CircSamd4 and application thereof in preparation of medicine for treating myocardial fibrosis

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to circSamd4 and application thereof in preparation of a medicine for treating myocardial fibrosis. In order to screen and obtain circRNA playing a key role in the myocardial fibrosis process so as to provide a medicine for preparing myocardial fibrosis, the invention provides circSamd4, a vector for reducing circSamd4 expression, a host cell containing the vector and application of the circSamd4 in preparation of the medicine for treating myocardial fibrosis. The circSamd4 which plays a key role in the myocardial fibrosis process is found for the first time, the nucleotide sequence of the circSamd4 is shown as SEQ ID NO: 1 or SEQ ID NO: 2, and it is verified that knocking down circSamd4 expression can improve cardiac systolic function damage caused by thoracic aortic arch constriction for four weeks, relieve myocardial fibrosis, inhibit myocardial fibroblast activation and inhibit myocardial fibrosis. The compound can be used for preparing medicines for treating myocardial fibrosis, and has important practical significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to circSamd4 and use thereof in preparing a drug for treating myocardial fibrosis. Background Art

[0002] Myocardial fibrosis refers to a pathological process characterized by excessive proliferation of fibroblasts and excessive deposition of extracellular matrix in the myocardial tissue structure due to harmful stimuli such as systemic diseases, cardiac ischemia, and drugs. It is present in a variety of cardiovascular diseases, such as myocardial hypertrophy, myocardial infarction, chronic heart failure, and diabetic cardiomyopathy. Myocardial fibrosis is an inevitable common pathological feature of various cardiovascular diseases at the end stage, an important manifestation of adverse cardiac remodeling, and one of the main causes of heart failure and sudden death. Fibrosis is initially an adaptive response. The deposition of extracellular matrix (ECM) is crucial to maintaining the integrity of myocardial tissue, healing of injuries, and maintaining the physiological function of the heart. When the injury is mild, the fibrotic reaction only promotes the transient accumulation of ECM components. After promoting the recovery of normal myocardial tissue structure, the synthesis of ECM stops rapidly. However, when myocardial injury is aggravated, myocardial ECM components will continue to deposit, which may lead to an increase in scar tissue, that is, pathological cardiac remodeling, cardiac systolic and diastolic dysfunction, and ultimately heart failure. Inhibiting or reversing myocardial fibrosis has become one of the goals of clinical treatment of heart disease. However, there is still a lack of specific means of intervention for myocardial fibrosis in the clinic. Current clinical treatment results have found that RAAS inhibitors can reduce myocardial fibrosis, such as angiotensin converting enzyme inhibitors, angiotensin receptor antagonists, aldosterone receptor antagonists spironolactone and eplerenone, but they are still in the clinical research stage. The main reason for the lack of specific intervention methods is that the current understanding of myocardial fibrosis is very limited. Therefore, screening key targets for regulating myocardial fibrosis and clarifying their role in myocardial fibrosis are of great significance for the early intervention of heart failure.

[0003] Circular RNA (circRNA) is a special type of non-coding RNA. Thanks to the development of high-throughput sequencing technology and circRNA bioinformatics algorithms, abundant circRNAs in eukaryotic organisms have been discovered and their functions have been gradually elucidated. The covalently closed ring structure of circRNA determines that it is more stable than linear RNA, less susceptible to exoribonucleases, and less susceptible to degradation. In addition, circRNA has tissue and disease specificity and can be packaged into extracellular vesicles for intercellular transport. In particular, the development of circRNA preparation technology and the application prospects of RNA-mediated gene therapy have made circRNA a research focus that has attracted much attention in disease treatment strategies. Studies have found that circRNA plays an important regulatory role in the occurrence and development of cardiovascular diseases by regulating key biological processes in the cardiovascular system, such as cell proliferation, apoptosis, mitochondrial damage, and oxidative stress. Existing studies have found that the loss of circNfix can promote cardiomyocyte proliferation and angiogenesis after myocardial infarction (MI), inhibit cardiomyocyte apoptosis after MI, alleviate heart failure, and improve prognosis; circ-SIRT1 promotes cell autophagy and inhibits myocardial hypertrophy by upregulating the expression of its host gene SIRT1; circFndc3b can inhibit stress-induced endothelial cell apoptosis, increase angiogenesis after MI, and alleviate left ventricular dysfunction after MI. It can be seen that circRNAs are ideal targets for the diagnosis and treatment of cardiovascular diseases. However, people's understanding of circRNAs in cardiac fibrosis is still limited, and the function of circRNAs in fibroblast activation and cardiac fibrosis remains to be studied. Summary of the invention

[0004] The technical problem to be solved by the present invention is to screen circRNA that plays a key role in the process of myocardial fibrosis and provide a drug for preparing myocardial fibrosis.

[0005] The technical solution of the present invention to solve the above technical problem is: to provide a myocardial fibrosis-related circSamd4, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0006] SEQ ID NO: 1 Nucleotide sequence of mouse circSamd4

[0007] GAATCATTAACCAATGGCAACAGGAATCCAAGGATAAAGTGATTTCCCTTCTGCTAACTC

[0008] ACCTGCCTTTGCTGAAGCCAGGAAACCTCGACGCGAAAGCAGAGTATATGAAACTGCT

[0009] GCCCAAGATCCTGGCACACTCTATCGAACACAACCAGCACATTGAGGAGAGCAGGCAG

[0010] CTGCTGTCCTATGCTTTGATCCACCCAGCCACTTCCTTGGAAGACCGCAGCGCACTAGCC

[0011] ATGTGGCTGAATCACTTGGAGGACCGCACATCCACCAGCTTTGGTAGCCAGAACCGAGG

[0012] CCGCTCGGACTCTGTGGATTATGGACAGACGCATTACTATCACCAAAGACAGAACTCTG

[0013] ACGATAAGCTCAATGGCTGGCAGAACTCTCGGGATTCTGGGATTTGCATCAGTGCCTCC

[0014] AACTGGCAGGACAAGAGCCTGGGCTGTGAGAATGGCCATGTGCCCCTCTACTCTTCCTCGTCTGTCCCTGCCACAATCAACACGATTGGAACCGGCGCAAGCACGA。

[0015] SEQ ID NO:2 Nucleotide sequence of human circSAMD4A

[0016] GAATCATTAACCAATGGCAACAGGAATCCAAGGATAAAGTGATTTCCCTCCTGTTAACTC

[0017] ATCTGCCTTTGCTGAAGCCAGGAAACCTCGACGCGAAAGTAGAATATATGAAACTGCTG

[0018] CCCAAAATCCTGGCTCACTCTATTGAACACAACCAGCACATTGAGGAGAGCAGGCAGCT

[0019] GCTGTCCTATGCTTTGATACATCCAGCCACTTCGTTAGAAGACCGTAGTGCTTTAGCCAT

[0020] GTGGCTGAATCACTTGGAGGACCGCACGTCGACCAGCTTTGGTGGCCAGAACCGAGGC

[0021] CGCTCAGACTCTGTGGATTATGGACAGACACACTACTATCACCAAAGACAGAACTCTGA

[0022] TGACAAGCTCAATGGGTGGCAGAACTCTCGGGATTCTGGGATTTGCATCAATGCCTCCA

[0023] ACTGGCAGGACAAAAGCATGGGGTGTGAGAATGGCCATGTGCCCCTCTACTCCTCCTCATCTGTCCCCACCACAATCAATACGATTGGAACCAGCACAAGTACAA.

[0024] The present invention also provides a use of the above circSamd4 in preparing a drug for treating myocardial fibrosis.

[0025] Furthermore, the present invention also provides a vector for reducing the expression of the above-mentioned circSamd4.

[0026] Preferably, in the above-mentioned vector, the vector is a viral vector. More preferably, the viral vector is an adeno-associated viral vector. Further preferably, the vector is GV733.

[0027] Furthermore, the above vector also includes a Periostin promoter.

[0028] Preferably, the sequence of construction of the above vector is: Periostin-EGFP-MIR155(MCS)-SV40 PolyA.

[0029] Among them, the nucleotide sequence of the target gene of the above-mentioned vector is SEQ ID NO: 16, and the two oligonucleotide sequences designed for knocking down circSamd4 are SEQ ID NO: 17 and SEQ ID NO: 18 respectively.

[0030] The present invention also provides a host cell comprising the above vector.

[0031] Furthermore, the present invention also provides a use of the above-mentioned vector and host cell for reducing circSamd4 expression in the preparation of a drug for treating myocardial fibrosis.

[0032] Wherein, in the above use, the myocardial fibrosis is myocardial fibrosis induced by pressure overload.

[0033] Wherein, in the above use, the myocardial fibrosis includes impaired cardiac contractile function or inhibition of myocardial fibroblast activation.

[0034] The beneficial effects of the present invention are:

[0035] The present invention provides a use of circSamd4 in the preparation of a drug for treating myocardial fibrosis, and further provides a drug for treating myocardial fibrosis. The present invention has found through experimental studies that knocking down circSamd4 can reduce myocardial fibrosis, especially has a good effect on myocardial fibrosis induced by pressure overload, can improve the impaired cardiac contractile function caused by thoracic aortic arch stenosis for 4 weeks, and reduce the effect of myocardial fibrosis. Knocking down circSamd4 on cells can inhibit the activation of myocardial fibroblasts. Based on this, the present invention also provides a method for preparing a drug for treating myocardial fibrosis, which provides a new idea for the treatment of heart failure-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Figure 1 is the screening process of circSamd4. A is a schematic diagram of using circRNA chips to detect differential circRNAs in normal hearts and mouse fibrotic hearts, as well as the top 10 circRNAs significantly upregulated in TAC mouse hearts after screening; B is the distribution of the top 3 upregulated circRNAs in cardiomyocytes and cardiac fibroblasts; C is the expression of circSamd4 in Sham and TAC mouse cardiac fibroblasts. n=4-6, **, p<0.01; ***p<0.001, Sham: sham surgery; TAC: thoracic aortic arch constriction.

[0037] Figure 2The results of knocking down circSamd4 to reduce the activation of cardiac fibroblasts stimulated by TGF-β1. A shows the knockdown efficiency of circSamd4 and the expression of its source gene Samd4 detected by real-time quantitative PCR (RT-qPCR) after transfection of si-circSamd4 in cardiac fibroblasts; B shows the expression of fibroblast activation marker genes Ccn2 and Postn detected by RT-qPCR after knocking down circSamd4 in cardiac fibroblasts; C shows the immunofluorescence representative graph and statistical results of α-SMA in fibroblasts detected after knocking down circSamd4 in cardiac fibroblasts. n=3, ns, not significant, *, p<0.05, ***, p<0.001.

[0038] Figure 3 This is a map of the adeno-associated virus vector used in the present invention.

[0039] Figure 4 The results show that knocking down circSamd4 alleviates myocardial fibrosis and improves cardiac function caused by thoracic aortic arch stenosis for 4 weeks.

[0040] Among them, A is the knockdown efficiency of AAV9-sh-circSamd4 in mice and the mRNA expression results of circSamd4 source gene; B is the representative echocardiogram of each treatment group; C is the ejection fraction (EF) and fraction shortening (FS) results of each treatment group; D is the result of RT-qPCR detection of the expression of cardiac fibrosis marker genes Ccn2 and Postn in each treatment group; E is the representative Masson staining of each treatment group and the statistical results of fibrosis area, the blue area is the obvious collagen deposition area, n=5-10, *, p<0.05, ***, p<0.001. DETAILED DESCRIPTION

[0041] The present invention screened and identified the key target circSamd4 related to myocardial fibrosis for the first time by analyzing the circRNA expression profile of myocardial tissue of myocardial fibrosis mice. The nucleotide sequence is shown in SEQ ID NO:1.

[0042] Subsequently, the present invention conducted a cell experiment, synthesized small interfering RNA (siRNA), and transfected si-circSamd4 in cardiac fibroblasts to detect the activation level of cardiac fibroblasts. The results showed that knocking down circSamd4 can reduce the activation of mouse fibroblasts, suggesting that circSamd4 may be related to myocardial fibrosis and can be used as a target for the preparation of drugs for the treatment of myocardial fibrosis.

[0043] After that, the present invention conducted animal experiments, constructed an adeno-associated virus (AAV) carrying the Periostin promoter (targeting activated myocardial fibroblasts) to knock down circSamd4, and injected the virus 1 week after thoracic aortic arch constriction surgery. Four weeks after thoracic aortic arch constriction surgery, echocardiography, pathological staining, etc. were used to evaluate the effect of knocking down circSamd4 on myocardial fibrosis and cardiac function in mice. The applicant found that compared with mice in which circSamd4 was not knocked down, knocking down circSamd4 using an adeno-associated virus significantly reduced myocardial fibrosis caused by pressure overload and improved cardiac contractile function. The above study further confirmed that circSamd4 can be used as a target for the preparation of myocardial fibrosis drugs.

[0044] Based on this, the present application provides the use of the above-mentioned circSamd4 and a vector for reducing the expression of circSamd4, and a host cell containing the above-mentioned vector in the preparation of a drug for treating myocardial fibrosis.

[0045] The circBase ID of circSamd4 is mm9_circ_005305, and its nucleotide sequence is shown in SEQ ID NO: 1. The nucleotide sequence of human circSAMDd4A is shown in SEQ ID NO: 2.

[0046] According to BLAST comparison, the circSamd4 sequence of mice and humans is 93% conservative, which is highly conservative. The present invention experimentally proves that the drug for treating myocardial fibrosis prepared by circSamd4 can reduce myocardial fibrosis, mainly myocardial fibrosis induced by pressure overload; specifically, knocking down circSamd4 has the effect of improving the impaired cardiac contractile function caused by thoracic aortic arch stenosis for 4 weeks and reducing myocardial fibrosis; knocking down circSamd4 on cells can inhibit the activation of myocardial fibroblasts.

[0047] The specific implementation modes of the present invention will be further explained below through examples, but it does not mean that the protection scope of the present invention is limited to the scope described in the examples.

[0048] Example 1 Screening of key circRNAs in myocardial fibrosis

[0049] (1) A pressure overload-induced myocardial fibrosis mouse model was established using thoracic aorta constriction (TAC). The specific steps are as follows:

[0050] SPF-grade healthy C57BL / 6 mice (male, 6-8 weeks, 20-22g) were enrolled and randomly divided into sham operation (Sham) group and TAC group. Before surgery, mice were anesthetized by isoflurane inhalation. The anesthetized mice were fixed on a heating pad in a supine position. The chest hair of the mice was removed with depilatory cream to fully expose the thorax, and then disinfected with iodine. The mice were intubated. After successful intubation, the anesthesia machine was connected to a small animal ventilator to keep the mice breathing. The chest skin was cut open, the sternum was cut open horizontally, the muscles were bluntly separated, and the chest cavity was opened with a chest expander. Then the thymus was separated with forceps to expose the aortic arch and the first, second, and third branches. A 5-0 silk thread was passed through the blood vessels between the first and second branches, and a 27G needle was used to ligate the aortic arch with silk thread, and then the needle was removed. After the thoracotomy of the Sham group mice, only the blood vessels were exposed and threaded but not ligated. The chest cavity was closed and the muscle layer and skin were sutured, and the surgical wound was disinfected with iodine. The vital signs of the mice were closely observed after surgery and they were kept in a conventional manner until the end of the experiment.

[0051] (2) Obtain fibrotic mouse hearts for Arraystar Mouse circRNA Array analysis to obtain the circRNA expression profile of mouse fibrotic hearts. The specific steps are as follows:

[0052] After 4 weeks of TAC, representative hearts from the sham group and TAC group were taken for RNA extraction. The concentration and purity of the total RNA of the samples were determined using NanoDrop, and the integrity of the RNA was assessed by denaturing agarose gel electrophoresis. The total RNA of each sample was then treated with RNase R to enrich circular RNA. The enriched circular RNA was then amplified using random primers according to the Arraystar Super RNA Labeling protocol (Arraystar, Inc.). RNA was purified using the RNeasy MiniKit kit. This was followed by hybridization reaction, chip washing, machine scanning, data extraction, and analysis. The circRNA microarray analysis process involved in the present invention is to extract cardiac tissue RNA and entrust Shanghai Shupu Biotechnology Co., Ltd. to perform subsequent analysis. The analysis results are shown in the figure. Figure 1 As shown in A, the results showed that after 4 weeks of TAC, circSlc8a1, circMyom2 and circSamd4 were the three most significantly upregulated circRNAs.

[0053] (3) Cellular distribution of circSamd4: The two main cell types in myocardial tissue (primary cardiomyocytes and cardiac fibroblasts) were isolated, and then RT-qPCR was used to detect its expression in the two cells.

[0054] Isolation and culture of cardiac fibroblasts: The present invention uses C57BL / 6 suckling mice (0-1d) to isolate cardiac fibroblasts using the differential adhesion method. Quickly soak the suckling mice in 75% alcohol, hold the skin on the back of the suckling mice's neck with your left hand to fully expose the chest, use straight scissors in your right hand to cut the sternum horizontally, remove the heart, put it in a culture dish containing PBS, and place it on ice. Gently squeeze out the remaining blood in the heart, wash it with PBS twice, add 0.25% pancreatic enzyme, and cut the heart into 1mm 3 About tissue blocks. Place the tissue fragments in a 50mL centrifuge tube, add 0.25% trypsin, and put it in a shaker to digest for 3 hours at 30rpm / min (4°C). After 3 hours, remove the centrifuge tube, terminate the digestion with a complete medium containing 10% fetal bovine serum, and suck the tissue mass in the tube into another new 50mL centrifuge tube, add type II collagenase digestion solution (1.5mg / mL) prepared with L15 medium, place it at 37°C for 30min of rotation digestion, then blow and mix with a Pasteur pipette and let it stand, collect the supernatant containing cell digestion solution to terminate digestion. Continue to digest the remaining precipitated tissue blocks with type II collagenase digestion solution for 30min until there are no tissue blocks visible to the naked eye. Then filter all cell suspensions with a 70μm filter, centrifuge at 400g for 5min, discard the supernatant, and collect the cells. Resuspend the cells with complete medium, and plant the cells in a T25 cell culture flask and place them in a 37°C, 5% CO2 incubator for culture. After 30-45 minutes, most of the adherent cells are cardiac fibroblasts, and those that are temporarily not adherent are cardiac myocytes. At this time, the differential adhesion method is used to culture the two types of cells.

[0055] (4) Extract RNA according to the instructions of the kit (Accurate Biotechnology, AG21024), perform reverse transcription reaction and RT-qPCR, and detect the expression of related genes. The specific steps are as follows:

[0056] The reverse transcription reaction system is as follows: 5×Reverse Transcripition buffer (4μL), Primer Mix (1μL), RT Enzyme Mix (1μL), RNA and RNAase free Water (14μL), the sequence of the upstream primer for PCR of circSamd4 is as follows: CTGGGATTTGCATCAGTGCC (SEQ ID NO: 3), and the sequence of the downstream primer is as follows: TACTCTGCTTTCGCGTCGAG (SEQ ID NO: 4); the sequence of the upstream primer of circSlc8a1 is as follows: TCTGGAGCTCGAGGAAATGT (SEQ ID NO: 5), and the downstream primer is as follows: TTGGGTGGGAGACTTAATCG (SEQID NO: 6); the sequence of the upstream primer of circMyom2 is as follows: GACCCTGTTGACCTCAGAAGA (SEQ ID NO: 7): the downstream primer is as follows: CGACCAGGGACATCTTGAGT (SEQ ID NO: 8). The PCR amplification reaction system consisted of the following components: SYBR Green Real time PCR Master Mix (10 μL), upstream primer (10 μM, 1 μL); downstream primer (10 μM, 1 μL), cDNA and RNAase free Water (8 μL); PCR reaction procedure was: pre-denaturation (95°C, 2 min); amplification reaction (95°C, 10 s; 59°C, 10 s; 72°C, 15 s), 40 cycles; melting curve analysis (65-95°C). The results showed that circSamd4 was mainly located in cardiac fibroblasts, while the other two circRNAs were mainly located in cardiac myocytes ( Figure 1 B), fibroblast activation is a major event in myocardial fibrosis, so we focused on circSamd4.

[0057] Function in fibroblast activation and myocardial fibrosis. We also further isolated cardiac fibroblasts from mice after TAC and further confirmed that circSamd4 was significantly upregulated in cardiac fibroblasts after 4 weeks of TAC compared with the Sham group ( Figure 1 C).

[0058] Example 2 In vitro experiments to verify the function of circSamd4

[0059] The present invention designs and synthesizes small interfering RNA (siRNA), and transfects si-circSamd4 into cardiac fibroblasts to study the effect of circSamd4 on fibroblast activation. The sequence of si-circSamd4 is as follows: GCACGAGAATCATTAACCA (SEQ ID NO: 9).

[0060] (1) siRNA transfection of cardiac fibroblasts: When the cell density needs to reach about 60%, use the transfection reagent RNAiMAX to transfect si-NC and si-circSamd4 into cardiac fibroblasts. The siRNA transfection concentration used is 50nM. Before transfecting siRNA and conducting functional experiments on cells, RT-qPCR is used to detect the knockdown efficiency of si-circSamd4. The specific groups are ① negative control (si-NC) group: transfection with negative control siRNA; ② specific knockdown circSamd4 (si-circSamd4) group: transfection with si-circSamd4 target sequence. Liposome transfection is used for transfection, using RNAiMAX is used as a transfection reagent for transfection. Before transfection, replace the culture medium in the cell culture plate with fresh culture medium. The volume is the regular volume minus the volume of transfection medium. The specific steps for adding transfection medium are as follows: Dilute RNAiMAX and siRNA in culture medium respectively; mix RNAiMAX dilution with siRNA / miRNA mimics at a ratio of 1:1 and incubate at room temperature for 5 minutes; add the mixture dropwise to the cell culture medium and shake gently to mix. Continue to culture cells, and detect knockdown efficiency after 24 hours or proceed to the next step of cell treatment.

[0061] The results showed that the siRNA sequence of SEQ ID NO: 9 had high efficiency in knocking down circSamd4 and did not change the expression of its source gene ( Figure 2 A).

[0062] After confirming the knockdown efficiency of the target sequence, the cell function experiment of si-circSamd4 was carried out and the groups were as follows: ① Negative control (si-NC) group: transfection with negative control siRNA; ② si-NC+TGF-β1 stimulation (si-NC+T) group: transfection with negative control siRNA for 24 hours and then TGF-β1 stimulation for 24 hours; ③ Specific knockdown of circSamd4 (si-circSamd4) group: transfection with si-circSamd4 target sequence to illustrate whether the transfected target sequence affects the physiological condition of the cells; ④ si-circSamd4+TGF-β1 stimulation (si-circSamd4+T) group: transfection with si-circSamd4 target sequence for 24 hours and then TGF-β1 stimulation for 24 hours to illustrate the effect of the target gene on the pathological process of the cells.

[0063] (2) Detection of fibroblast activation marker expression. After the cells were transfected with siRNA and stimulated with TGF-β1, the cells were collected to extract total RNA, and reverse transcription reaction and RT-qPCR were performed to detect the gene expression of fibroblast activation markers. The primers of fibroblast activation marker genes used in the present invention are as follows: Ccn2 upstream primer sequence: GGACACCTAAAATCGCCAAGC (SEQ ID NO: 10), Ccn2 downstream primer sequence: ACTTAGCCCTGTATGTCTTCACA (SEQ ID NO: 11), Postn upstream primer sequence: TGGTATCAAGGTGCTATCTGCG (SEQ ID NO: 12), Postn downstream primer sequence: AATGCCCCAGCGTGCCATAA (SEQ ID NO: 13); internal reference gene Gapdh upstream primer sequence: CCTCGTCCCGTAGACAAAATG (SEQ ID NO: 14), Gapdh downstream primer sequence: TGAGGTCAATGAAGGGGTCGT (SEQ ID NO: 15).

[0064] The results are as follows Figure 2 As shown in B, knockdown of circSamd4 significantly reduced the expression of Ccn2 and Postn genes increased by TGF-β1 stimulation, indicating that knockdown of circSamd4 can reduce the expression of cardiac fibroblast activation marker genes to a certain extent.

[0065] (3) Immunofluorescence staining: After the cells were transfected with siRNA and stimulated with TGF-β1, immunofluorescence staining of fibroblasts was performed according to the following steps to observe the activation of cells: discard the cell culture medium, gently rinse the cells twice with room temperature PBS buffer, add 4% paraformaldehyde to fix the cells, and fix them at room temperature for 15 minutes. After fixation, add PBS buffer and rinse at low speed on a shaker for 3 times, each time for 5 minutes. Prepare 0.5% Triton X-100 cell permeabilization solution and permeabilize the cells at room temperature for 10 minutes. Add PBS buffer and rinse at low speed on a shaker for 3 times, each time for 5 minutes. Add 0.1% BSA blocking solution and block at room temperature for 30 minutes. After blocking, start incubating the primary antibody, add the primary antibody diluted in antibody diluent (α-SMA ratio is 1:200), and incubate overnight at 4°C. The next day, recover the primary antibody, rinse three times with PBS buffer, and then start incubating with the secondary antibody. The ratio of the secondary antibody is 1:400. Choose 488 or 594 fluorescent secondary antibody according to the purpose of the experiment, and incubate at room temperature for 2 hours. Rinse three times with PBS buffer, 5 minutes each time. Add DAPI staining solution to counterstain the cell nucleus. DAPI is prepared with PBS (1:200) and incubate at room temperature for 5-10 minutes. Rinse three times with PBS buffer, 5 minutes each time, and finally add PBS for storage. Image acquisition: Observe and collect images with a fluorescence microscope or confocal microscope, and then analyze the images with Image J. The results are shown in the figure. Figure 2 As shown in C, knockdown of circSamd4 significantly reduced the increase in α-SMA fluorescence intensity caused by TGF-β1 stimulation, indicating that knockdown of circSamd4 can reduce the expression of marker proteins of cardiac fibroblast activation to a certain extent.

[0066] Example 3 In vivo experiments in mice to verify the function of circSamd4

[0067] An adeno-associated virus carrying the Periostin promoter to target fibroblasts and knock down circSamd4 was constructed, and Shanghai Jikai Gene Chemistry Technology Co., Ltd. was commissioned to construct and package it. Among them, the knockdown target sequence is GCACGAGAATCATTAACCA (SEQ ID NO: 16), and the two designed oligos are ACCGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 17) and AGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCCTCGAGGGT (SEQ ID NO: 18) to form a double strand and be connected to the viral vector. The name of the viral vector is GV733, the element sequence is: Periostin-EGFP-MIR155 (MCS)-SV40 PolyA, and the negative control virus insertion sequence is TTCTCCGAACGTGTCACGT (SEQ ID NO: 19). The vector map of AAV is shown in Figure 3 As shown. According to the method in Example 1, a mouse model of myocardial fibrosis caused by pressure overload was constructed. In the first week after TAC surgery, the mice in the TAC group were randomly divided into two groups and injected with negative control adeno-associated virus and adeno-associated virus that specifically knocked down circSamd4 through tail vein injection, respectively. The Sham group was given negative control adeno-associated virus, and the virus injection titer for each mouse was 5×10 11 vg. The mice were kept as usual until the fourth week, when they were examined by ultrasound and samples were collected.

[0068] (1) Observation of cardiac structure and evaluation of cardiac function after TAC surgery in mice: Adeno-associated virus treatment was given to mice 1 week after surgery, and echocardiography was performed on the mice in the 4th week to observe their cardiac structure and obtain their cardiac function indicators. The specific operation is as follows: Before the ultrasound examination, the mice were anesthetized by isoflurane inhalation (2.5% concentration for induction and 1% concentration for maintenance). The anesthetized mice were fixed in a supine position on the monitoring table, and the chest hair of the mice was removed with a depilatory cream to fully expose the thorax. The heart rate of the mice was maintained at 400-500 beats / min during the ultrasound examination. The 3100 small animal high-frequency ultrasound imaging system was used with the MX400 probe (30MHz). After continuous observation of several cardiac cycles in the long-axis section and the short-axis section, the echocardiographic images were acquired using the grayscale mode (B mode) and the motion mode (M mode). Note that the left ventricular outflow tract must be unobstructed in the long-axis section and at the same level as the apex of the heart. When turning to the short-axis section, the papillary muscles must be clearly observed and the maximum cavity surface must be obtained. After obtaining the echocardiogram, the Vevo LAB 5.5.1 software was used to analyze the image and calculate the EF and FS to evaluate the cardiac function of the mouse. The results are shown in Figure 2. Figure 4As shown in BC, the results showed that knocking down circSamd4 in animals significantly increased the EF and FS values, indicating that knocking down circSamd4 significantly improved the deterioration of cardiac function caused by TAC.

[0069] (2) Knockdown efficiency detection: RNA was extracted from mouse hearts, and reverse transcription and RT-qPCR were performed to detect the expression of circSamd4 in the hearts of mice in each group. The upstream and downstream primer sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. The test results are shown in Figure 4 As shown in A, the results show that the efficiency of AAV-sh-circSamd4 for circSamd4 in mice is about 50%, and AAV-sh-circSamd4 does not change the expression of its source gene Samd4.

[0070] (3) Detection of gene expression of cardiac fibrosis markers: RNA was extracted from mouse hearts, and the expression of Ccn2 and Postn in the hearts of each group of mice was detected by reverse transcription reaction and RT-qPCR. The upstream and downstream primer sequences of Ccn2 are shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively; the upstream and downstream primer sequences of Postn are shown in SEQ ID NO: 12 and SEQ ID NO: 13, respectively. The test results are shown in Figure 4 As shown in D, the results showed that the expression of Ccn2 and Postn in the TAC+AAV-sh-circSamd4 group was significantly lower than that in the TAC+AAV-sh-Ctrl group, indicating that knockdown of circSamd4 in vivo significantly reduced the increased gene expression of fibrosis markers caused by TAC.

[0071] (4) Masson staining of cardiac tissue to assess the degree of cardiac fibrosis. After the ultrasound examination, the mice were euthanized, the chest cavity was opened and the heart was removed. The heart was placed on ice and washed with PBS buffer. After the heart tissue was fixed for 24 hours, it was routinely dehydrated, transparent, paraffin-embedded, and sliced. The slices were routinely dewaxed to water, stained with the prepared Weigert iron hematoxylin staining solution, differentiated with acid ethanol differentiation solution, re-blued with Masson blueing solution, and stained with Ponceau fuchsin staining solution. Washing was required between each staining. After Ponceau fuchsin staining, the slices were washed with weak acid working solution (the ratio of weak acid working solution was distilled water: weak acid solution = 2:1), then washed with phosphomolybdic acid solution, and then directly placed in aniline blue staining solution for staining. After washing with the prepared weak acid working solution, the slices were quickly dehydrated with 95% ethanol, and then dehydrated with anhydrous ethanol for 3 times. Finally, they were transparentized with xylene for 3 times and sealed with neutral gum. After staining, the slices were scanned. After obtaining the scanned images, Image J software was used to analyze the myocardial collagen deposition.

[0072] The results are as follows Figure 4As shown in E, the results show that knocking down circSamd4 in animals significantly reduced the area of ​​cardiac fibrosis, which indicates that knocking down circSamd4 significantly reduced TAC-induced cardiac fibrosis.

Claims

1. A myocardial fibrosis-related circSamd4, characterized in that: The nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:

2.

2. Use of the myocardial fibrosis-related circSamd4 according to claim 1 in the preparation of a drug for treating myocardial fibrosis.

3. A vector for reducing the expression of circSamd4 associated with myocardial fibrosis according to claim 1.

4. The carrier according to claim 3, characterized in that: The vector is a viral vector; preferably an adeno-associated viral vector; more preferably GV733.

5. The carrier according to claim 4, characterized in that: The sequence of constructing the vector is: Periostin-EGFP-MIR155(MCS)-SV40 PolyA.

6. The carrier according to claim 5, characterized in that: The target gene nucleotide sequence of the vector is SEQ ID NO: 16, and the two oligonucleotide sequences designed for knocking down circSamd4 are SEQ ID NO: 17 and SEQ ID NO: 18, respectively.

7. A host cell comprising the vector according to any one of claims 3 to 6.

8. Use of the vector for reducing circSamd4 expression according to any one of claims 3 to 6 and the host cell according to claim 7 in the preparation of a drug for treating myocardial fibrosis.

9. The use according to claim 8, characterized in that: The myocardial fibrosis is myocardial fibrosis induced by pressure overload.

10. The use according to claim 8, characterized in that: The myocardial fibrosis includes impaired cardiac contractile function or inhibition of myocardial fibroblast activation.

Images