 8 T of Bgal1-3 and its mutants 50 10 and crude enzyme activity

[0131]

[0132]

[0133] On the basis of the above single mutants, the present invention also obtained 9 combined mutants with improved thermal stability, which were named M2, M3, M4, M5, M6, M7, M8, M9 and M10 in sequence.

[0134] Specifically, M2 is to mutate the 462nd glutamic acid (Glu) of the amino acid sequence of Bgal1-3 to glutamine (Gln), and the 676th serine (Ser) to phenylalanine (Phe);

[0135] M3 is a mutation in which the 277th serine (Ser) in the amino acid sequence of Bgal1-3 is mutated to valine (Val), the 462nd glutamic acid (Glu) is mutated to glutamine (Gln), and the 676th serine (Ser) is mutated to phenylalanine (Phe).

[0136] M4 is a mutation in which the 277th serine (Ser) of the amino acid sequence of Bgal1-3 is mutated to valine (Val), the 462nd glutamic acid (Glu) is mutated to glutamine (Gln), the 676th serine (Ser) is mutated to phenylalanine (Phe), and the 689th (Arg) is mutated to leucine (Leu).

[0137] M5 mutates the 277th serine (Ser) of the amino acid sequence of Bgal1-3 to valine (Val), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu).

[0138] M6 mutates the 277th serine (Ser) of the amino acid sequence of Bgal1-3 to valine (Val), the 398th tyrosine (Tyr) to cysteine ​​(Cys), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu).

[0139] M7 mutates the 80th glutamine (Gln) of the amino acid sequence of Bgal1-3 to glycine (Gly), the 277th serine (Ser) to valine (Val), the 398th tyrosine (Tyr) to cysteine ​​(Cys), the 462nd glutamic acid (Glu) to glutamine (Gln), the 578th lysine (Lys) to arginine (Arg), the 676th serine (Ser) to phenylalanine (Phe), and the 689th arginine (Arg) to leucine (Leu).

[0140] M8 is a mutation in which the 80th glutamine (Gln) of the amino acid sequence of Bgal1-3 is mutated to glycine (Gly), the 277th serine (Ser) is mutated to valine (Val), the 378th valine (Val) is mutated to threonine (Thr), the 398th tyrosine (Tyr) is mutated to cysteine ​​(Cys), the 462nd glutamic acid (Glu) is mutated to glutamine (Gln), the 578th lysine (Lys) is mutated to arginine (Arg), the 676th serine (Ser) is mutated to phenylalanine (Phe), and the 689th arginine (Arg) is mutated to leucine (Leu).

[0141] M9 is a mutation in which the 80th glutamine (Gln) of the amino acid sequence of Bgal1-3 is mutated to glycine (Gly), the 277th serine (Ser) is mutated to valine (Val), the 378th valine (Val) is mutated to threonine (Thr), the 398th tyrosine (Tyr) is mutated to cysteine ​​(Cys), the 462nd glutamic acid (Glu) is mutated to glutamine (Gln), the 578th lysine (Lys) is mutated to arginine (Arg), the 633rd phenylalanine (Phe) is mutated to leucine (Leu), the 676th serine (Ser) is mutated to phenylalanine (Phe), and the 689th arginine (Arg) is mutated to leucine (Leu).

[0142] M10 is a mutation in which the 80th glutamine (Gln) of the amino acid sequence of Bgal1-3 is mutated to glycine (Gly), the 277th serine (Ser) is mutated to valine (Val), the 378th valine (Val) is mutated to threonine (Thr), the 398th tyrosine (Tyr) is mutated to cysteine ​​(Cys), the 462nd glutamic acid (Glu) is mutated to glutamine (Gln), the 578th lysine (Lys) is mutated to arginine (Arg), the 632nd aspartic acid (Asp) is mutated to threonine (Thr), the 633rd phenylalanine (Phe) is mutated to leucine (Leu), the 676th serine (Ser) is mutated to phenylalanine (Phe), and the 689th arginine (Arg) is mutated to leucine (Leu).

[0143] The half-inactivation temperature (T 50 10 ), thermal inactivation half-life at 63°C (t 1 / 2 ) and crude enzyme activity are shown in Table 9:

[0144] Table 9 T of Bgal1-3 and their combined mutants 50 10 , half-life (t 1 / 2 ) and crude enzyme activity

[0145]

[0146] As shown in Table 9, the thermal stability of mutants M9 and M10 is the most outstanding among the combined mutants, among which the T 50 10 was 64℃, 15.6℃ higher than the wild type. 50 10 It was 67.8℃, 19.4℃ higher than the wild type, so mutants M9 and M10 were selected for further analysis.

[0147] Example 3 Expression, purification and thermal stability analysis of Bgal1-3 and mutants M9 and M10

[0148] 1. Expression of Bgal1-3 and mutants M9 and M10

[0149] The bacterial liquid of wild-type Bgal1-3, mutant M9 and M10 expression strains were streaked on LB solid culture medium containing 1 mg kanamycin (kana), and cultured at 37°C for 24 h. Then, a single colony was picked and inoculated into LB liquid culture medium containing 50 mg / mL kana, and cultured at 37°C and 220 rpm for 14 h. 3% of the bacterial liquid was transferred to 100 mL LB culture medium, and cultured at 37°C and 200 rpm until the bacterial OD600 nm was 0.8-1.0, 1 mL of inducer IPTG (final concentration was 1 mM) was added, and the culture was continued at 25°C and 200 rpm for 14 h. The bacteria were collected by centrifugation (5000g, 10 min, 4°C).

[0150] 2. Purification of Bgal1-3 and mutants M9 and M10

[0151] (1) Resuspend the collected cells in 10 mL of 1× Binding Buffer and disrupt the cells using an ultrasonic disruptor. After disruption, centrifuge (10,000×g, 8 min) to collect the supernatant, and filter the supernatant with a 0.45 μm filter membrane to obtain a crude enzyme solution;

[0152] (2) Take 4 mL of His Bin resin and add it to the filter column to form a purification column;

[0153] (3) Wash the purification column with 10 mL of ultrapure water and 10 mL of 1× Binding Buffer in sequence;

[0154] (4) Slowly add the crude enzyme solution into the purification column;

[0155] (5) Add 20 mL of 1× Binding Buffer and 12 mL of 1× Wash Buffer, then elute with 5 mL of 1× Elute Buffer and collect the protein eluate;

[0156] (6) The protein was replaced with potassium phosphate buffer (pH 7.0, 50 mM) using a 30 kDa ultrafiltration tube and stored at 4°C.

[0157] 3. Thermal stability analysis

[0158] The present invention analyzes the thermal stability of the above-obtained β-galactosidase Bgal1-3 (wild type), mutants M9 and M10, including the melting temperature (T m The optimal temperatures of β-galactosidase Bgal1-3 (wild type) and mutant M9 were also determined. M9 was the best mutant considering the thermal stability and enzyme activity.

[0159] The half-inactivation temperature and T of β-galactosidase Bgal1-3 (wild type), mutants M9 and M10 m The results of the value determination are as follows Figure 1 As shown, Figure 1 A in the figure is the half-inactivation temperature determination result of Bgal1-3 and mutant M9; Figure 1 B in the figure is T of Bgal1-3 and mutant M9. m Value determination results; Figure 1 C in the figure is the half-inactivation temperature determination result of Bgal1-3 and mutant M10; Figure 1 D in the figure is T of Bgal1-3 and mutant M10. m The value is determined by Figure 1 It can be seen that the T of the combined mutant M9 m The value was 67.9℃, which was 14.8℃ higher than that of the wild type. The T m The value was 71.5℃, which was 18.4℃ higher than that of the wild type.

[0160] Optimum temperature determination: The enzyme (Bgal1-3-M9) and substrate (lactose) were mixed and placed under 20-75°C for catalytic reaction. Except for the reaction temperature, other conditions remained unchanged. The optimum temperature determination results of β-galactosidase Bgal1-3 (wild type) and mutant M9 are shown in Figure 2 As shown. Figure 2 It can be seen that the optimum temperature of the combined mutant M9 is 60°C, which is 15°C higher than that of the wild type.

[0161] Example 4 Determination of kinetic constants of Bgal1-3 and mutants M9 and M10

[0162] The present invention uses lactose as a substrate to determine the kinetic constants of β-galactosidase Bgal1-3 (wild type) and its combined mutants M9 and M10. Specifically, the present invention prepares lactose solutions of different concentrations (the concentrations are 2mM, 2.9mM, 5mM, 7.3mM, 10.2mM, 14.6mM, 29.2mM, 58.5mM, 87.7Mm and 117mM, respectively), and then determines the reaction rate ν of lactase at 40°C, and finally uses the lactose concentration as the horizontal coordinate and the reaction rate ν as the vertical coordinate, and uses Michaelis Menten to fit, and then calculates the Michaelis constant K m and the reaction conversion number k cat The results are shown in Table 10. As shown in Table 10, the k cat Value and k cat / K m The k cat Value and k cat / K m They are 1.44 and 1.91 times of the wild type, respectively, indicating that the catalytic efficiency of the obtained β-galactosidase mutant is significantly improved by combined mutation in the present invention.

[0163] Table 10 Kinetic constants of Bgal1-3 and its combined mutants M9 and M10

[0164]

[0165] Example 5 Lactose hydrolysis ability determination

[0166] The present invention takes Yili skim milk available on the market as an example, and uses thin layer chromatography (TLC) to detect the sugar components in the system, and measures the ability of β-galactosidase Bgal1-3 (wild type), combined mutants M9 and M10, and commercial enzyme MaxilactLGi 5000 to hydrolyze lactose in dairy products. Take equal amounts of milk, add purified enzymes with a final concentration of 10U / mL respectively, mix well, react at 63°C, and then use thin layer chromatography to detect the sugar components in the system, and analyze the hydrolysis ability of the above enzymes on lactose. The results are as follows: Figure 3 As shown. Figure 3 It can be seen that compared with the wild-type Bgal1-3 and the commercial enzyme MaxilactLGi 5000, the combined mutant M9 can completely hydrolyze lactose in milk into glucose and galactose within 30 minutes.

[0167] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for improving the thermal stability of β-galactosidase, characterized in that: The method comprises: mutating one or more of the amino acids at positions 66, 80, 277, 378, 396, 398, 414, 418, 462, 552, 578, 613, 632, 633, 676 and 689 of the amino acid sequence of β-galactosidase; the amino acid sequence of β-galactosidase is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that: The method is: Mutate alanine at position 66 to valine; or mutate glutamine at position 80 to glycine; or replace the serine at position 277 with valine or methionine; or replace valine at position 378 with threonine; or replace valine at position 396 with alanine; or replacing tyrosine at position 398 with cysteine ​​or asparagine; or replace phenylalanine at position 414 with tyrosine; or replace asparagine at position 418 with serine; or replace glutamic acid at position 462 with glutamine or glycine; or replacing asparagine at position 552 with aspartic acid; or replace lysine at position 578 with arginine; or replace serine at position 613 with proline; or replace aspartic acid at position 632 with threonine; or replace phenylalanine at position 633 with leucine; or replace serine at position 676 with phenylalanine; or replace arginine at position 689 with leucine; or mutating glutamic acid at position 462 to glutamine and serine at position 676 to phenylalanine; or mutating the serine at position 277 to valine, the glutamic acid at position 462 to glutamine, and the serine at position 676 to phenylalanine; or mutating serine at position 277 to valine, glutamic acid at position 462 to glutamine, serine at position 676 to phenylalanine, and serine at position 689 to leucine; or mutating the serine at position 277 to valine, the glutamic acid at position 462 to glutamine, the lysine at position 578 to arginine, the serine at position 676 to phenylalanine, and the arginine at position 689 to leucine; or mutating serine at position 277 to valine, tyrosine at position 398 to cysteine, glutamic acid at position 462 to glutamine, lysine at position 578 to arginine, serine at position 676 to phenylalanine, and arginine at position 689 to leucine; or mutating glutamine at position 80 to glycine, serine at position 277 to valine, tyrosine at position 398 to cysteine, glutamic acid at position 462 to glutamine, lysine at position 578 to arginine, serine at position 676 to phenylalanine, and arginine at position 689 to leucine; or mutating glutamine at position 80 to glycine, serine at position 277 to valine, valine at position 378 to threonine, tyrosine at position 398 to cysteine, glutamic acid at position 462 to glutamine, lysine at position 578 to arginine, serine at position 676 to phenylalanine, and arginine at position 689 to leucine; or mutating glutamine at position 80 to glycine, serine at position 277 to valine, valine at position 378 to threonine, tyrosine at position 398 to cysteine, glutamic acid at position 462 to glutamine, lysine at position 578 to arginine, phenylalanine at position 633 to leucine, serine at position 676 to phenylalanine, and arginine at position 689 to leucine; Or the glutamine at position 80 is mutated to glycine, the serine at position 277 is mutated to valine, the valine at position 378 is mutated to threonine, the tyrosine at position 398 is mutated to cysteine, the glutamic acid at position 462 is mutated to glutamine, the lysine at position 578 is mutated to arginine, the aspartic acid at position 632 is mutated to threonine, the phenylalanine at position 633 is mutated to leucine, the serine at position 676 is mutated to phenylalanine, and the arginine at position 689 is mutated to leucine.

3. A β-galactosidase mutant with improved thermal stability, characterized in that The mutant is obtained by the method according to claim 1 or 2.

4. A gene encoding the β-galactosidase mutant according to claim 3.

5. A recombinant vector containing the gene according to claim 4. A recombinant bacterium containing the recombinant vector according to claim 5.

7. Use of the β-galactosidase mutant according to claim 3, the gene according to claim 4, the recombinant vector according to claim 5 or the recombinant bacteria according to claim 6 in degrading lactose.

8. Use of the β-galactosidase mutant according to claim 3, the gene according to claim 4, the recombinant vector according to claim 5 or the recombinant bacteria according to claim 6 in the preparation of a preparation for degrading lactose.

9. Use of the β-galactosidase mutant according to claim 3, the gene according to claim 4, the recombinant vector according to claim 5 or the recombinant bacteria according to claim 6 in the production of low-lactose or lactose-free dairy products.

10. Use of the β-galactosidase mutant according to claim 3, the gene according to claim 4, the recombinant vector according to claim 5 or the recombinant bacteria according to claim 6 in the preparation of a preparation for producing low-lactose or lactose-free dairy products.

Images