Tobacco ap2 transcription factor toe3 and use thereof
By cloning and overexpressing the tobacco AP2 transcription factor TOE3, the expression of NtMLP43 was enhanced, solving the problems of toxicity and environmental pollution of chemical pesticides in the control of tobacco viruses. This achieved highly efficient resistance to TMV, CMV and ChiVMV, promoting environmental safety and sustainable development.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SICHUAN UNIV
- Filing Date
- 2024-07-05
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies for controlling tobacco viruses using chemical pesticides are highly toxic, leave residues that pollute the environment, are harmful to humans and animals, and long-term use can lead to the development of pesticide resistance in plants.
The transcription factor TOE3 of tobacco AP2 was cloned, and the expression of the antiviral-related gene NtMLP43 was enhanced by constructing an overexpression vector, thereby improving the resistance of tobacco to TMV, CMV and ChiVMV.
It enhances tobacco's resistance to TMV, CMV, and ChiVMV, reduces the use of chemical pesticides, protects environmental safety, and prevents the development of plant resistance.
Smart Images

Figure CN119162190B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to a tobacco AP2 transcription factor TOE3 and its applications. Background Technology
[0002] Tobacco mosaic virus (TMV) is a single-stranded, positive-sense RNA virus with multiple hosts and a wide distribution, making it one of the most economically important plant viruses. In tobacco-growing areas, tobacco and other Solanaceae plants are susceptible to infection and damage by this virus. After infecting plants, TMV rapidly multiplies and spreads to any part of the plant except the growing point, causing phenotypes such as yellowing leaves, malformed leaf growth, mottling and staining of infected leaves, and typical mosaic symptoms on the systemic leaves of the plant. Large-scale outbreaks of TMV can severely impact the yield and varieties of cash crops, causing huge economic losses.
[0003] Cucumber mosaic virus (CMV), belonging to the family Bromoviridae and the genus Cucumovirus, is one of the world's most important plant viruses. Current research indicates that CMV can infect not only Cucurbitaceae plants but also over 1200 species of monocotyledonous and dicotyledonous plants, including those in the Brassicaceae, Solanaceae, and Leguminosae families. Infected plants commonly exhibit symptoms such as chlorosis, yellowing, wrinkling, and malformation, severely impacting crop growth and development and causing significant losses in crop production. Therefore, CMV is listed as one of the ten most destructive agricultural viruses.
[0004] Chili veinal mottle virus (ChiVMV) is a potato virus belonging to the genus PotatoY that seriously damages crops such as tobacco, chili peppers, and tomatoes. After infecting plants, it produces symptoms such as necrotic spots and chlorotic mottling, causing serious losses to the quality and yield of cash crops and to farmers, and seriously threatening the development of the agricultural economy.
[0005] Therefore, studying the broad-spectrum resistance of TOE3 to TMV, CMV and ChiVMV, revealing plant defense responses and disease resistance strategies, and providing scientific support for sustainable agricultural development has significant practical value.
[0006] Currently, existing technologies using chemical pesticides for tobacco control suffer from high toxicity, leave residues that pollute the environment, and are harmful to humans and animals. Continued use can also lead to pesticide resistance in plants. Therefore, clarifying the mechanisms of tobacco's antiviral activity and cloning related disease-resistant genes are increasingly being applied to virus control, which is of great significance for the sustainable development of the tobacco industry and environmental safety.
[0007] Therefore, the present invention aims to provide an AP2 transcription factor TOE3 and its application to solve the problems of existing chemical pesticides having high toxicity to TMV, CMV and ChiVMV, easy residue pollution of the environment, harm to humans and animals, and continuous use leading to the development of pesticide resistance in plants. Summary of the Invention
[0008] The purpose of this invention is to solve the above-mentioned problems and provide a tobacco AP2 transcription factor TOE3 and its applications.
[0009] To achieve the above objectives, the technical solution of the present invention is as follows:
[0010] This invention provides a tobacco AP2 transcription factor TOE3, wherein the AP2 transcription factor TOE3 is a gene TOE3 derived from common tobacco NC89, and its nucleotide sequence is shown in SEQ ID NO: 1; the amino acid sequence of the protein TOE3 encoded by the gene TOE3 is shown in SEQ ID NO: 2.
[0011] This invention also provides an application of the tobacco AP2 transcription factor TOE3, wherein the gene TOE3 regulates the antiviral-related gene NtMLP43 and enhances the expression of the antiviral-related gene NtMLP43.
[0012] Furthermore, the method by which the gene TOE3 regulates the expression of the antiviral-related gene NtMLP43 is as follows:
[0013] An overexpression vector for TOE3 was constructed. The full-length TOE3 gene was inserted forward into the restriction sites BamHI and KpnI of the PCM1307 vector. The resulting overexpression vector was then introduced into NC89 tobacco.
[0014] Furthermore, the TOE3 overexpression vector is used in tobacco anti-TMV.
[0015] Compared with existing technologies, the beneficial effects of this solution are:
[0016] 1. The present invention clones a regulatory factor TOE3 of the tobacco disease resistance gene NtMLP43 from ordinary tobacco NC89. TOE3 enhances the expression of NtMLP43 and encodes the protein TOE3. TOE3 can be used for genetic engineering to resist disease. Its nucleotide sequence is inserted into the overexpression vector PCM1307, and the resulting overexpression vector is introduced into ordinary tobacco NC89, which can improve the resistance of ordinary tobacco NC89 to TMV, CMV, and ChiVMV.
[0017] 2. This invention overcomes the problems of existing technologies that use chemical pesticides for control, such as high toxicity, easy residue pollution of the environment, harm to humans and animals, and the development of pesticide resistance in plants with continuous use. Applying the solution of this invention to the control of tobacco viruses is of great significance for sustainable development and environmental safety. Attached Figure Description
[0018] Figure 1 This is a real-time quantitative qRT-PCR analysis of TOE3 in various tissues of tobacco in this embodiment of the invention (X-axis: roots, stems, lower leaves and upper leaves represent different tissues of tobacco, namely roots, stems, lower leaves and upper leaves respectively; Y-axis: the fold increase in the expression level of TOE3 in different tissues of tobacco).
[0019] Figure 2 This is a construction map of the TOE3 overexpression vector in an embodiment of the present invention;
[0020] Figure 3 This is an identification diagram of the T0 generation positive transgenic plant of common tobacco NC89 transformed by the PCM1307-TOE3 overexpression vector in this embodiment of the invention;
[0021] Figure 4 In this embodiment of the invention, T1 generation positive transgenic plants of common tobacco NC89 transformed by PCM1307-TOE3 overexpression vector were inoculated with TMV, where (a) is the phenotypic diagram after inoculation and (b) is the detection of virus accumulation.
[0022] Figure 5 In this embodiment of the invention, T1 generation positive transgenic plants of common tobacco NC89 transformed by PCM1307-TOE3 overexpression vector were inoculated with CMV, where Figure (a) is the phenotypic diagram after inoculation and (b) is the detection of virus accumulation.
[0023] Figure 6 In this embodiment of the invention, T1 generation positive transgenic plants of common tobacco NC89 transformed with PCM1307-TOE3 overexpression vector were inoculated with ChiVMV. Figure (a) shows the phenotype after inoculation, and (b) shows the detection of virus accumulation. Detailed Implementation
[0024] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be described in further detail below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.
[0025] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the embodiments.
[0026] Example:
[0027] The inventors of this application used ordinary smoke (Nicotiana tabacum cv.NC89) at an optical density of 60 μM m -2 s -1 The plants were cultured under conditions of a 12-hour light / 12-hour dark photoperiod and a growth temperature of 24°C. The inventors of this application discovered that the AP2 transcription factor TOE3 is expressed in all parts of the plant tissues, with the highest expression level in the upper leaves. Dual-luciferase complementation experiments revealed an interaction between AP2 transcription factor TOE3 and its regulator MLP43, enhancing MLP43 expression. Using Agrobacterium-mediated genetic transformation, the overexpression vector PCM1307-TOE3 was transformed into common tobacco NC89 to obtain transgenic TOE3-overexpressing positive plants. Molecular identification and resistance identification results showed that the overexpressing TOE3 plants exhibited enhanced resistance to TMV, CMV, and ChiVMV, indicating that this gene plays a positive regulatory role in tobacco resistance to TMV, CMV, and ChiVMV. The invention will be described in detail below with reference to specific examples.
[0028] Example 1: Cloning the TOE3 gene
[0029] Total RNA was extracted from the sample leaves using TRIZOL (Invitrogen). III. First Strand cDNA Synthesis SuperMix for qPCR (YEASEN) The first strand of cDNA was synthesized using reverse transcription to obtain the cDNA from the sample. A 1518 bp nucleotide sequence encoding 515 amino acids was obtained via BLAST using the NCBI website; this gene was named TOE3. Specific primers were designed based on the nucleotide sequence.
[0030] F1 (ATGGAGTGTAGAGAAATGTG) and
[0031] R1(CTAGTCTATCTGCTGGGGGGA);
[0032] Obtain the TOE3 fragment.
[0033] Example 2: Tissue-specific expression characteristics of TOE3
[0034] Common tobacco seeds were sown in nutrient soil and germinated. Once the seedlings showed signs of germination, they were transplanted into flowerpots. When the common tobacco seedlings reached 5 weeks of age, seedlings of uniform size and growth were selected. Root, stem, lower leaf, and upper leaf tissues were collected and stored at -80℃ for later use. Total RNA was extracted from the leaf samples and reverse transcribed to obtain cDNA.
[0035] The F2 primer (AGGTCTAGGAGCTCACAGTA) and R2 primer (AGCACATGCACAAATTCTTC), which specifically amplify TOE3, were used to perform qRT-PCR analysis on this gene in various tobacco tissue samples. The qRT-PCR reaction was performed on a Q-PCR instrument. A 20 μL reaction mixture contained 2 μL cDNA and 10 μL Hieff. Universal BlueqPCR SYBR Green Master Mix (YEASEN), 0.5 μL primer F1 and 0.5 μL primer R1. Amplification parameters: 95℃ for 2 minutes, then 95℃ for 10 seconds, 60℃ for 30 seconds, for 40 cycles. After the reaction, the relative expression level was calculated: based on the obtained Cq values, the relative expression level of the target gene at different time points after TMV infection compared to the negative control group was calculated, i.e., 2. -CT Where CT = (CT.Target - CT.Tublin) - (CT.Target - CT.Tublin). The results showed that TOE3 was expressed at the highest level in the lower leaves among all tobacco tissues.
[0036] Example 3: Construction of TOE3 overexpression vector
[0037] Using the TOE3 cDNA as a template, PCR amplification was performed using primers F1 and R1, which specifically amplify the TOE3 gene fragment. The amplified fragment was then recovered. The target fragment was inserted into the multiple cloning site between BamHI and KpnI after double digestion with BamHI and KpnI. This yielded the TOE3 gene overexpression vector PCM1307-TOE3.
[0038] Example 4: Leaf disc method-mediated transformation of stable genetic materials with TOE3 overexpression
[0039] Thaw 100 μL of Agrobacterium GV3101 competent cells on ice, then add 5 μL of ligation product, gently mix, and incubate on ice for 25 minutes. Next, rapidly freeze the mixture in liquid nitrogen for 5 minutes and quickly transfer it to a 37°C water bath for 5 minutes of heat shock. Incubate on ice for another 5 minutes. Add 500 mL of antibiotic-free LB medium to a centrifuge tube and incubate at 28°C for 2 hours. After incubation, enrich the cells at 5000 rpm, and spread an appropriate volume of the incubation solution evenly onto a medium containing the appropriate antibiotic using sterile beads. Incubate overnight in an inverted incubator at 28°C. Pick positive Agrobacterium strains and incubate them in LB medium containing the appropriate antibiotic at 28°C for approximately 12 hours. Once the bacterial culture has grown, inoculate 100 μL of the stock solution into 5 mL of LB medium containing the appropriate antibiotic and incubate at 28°C with shaking for approximately 10 hours. Wait for the bacterial culture to develop OD... 600nm When the value reaches 0.8, centrifuge at 5000 rpm for 3 minutes and resuspend the bacterial cells with infection buffer; after the prepared infection solution has been allowed to stand at room temperature for 3-4 hours, it is then infected with Agrobacterium containing the PCM1307-TOE3 vector.
[0040] Co-culture: Leaves were removed from sterile tobacco seedlings and temporarily stored in water. After enrichment with PCM1307-TOE3 positive Agrobacterium solution, the seedlings were resuspended in MS liquid medium (MS salt 1.89g; sucrose 8g; H2O to 400mL, then pH adjusted to 5.8 with NaOH). Small pieces of the leaves were then inoculated into the resuspended leaves for 5-10 minutes. Excess bacterial solution was blotted off with filter paper, and the seedlings were transferred to co-culture medium (MS salt 1.89g; sucrose 8g; H2O to 400mL, then pH adjusted to 5.8 with NaOH, 3g agar powder; 0.8mg 6-BA; 0.4mg NAA) and incubated in the dark for 48 hours.
[0041] Differentiation and selection: Leaves from the co-culture were transferred to differentiation and selection medium (MS salt 1.89g; sucrose 8g; H2O to 400mL, pH adjusted to 5.8 with NaOH, 3g agar powder; 0.6mg 6-BA; 0.1mg NAA). After three weeks, buds differentiated from the leaf disc edge, and complete individual buds were separated from them using tweezers.
[0042] Rooting elongation: The separated buds were transferred to elongation medium (MS salt 1.89g; sucrose 8g; H2O to 400ml, then pH adjusted to 5.8 with NaOH, and 3g agar powder; 0.04mg 6-BA; 0.1mg NAA). Rooted seedlings appeared in three to four weeks. When the plant roots were strong, the cap of the tissue culture bottle could be opened to harden the seedlings for 1-2 days. Finally, the culture medium residue attached to the roots was washed away and the seedlings were transplanted into the soil to obtain 10 transgenic materials.
[0043] Identification: Total protein was extracted from all transgenic materials to identify the expression level of TOE3. Fresh leaf tissue from Example 3 was placed in a pre-cooled mortar and ground until the tissue sample turned white; 0.1 g of the ground sample was accurately weighed and transferred to a 2 mL centrifuge tube, and an appropriate amount of 2× protein extraction buffer was added, followed by thorough mixing on a vortex mixer; the sample was then placed in a 90°C water bath for 10-15 minutes to fully denature the protein; the denatured protein sample was placed in a centrifuge and centrifuged at 8000 rpm for 10 minutes, the supernatant was carefully aspirated and transferred to a new 1.5 mL centrifuge tube, flash-frozen in liquid nitrogen, and stored at -20°C for later use;
[0044] Prepare 12% separating gel and 5% stacking gel; 12% SDS-PAGE separating gel (H2O 9.2mL; 30% polyacrylamide 5.4mL; 1.5M Tis-HCl (pH=8.8) 5mL; 10% SDS 100μL; 10% APS 100μL; TEMED 10μL); 5% SDS-PAGE stacking gel (H2O 4mL; 30% polyacrylamide 1.67mL; 0.5M Tis-HCl (pH=6.8) 622.5μL; 10% SDS 25μL; 10% APS 17μL; TEMED 6μL). After the SDS-PAGE gel has completely solidified, carefully remove the comb under running water. Then place the gel plate in the electrophoresis tank, add an appropriate amount of electrophoresis buffer, and add samples sequentially to the wells. Electrophore the protein samples at 120V for about 1-2 hours until the bromophenol blue indicator reaches the bottom of the separating gel. Then remove the glass plate and carefully pry it open to remove the stacking gel. Place the separating gel on the filter paper in the transfer clamp (note that the gel is fragile and requires careful handling). Cut a PVDF membrane of the same size as the separating gel and soak it in methanol. Place the methanol-soaked membrane on the separating gel and cover it with another layer of filter paper. Place the assembled transfer clamp in the electrophoresis tank and perform electrophoresis according to the principle of "gel negative, membrane positive". The electrophoresis time is 80V for about 2 hours, and the transfer process should be performed on ice. Place the PVDF membrane in 25mL of blocking buffer (NO-fat Milk 2.5g; TBST). Add 50 mL of the solution to the primary antibody and block on a shaker for about 2 hours. After blocking, place the membrane in the primary antibody dilution buffer and hybridize at room temperature for 2 hours. After primary antibody binding, wash the membrane with TBST (1 M Tris-HCl (pH = 8.0) 20 mL; NaCl 8.8 g; Tween-20 1 mL; H2O to a final volume of 1 L) elution buffer, washing 4 times for 5 minutes each time. Place the washed PVDF membrane in the secondary antibody dilution buffer and hybridize at room temperature for 1-2 hours. After secondary antibody binding, wash the membrane again with TBST elution buffer, washing 4 times for 5 minutes each time. TMThe ECL chemiluminescent solution was mixed with solution A in a 1:1 ratio with solution B; the developer was evenly applied to the membrane, and the membrane was placed on a gel imaging system for exposure; the development results were saved for analysis.
[0045] Example 5: Verification of the gene function of TOE3
[0046] Three positive plants were selected based on Western blot results, with the strain numbers WT, TOE3-OE#4, and TOE3-OE#5. WT, TOE3-OE#4, and TOE3-OE#5 were sown respectively. The results showed that on day 28 after TMV inoculation, the WT material was the first to exhibit yellowing symptoms, while the yellowing symptoms in TOE3-OE#4 and TOE3-OE#5 were weaker, indicating that the TOE3-OE plants had stronger antiviral capabilities and could recover from TMV infection more quickly. Total protein was extracted from the plants, and the TMV content in the leaves was measured. The results showed that the TMV content in TOE3-OE#4 and TOE3-OE#5 was lower than that in WT.
[0047] On day 7 post-CMV inoculation, the WT material was the first to exhibit mosaic symptoms, while TOE3-OE#4 and TOE3-OE#5 were largely asymptomatic. Furthermore, on day 28 post-CMV inoculation, TOE3-OE#4 and TOE3-OE#5 transgenic materials showed abundant green island tissue, while the WT material exhibited more yellowing tissue, indicating that TOE3-OE plants have stronger antiviral capabilities and are less affected by CMV infection. Total protein was extracted from the plants, and the CMV content in the leaves was measured. The results showed that the CMV content in TOE3-OE#4 and TOE3-OE#5 was lower than that in WT.
[0048] On day 7 after ChiVMV inoculation, WT materials were the first to show necrotic spots, while TOE3-OE#4 and TOE3-OE#5 showed no obvious symptoms. Furthermore, on day 28 after ChiVMV inoculation, WT materials exhibited significant yellowing, indicating that TOE3-OE plants had stronger antiviral capabilities and were less affected by ChiVMV infection. Total protein was extracted from the plants, and the ChiVMV content in the leaves was measured. The results showed that the ChiVMV content in TOE3-OE#4 and TOE3-OE#5 was lower than that in WT.
[0049] In summary, through the above embodiments of the present invention, a regulatory factor TOE3 of the tobacco disease resistance gene NtMLP43 was cloned from common tobacco NC89. TOE3 interacts with NtMLP43 and encodes the protein TOE3. TOE3 can be used for genetic engineering to control disease. Its nucleotide sequence was inserted into the overexpression vector PCM1307, and the resulting overexpression vector was introduced into common tobacco NC89, which improved the resistance of common tobacco NC89 to TMV, CMV, and ChiVMV. The solution of the present invention overcomes the problems of existing technologies that use chemical pesticides for disease control, such as high toxicity, easy residue pollution of the environment, harm to humans and animals, and the development of pesticide resistance in plants with continuous use. It can be applied to the field of tobacco virus control and has important significance for sustainable development and environmental safety.
[0050] The above specific embodiments are merely explanations of the present invention and are not intended to limit the present invention. After reading this specification, those skilled in the art can make modifications to these embodiments without contributing any inventive step, but as long as they are within the scope of the claims of the present invention, they are protected by patent law.
Claims
1. The application of a tobacco AP2 transcription factor TOE3 in enhancing tobacco resistance to tobacco viruses, characterized by: The tobacco AP2 transcription factor TOE3 is a gene. TOE3 The gene TOE3 From Nicotiana tabacum cv. NC89, whose nucleotide sequence is shown in SEQ ID NO: 1; the gene TOE3 The amino acid sequence of the encoded protein TOE3 is shown in SEQ ID NO: 2; The tobacco viruses mentioned are: Tobacco Mosaic Virus (TMV), Cucumber Mosaic Virus (CMV), and Pepper Vein Mottle Virus (ChiVMV).
2. The application of the tobacco AP2 transcription factor TOE3 as described in claim 1 in improving tobacco resistance to tobacco viruses, characterized in that: By constructing an overexpression vector containing SEQ ID NO:1 and introducing the vector into common tobacco NC89, transgenic plants with enhanced resistance to TMV, CMV and ChiVMV can be obtained.
3. The application of the tobacco AP2 transcription factor TOE3 as described in claim 2 in improving tobacco resistance to tobacco viruses, characterized in that: The overexpression vector is used to... TOE3 The full-length gene is inserted forward into the restriction sites of the PCM1307 vector. Bam HI and Kpn The carrier constructed between I.
4. The application of the tobacco AP2 transcription factor TOE3 as described in claim 3 in improving tobacco resistance to tobacco viruses, characterized in that: Application of transgenic tobacco plants containing the overexpression vector in resistance to TMV, CMV and ChiVMV.