PiRNA-400431 and application thereof

Abstract

The invention provides a piRNA-400431 (piRNA (Ribonucleic Acid)) and an application thereof. The invention provides a novel liver cancer marker piRNA-400431, the piRNA-400431 is highly expressed in liver cancer tissues and cells and has relatively high specificity and sensitivity, a novel liver cancer treatment target is provided based on the liver cancer marker, a treatment strategy taking the piRNA-400431 as the target is developed, and a new thought and direction are provided for treatment of liver cancer.

Description

Technical field:

[0001] The present invention specifically relates to piRNA-400431, and its application as a target in the preparation or screening of liver cancer therapeutic drugs, and its application in the preparation of liver cancer diagnostic preparations. Background technology:

[0002] The morbidity and mortality rates of liver cancer are high. Its morbidity ranks fifth among solid tumors worldwide and it is also the second leading cause of cancer-related deaths. Because its early symptoms are not obvious, most of them will have distant metastases when they are discovered, and the prognosis is still poor after treatment. Chemotherapy is the first choice for systemic treatment of liver cancer, but traditional chemotherapy has low selectivity for tumor cells and large side effects. Therefore, exploring the molecular mechanism of the occurrence and development of HCC is the key to its research, and finding an effective treatment method is an urgent problem to be solved.

[0003] piRNA is a complex class of small non-coding RNAs discovered in fruit fly germ cells in 2006. Most of them are 24 to 31 nucleotides in length. With the in-depth study of piRNA, it was found that it plays an important role in germ cell and embryonic development, maintenance of stem cell function, maintenance of germline gene integrity, transposon transcriptional silencing, translation inhibition, and cancer occurrence and development. The mechanism of action of non-coding RNA, especially piRNA, in liver-related diseases is still unclear. piRNA plays a key role in the occurrence and development of liver cancer and may serve as a biomarker and new therapeutic target for liver cancer. Therefore, the study of the function and mechanism of piRNA has important scientific significance and clinical value. Summary of the invention:

[0004] The primary purpose of the present invention is to provide a new piRNA, namely piRNA-400431, and its use in the preparation and / or screening of liver cancer therapeutic drugs. The present invention first discovered that the expression level of piRNA-400431 in liver cancer may be related to the occurrence, development and prognosis of the disease, and has high specificity and sensitivity. Therefore, based on the above liver cancer marker, a new liver cancer treatment target is provided, and a treatment strategy with piRNA-400431 as a target is developed, which provides new ideas and directions for the treatment of liver cancer.

[0005] The piRNA-400431 provided by the present invention has a nucleic acid sequence:

[0006] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGC AAC.

[0007] The present invention provides the use of the piRNA-400431 in the preparation and / or screening of drugs for treating liver cancer.

[0008] Further,

[0009] The liver cancer therapeutic drug includes a preparation that inhibits the expression level of piRNA-400431.

[0010] Furthermore,

[0011] The agent for inhibiting the expression level of piRNA-400431 is a piRNA-400431 inhibitor.

[0012] Preferably, the inhibitor sequence is: AAGCAACATCAGTCTGATAAGCTA.

[0013] The second object of the present invention is to provide a drug for treating liver cancer, including a preparation for inhibiting the expression level of piRNA-400431.

[0014] Further,

[0015] The agent for inhibiting the expression level of piRNA-400431 is a piRNA-400431 inhibitor.

[0016] Preferably, the inhibitor sequence is: AAGCAACATCAGTCTGATAAGCTA.

[0017] The third object of the present invention is to provide a reagent for detecting the piRNA-400431 for use in preparing a liver cancer diagnostic preparation.

[0018] Further,

[0019] The reagent for detecting the piRNA-400431 includes a reagent for detecting the expression amount of piRNA-400431.

[0020] Furthermore,

[0021] The reagent for detecting the expression of piRNA-400431 includes a PCR reagent, and the preferred PCR primer sequence is:

[0022] F:5'-GCTTATCAGACTGATGTTGCTT-3'

[0023] R:5'-GCAGGGTCCGAGGTTATTC-3'.

[0024] The present invention uses piRNA-400431 as a target for RNA interference, and develops a tumor treatment drug or preparation that can target the piRNA-400431 gene, thereby reducing the expression level of the piRNA-400431 gene in tumor cells. There are nucleic acid molecules that reduce the expression level of piRNA-400431 in liver cancer cells. The nucleic acid molecules that reduce the expression level of piRNA-400431 in tumor cells are mainly piRNA-400431 inhibitors, and the sequence of the inhibitor is: AAGCAACATCAGTCTGATAAGCTA; the control piRNA-NC sequence is: UUCUCCGAACGUGUCACGU.

[0025] The preliminary study of the present invention found that piRNA-400431 was highly expressed in liver cancer tissue samples and liver cancer cell lines. After using piRNA-400431 inhibitors, the expression of liver cancer cell lines was reduced, and the cloning, invasion and migration capabilities of liver cancer cells were reduced. Further animal pre-experiments suggest that the use of piRNA-400431 inhibitors can significantly inhibit the growth of liver cancer cells. The present invention provides a scientific basis for piRNA as a liver cancer treatment strategy and provides a new idea for targeting piRNA-400431 to improve the efficacy of liver cancer treatment.

[0026] In summary, the present invention provides a new target for liver cancer treatment, a treatment strategy using the piRNA-400431 gene as a target. Interference with the piRNA-400431 gene may help block the growth, metastasis and invasion of liver cancer cells, thereby providing new ideas and directions for the treatment of liver cancer, which has far-reaching clinical significance and important prospects for promotion and application.

[0027] The present invention also provides a new liver cancer marker piRNA-400431, wherein the expression of the piRNA-400431 in liver cancer tissues and cells is upregulated with statistical significance. Compared with traditional liver cancer markers, the piRNA-400431 gene may have higher specificity and sensitivity.

[0028] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but will not be limited to the present invention. Description of the drawings:

[0029] Figure 1 The differential piRNA expression analysis of 5 pairs of HCC tissues and corresponding normal tissues; Figure 1 A is the clustering heat map of differentially expressed piRNAs and Figure 1 B is a volcano analysis diagram.

[0030] Figure 2A is the expression level of piRNA-400431 in cancer tissues and adjacent tissues of HCC patients; Figure 2 B is the expression level of piRNA-400431 in liver cancer cells; Figure 2 C is the expression level of piRNA-400431 after transfection of piRNA-400431 inhibitor into liver cancer cells Hep3B and HepG2. (The two groups were statistically analyzed using an independent sample t-test, ** represents p<0.01 *** represents p<0.001).

[0031] Figure 3 The ROC curve was used to evaluate the sensitivity and specificity of piRNA-400431 for liver cancer diagnosis. The AUC value was 0.803, the sensitivity was 0.702, and the specificity was 0.904.

[0032] Figure 4 To inhibit the proliferation and migration of liver cancer cells after using piRNA-400431 inhibitor; Figure 4 A shows the cell proliferation of HepG2 cells after transfection of piRNA-NC and piRNA-inhibitor; Figure 4 B shows the formation of cell clone numbers after piRNA-NC and piRNA-inhibitor transfection of HepG2 cells; Figure 4 C shows the invasion and migration of HepG2 cells after piRNA-NC and piRNA-inhibitor transfection. (The two groups were statistically analyzed using an independent sample t-test, ** represents p<0.01).

[0033] Figure 5 The growth of tumors after nude mice were subcutaneously inoculated with piRNA-NC and piRNA-inhibitor transfected HepG2 cell lines. Specific implementation method:

[0034] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0035] 1.1 Sample Collection

[0036] A total of 60 cancer tissues and 60 adjacent tissues from liver cancer patients were collected. The clinical samples had complete clinical data, including the patient's name, gender, age, hospitalization number, pathological type, pathological stage, treatment received, etc. The consent of the subjects was obtained for all clinical samples.

[0037] 1.2 RNA-Seq sequencing to screen differentially expressed piRNAs

[0038] RNA-Seq sequencing was performed on liver cancer tissues to screen for differentially expressed piRNAs. This part of the experiment was completed by Guangzhou Ruibo Biotechnology Co., Ltd. The specific steps are as follows: First, the total RNA sample was pre-treated and then synthesized into cDNA, mixed with Arraystar Green qPCR Master Mix and cDNA template were loaded into the well plate and amplified by real-time fluorescence quantitative PCR equipment ABI7900 qPCR. The piRNAs with significant abnormal expression were screened based on the differential expression fold change ≥ 2 and p value < 0.05.

[0039] RNA-seq results analysis

[0040] RNA sequencing was performed on total RNA obtained from five pairs of HCC and normal tissues, and heat maps and volcano plots of piRNA differential expression were plotted based on the differential expression levels of dysregulated piRNAs (|fold change| ≥ 2 and p value < 0.05). Figure 1 We selected piRNA-400431, which was significantly upregulated in HCC tissues, for qPCR validation.

[0041] 1.3 Extraction and reverse transcription of total RNA from tissue samples and cell lines

[0042] RNA is extracted from tissues or cells using an RNA extraction kit, the RNA concentration is measured using Nano Drop, and then reversed into cDNA using a reverse transcription kit.

[0043] Reverse transcription was performed using a reverse transcription kit, the system is as follows:

[0044]

[0045]

[0046] Reaction conditions:

[0047] 42°C, 90 minutes; 95°C, 5 minutes; cool on ice to obtain cDNA solution.

[0048] Fluorescence quantitative PCR: First, PCR detection was performed for piRNA-400431 primers (synthesized by Sangon Biotechnology Co., Ltd.) as follows:

[0049] F:5'-GCTTATCAGACTGATGTTGCTT-3'

[0050] R:5'-GCAGGGTCCGAGGTTATTC-3'

[0051] The PCR product was sequenced to confirm that the sequence of piRNA-400431 was correct. The relative expression of piRNA-400431 was detected using SYBR Green Mixture with -actin as an internal reference.

[0052] Fluorescence quantitative PCR system

[0053]

[0054] PCR conditions

[0055]

[0056] After the PCR process is completed, the Ct value of each PCR reaction is obtained and the -ΔΔCt The relative expression of circular RNA was calculated by this method.

[0057] Based on the sequence of piRNA-400431, an inhibitor that specifically knocks down piRNA-400431 was designed.

[0058] Its sequence: AAGCAACATCAGTCTGATAAGCTA

[0059] Control NC sequence: UUCUCCGAACGUGUCACGU.

[0060] 1.3 Inhibitor transfection cells

[0061] Cells were transfected with piRNA-NC and piRNA-inhibitor, respectively: liver cancer cells (Hep3B and HepG2) were plated in 24-well plates, and cells were transfected with 1ipo3000 transfection reagent (purchased from Thermo Fisher). 25 pmol inhibitor was added to each well. Cell RNA was extracted after 72 hours, and the expression of piRNA-400431 was detected by real-time fluorescence quantitative PCR.

[0062] The experimental results showed that piRNA-400431 was highly expressed in liver cancer tissues and cells, and the use of inhibitors in liver cancer cells (Hep3B and HepG2) could reduce the expression of piRNA-400431 ( Figure 2 ).

[0063] 1.4CCK-8 detection of cell proliferation

[0064] The hepatoma cells (Hep3B and HepG2) transfected with piRNA-NC and piRNA-inhibitor were counted and the number of cells was 1×10 3The number of liver cancer cells per well was inoculated into 100 μL of complete culture medium in a 96-well plate and cultured in an incubator at 37°C. According to the concentration of 10% CCK-8 (10 μL of CCK-8 solution was added to 100 μL of complete culture medium), 100 μL was taken and added to the 96-well plate, incubated at 37°C for 2 hours, and the absorbance value (OD value) of each well was measured at a wavelength of 450 nm using an enzyme reader.

[0065] The experimental results showed that the piRNA-400431 inhibitor can significantly inhibit the proliferation of liver cancer cells HepG2 ( Figure 4 A).

[0066] 1.5 Clone formation experiment

[0067] Add 3 × 10 2 Hepatoma cells were cultured for 14 consecutive days, and the culture medium was replaced every 3 days. The culture medium in the well plate was discarded, and the cells were washed 2-3 times with PBS. The cells were fixed with 4% paraformaldehyde for 10-15 minutes, and then 0.1% crystal violet was added for staining for 10 minutes. The excess crystal violet was removed and washed with running water. More than 50 cell clusters were counted as one clone, and the number of cell clones in different treatment groups was calculated for statistical analysis.

[0068] The experimental results showed that the piRNA-400431 inhibitor can significantly inhibit the cloning ability of liver cancer cells HepG2 ( Figure 4 B).

[0069] 1.6 Transwell assay

[0070] Take 250 μL of 2×10 5 The resuspension of liver cancer cells (medium without FBS) was added to the upper chamber of the Transwell chamber, and the medium containing 10% FBS was added to the lower chamber. After culturing in a 37°C incubator for 1-2 days, the medium in the upper chamber was discarded, and the cells were washed twice with PBS. The cells were fixed with 4% paraformaldehyde for 10-15 minutes, and then 0.1% crystal violet was added for staining for 10 minutes, and the excess crystal violet was removed and rinsed with running water. The number of cells that passed through the lower membrane of the upper chamber was observed and counted under an optical microscope for statistical analysis.

[0071] The experimental results showed that the piRNA-400431 inhibitor can significantly inhibit the invasion and migration ability of liver cancer cells HepG2 ( Figure 4 C).

[0072] 1.7 Nude mouse tumorigenesis assay

[0073] HepG2 cells transfected with piRNA-NC and piRNA-inhibitor were plated on a 10 cm dish. When the number of cells reached the injection standard, they were digested and counted. 2×10 6 The cells were injected subcutaneously into BALB / c nude mice, and the tumors were removed on day 25 and their weights were calculated.

[0074] Figure 5 The experimental results suggest that piRNA-400431 inhibitor has an inhibitory effect on the growth of liver cancer cells HepG2.

Claims

1. piRNA-400431, characterized in that Nucleic acid sequence: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGCAAC.

2. Use of the piRNA-400431 described in claim 1 in the preparation and / or screening of drugs for treating liver cancer.

3. The use according to claim 2, characterized in that: The liver cancer therapeutic drug includes a preparation that inhibits the expression level of piRNA-400431.

4. The use according to claim 3, characterized in that: The agent for inhibiting the expression level of piRNA-400431 is a piRNA-400431 inhibitor. Preferably, the inhibitor sequence is: AAGCAACATCAGTCTGATAAGCTA.

5. A drug for treating liver cancer, characterized in that: Agents that inhibit the expression level of piRNA-400431 are included.

6. The liver cancer therapeutic drug according to claim 5, characterized in that: The agent for inhibiting the expression level of piRNA-400431 is a piRNA-400431 inhibitor. Preferably, the inhibitor sequence is: AAGCAACATCAGTCTGATAAGCTA.

7. Use of the reagent for detecting piRNA-400431 according to claim 1 in the preparation of a liver cancer diagnostic preparation.

8. The use according to claim 7, characterized in that: The reagent for detecting the piRNA-400431 includes a reagent for detecting the expression amount of piRNA-400431.

9. The use according to claim 8, characterized in that: The reagent for detecting the expression of piRNA-400431 includes a PCR reagent, and the preferred PCR primer sequence is: F:5'-GCTTATCAGACTGATGTTGCTT-3' R:5'-GCAGGGTCCGAGGTTATTC-3'.

Images