Fresh seed of rice panicle germination of osrdr3 gene and its in del marker and application
By using the OsRDR3 gene and its InDel marker, the problem of rice panicle germination was solved, and the rice variety's resistance to panicle germination was significantly improved, thereby increasing rice yield and quality.
Patent Information
- Application Number
- CN202411555191.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-04
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2044-11-04
AI Technical Summary
Existing technologies cannot effectively solve the problem of rice panicle germination, especially in high temperature and high humidity environments, which leads to a reduction in rice yield and quality. Furthermore, traditional methods such as the application of gibberellin have not been able to completely solve the occurrence and severity of panicle germination.
The OsRDR3 gene and its InDel marker in fresh rice seeds were used to improve the germination level and reduce germination resistance by deleting the OsRDR3 gene. PCR amplification and agarose gel electrophoresis were performed using the ZIRDR3-F/R primer pair to identify the germination resistance/susceptibility of rice seeds, thus aiding in breeding.
It significantly improves the resistance to panicle germination in rice, and enables the selection of varieties with significantly improved resistance to panicle germination through molecular marker-assisted screening, reducing the sensitivity of rice to high temperature and high humidity environments and improving rice yield and quality.
Smart Images
Figure CN119162200B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetics and breeding technology, specifically to a method for preventing fresh rice seeds from sprouting during panicle heading. OsRDR3 Genes and their InDel markers and applications. Background Technology
[0002] In rice-growing areas of southern my country, high temperatures and humidity during rice ripening easily trigger panicle sprouting, reducing rice yield and quality and causing significant economic losses. Furthermore, the application of gibberellin in hybrid rice seed production to address necking in sterile lines also exacerbates the incidence and severity of panicle sprouting. During rice domestication and breeding, the selection of rapid and uniform germination characteristics has also led to reduced seed dormancy, thus increasing rice's sensitivity to panicle sprouting.
[0003] Rice panicle germination is influenced by both intrinsic factors (such as maturity, seed morphology, and biochemical composition) and external environmental factors (temperature, humidity, and light) of different varieties, and is a complex quantitative trait controlled by multiple genes. To date, several QTLs / genes related to panicle germination have been located and cloned. OsVP1 , Sdr4 , GA2ox9 , miR156 , SD6 While these genes exist, they cannot completely solve the problem of panicle sprouting resistance in rice. Therefore, finding new panicle sprouting resistance genes and analyzing their functions is a crucial foundation for breeding panicle sprouting resistant varieties. Summary of the Invention
[0004] To overcome the shortcomings of existing technologies, the purpose of this invention is to provide a method for preventing fresh rice seeds from sprouting during panicle panicle. OsRDR3 Genes and their InDel markers and applications.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A type of fresh rice seed resistant to panicle germination OsRDR3 Genes, the ones mentioned OsRDR3 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0007] The above OsRDR3 Application of genes in regulating the germination of fresh rice seeds.
[0008] Furthermore, missing OsRDR3 Genes enhance the germination rate of fresh rice seeds and reduce germination resistance.
[0009] The above OsRDR3 Application of genes in regulating the germination of fresh plant seeds.
[0010] Furthermore, the plant is wheat, rice, or Arabidopsis thaliana.
[0011] A primer pair using InDel markers for identifying resistance / susceptibility to germination in rice panicles, the nucleotide sequence of which is:
[0012] ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3';
[0013] ZIRDR3-R: 5'- AGAAATGGACCAGCTACCCG -3';
[0014] A kit for identifying rice panicle germination resistance / susceptibility, characterized in that the kit contains the aforementioned primer pair.
[0015] Application of the above-mentioned InDel-labeled primer pairs or the above-mentioned kit in rice anti-spillage and sprouting trait-assisted breeding.
[0016] Furthermore, the above application includes the following steps:
[0017] (1) Extract genomic DNA from the rice to be tested;
[0018] (2) Using genomic DNA as a template, PCR amplification of the genomic DNA was performed using the ZIRDR3-F / R primer pair. Rice panicle germination resistance / susceptibility analysis was conducted based on the agarose gel electrophoresis results. The nucleotide sequences of the primer pair are as follows:
[0019] ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3';
[0020] ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3'.
[0021] Furthermore, the agarose gel electrophoresis result showed that when the value was 556 bp, it indicated that the rice sample carried the virus. OsRDR3 The Nipponbare gene allele type; when the agarose gel electrophoresis result is 417bp, it indicates that the rice sample does not carry the gene. OsRDR3 Gene Japanese allele type.
[0022] The beneficial effects of this invention are as follows:
[0023] (1) This invention provides rice OsRDR3 The application of genes can enhance the rice's resistance to panicle germination.
[0024] (2) This invention provides a rice anti-sprouting gene. OsRDR3 The Indel molecular marker ZIRDR3 within the gene.
[0025] (3) Through anti-sprouting genes OsRDR3 Marker-assisted screening can yield rice varieties or lines with significantly improved resistance to pre-harvest sprouting. Attached Figure Description
[0026] Figure 1 Rice anti-sprouting gene OsRDR3 Precise positioning.
[0027] Among them: JFZ is the parent line that is susceptible to ear germination and is of good quality; NIP is the parent line that is resistant to ear germination and is of good quality; L1, L2, L3, L5-1, L5-2, L6, L7, and L8 are recombinant replacement lines.
[0028] Figure 2 : OsRDR3 Sequencing verification of gene-edited lines.
[0029] Figure 3 : OsRDR3 Spike sprouting phenotype of gene-edited lines.
[0030] Figure A shows the budding phenotype of the Nipponbare gene-edited lines rdr3-c1, rdr3-c2, and rdr3-c3; Figure B shows the budding rate of the Nipponbare gene-edited lines rdr3-c1, rdr3-c2, and rdr3-c3.
[0031] Figure 4 The amplification results of the molecular marker ZIRDR3 in resistant / susceptible budding parents, with Takara DL1000 as the marker.
[0032] Figure 5 : Sprouting performance of the wild bud B near-isogenic line resistant to ear sprouting;
[0033] in Figure 5 A shows the phenotypes of individual plants of Wild Fragrance B (left) and the disease-resistant near-isogenic line (Wild Fragrance B-RDR3, right); Figure 5 B represents the budding phenotype of wild fragrant B and the disease-resistant near-isogenic line (wild fragrant B-RDR3); Figure 5 C represents a comparison of the germination rate of spikelets between Wild Fragrance B and the disease-resistant near-isogenic line (Wild Fragrance B-RDR3). Detailed Implementation
[0034] The technical solution of the present invention will be further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments.
[0035] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.
[0036] Example 1: Rice anti-sprouting gene OsRDR3 Identification
[0037] (1) Rice anti-sprouting gene OsRDR3 fine positioning
[0038] Observations revealed significant differences in ear germination resistance between Nipponbare and Kafumi. A germination resistance locus was located using a randomized cross-pollination recombinant inbred line population constructed from Kafumi and Nipponbare. qPHS1a Furthermore, by utilizing one of the group's... qPHS1a Residual system (i.e.) qPHS1a A recombinant fragment substitution line was constructed (with heterozygous loci at one site and homozygous loci at others) to finely map the gene for resistance to pre-harvest sprouting. Results are as follows: Figure 1 As shown, anti-sprouting sites will be used. qPHS1a The gene was located in a 20kb region between molecular markers InDel14 and InDel21. A search revealed that this region contains only one gene. OsRDR3 The gene number is Os01g0197900 (NCBI number), LOC_Os01g10130 (MSU number). OsRDR3 The full length of the gene coding region CDS is 3489 bp. OsRDR3 The coding region sequence of the gene is shown in SEQ ID NO.1. Therefore, this gene serves as a site for resistance to pre-budding sprouting. qPHS1a Candidate genes.
[0039] (2) Rice anti-sprouting gene OsRDR3 Knockout verification
[0040] To clarify OsRDR3 Targeting the gene, CRISPR-GE software was used to target the Japonica rice variety Nipponbare. OsRDR3 Gene search for PAM sequences. BLAST analysis was used to select... RDR3 Preferred sequences for single-gene editing with high conservation OsRDR3 -bar2, the specific target sequence is ACTTCAAACCTTCTGAACCG. Wuhan Boyuan Biotechnology Co., Ltd. was commissioned to construct the vector pBWA(V)HU-yl- using CRISP / Cas9 technology. RDR3 Thirty-one transgenic plants were obtained by transforming Nipponbare. DNA was extracted from these transgenic plants using the Tiangen Plant Genome Extraction Kit, and hygromycin (primer: Hyg) was used for detection, identifying positive plants. Positive plants were amplified using primer R3-b2 for the gene editing target site, and the PCR products were sent to Shanghai Sangon Biotech for sequencing to determine the type of gene editing.
[0041] The sequence of sequencing primer R3-b2:
[0042] SEQ ID NO.2: R3-b2-F: 5'-ACCGCTGAAAGGATATGCAG-3';
[0043] SEQ ID NO. 3: R3-b2-R: 5'-CCTGTTTATGTTTGATCTGGAC-3'.
[0044] The results are as follows Figure 2 As shown, the sequencing results were compared with the corresponding sequence of wild-type Nipponbare, and it was found that... OsRDR3 Single-gene-edited positive seedlings OsRDR3 Differences exist at the -bar2 site, which can be divided into 3 categories: OsRDR3 The rdr3-c1 gene is deleted by 32bp. OsRDR3 The rdr3-c2 gene is deleted by 29 bp. OsRDR3 The gene is inserted into 1 bp of rdr3-c3.
[0045] (3) OsRDR3 Gene-edited lines budding phenotype
[0046] Planting Nippon Haru OsRDR3 Gene knockout lines rdr3-c1, rdr3-c2, and rdr3-c1 were used. At maturity, the whole panicle germination resistance was assessed using the whole-panicle germination method. The specific steps were as follows: First, the date was recorded and marked for each line at the beginning of heading. At grain maturity (30-35 days after heading), at least 10 panicles with the same maturity date were selected from each line, placed in soaking bags, and immediately soaked in a 28℃ incubator for 10 hours. Afterward, a 7-day germination treatment (28℃) was performed, during which the panicles were washed twice daily and dried. After germination treatment, the germination rate of each panicle was investigated.
[0047] Figure 3 The results showed OsRDR3 The germination rate of panicles in the gene knockout lines rdr3-c1, rdr3-c2, and rdr3-c1 was significantly higher than that of the wild-type Nipponbare. This indicates that... OsRDR3 Loss of function of this gene leads to decreased germination resistance in Nipponbare spikes; this gene is likely a QTL locus for germination resistance in Nipponbare spikes. qPHS1a The target gene.
[0048] Example 2: Rice anti-sprouting gene OsRDR3 Development of ZIRDR3, an intragenetic marker
[0049] Comparison with Japan Haruhi and Yokohama OsRDR3 The full-length sequence of the gene. It was found that compared to Nipponbare, Yoshifumi... OsRDR3The allele begins to delete 139bp at ATG-12248bp; the deleted sequence is shown in SEQ ID NO.4, and primers ZIRDR3 were designed on both sides of the deletion.
[0050] The sequence of primer ZIRDR3:
[0051] SEQ ID NO.5: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3';
[0052] SEQ ID NO.6: ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3';
[0053] The product of this sequence amplification of the anti-spillage and sprouting allele is 556 bp, and the nucleotide sequence is shown in SEQ ID NO.7.
[0054] The product of this sequence amplification of the budding allele type is 417 bp, and the nucleotide sequence is shown in SEQ ID NO.8.
[0055] The primers were applied to the resistant budding variety Nipponbare and the budding susceptible varieties Kafuchi, Taifeng B, Noka B, Guang 8B, Hengfeng B, Quan 9311B, Gang 46B, II-32B and Jing 4155s.
[0056] The specific steps are as follows:
[0057] (1) Genomic DNA of the above varieties was extracted using the Tiangen plant genome extraction kit;
[0058] (2) Using extracted genomic DNA as a template, PCR amplification was performed: the PCR reaction system was 20 μL, containing 2.0 μL 10× buffer, 0.3 μL 10 mM dNTP, and 2.0 μL 25 mM Mg. 2+ The following reagents were used: 2.0 μL of 4 μM forward and reverse primers (SEQ ID NO. 5 and SEQ ID NO. 6), 0.25 μL of 4 U / μL Taq enzyme, 2.0 μL of 20 ng / μL template DNA, and 11.45 μL of ultrapure water. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 minutes, followed by 35 cycles of 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, and a final extension at 72℃ for 10 minutes.
[0059] (3) Load 5 μL of the amplification product onto a 1% agar gel, electrophore for 20 minutes, and take a picture to save the electrophoresis results.
[0060] The results are as follows Figure 4As shown, the amplification product of the resistant budding variety is 556 bp; while the amplification product of the susceptible budding varieties Jiafuzhan, Taifeng B, Yexiang B, Guang 8B, Hengfeng B, Quan 9311B, Gang 46B, II-32B and Jing 4155s is 417 bp. This indicates that the molecular marker ZIRDR3 can be used to distinguish between resistant and susceptible varieties and can be used as a marker for prospective selection. The resistant budding allele of Nipponbare can be introduced into susceptible budding varieties.
[0061] Example 3: Using marker-assisted selection technology to identify rice anti-sprouting genes OsRDR3 Imported into the budding variety Wild Fragrance B
[0062] The Nipponbare (donor parent) and Nokasa B (recurrent parent) were crossbred once, backcrossed five times, and self-crossed once. The molecular marker ZIRDR3 was used for assisted selection during backcrossing and self-crossing to ultimately obtain a variety resistant to ear sprouting. OsRDR3 Near-isogenic lines of the wild fern B allele type. The specific steps are as follows:
[0063] (1) Cross Nipponbare and Noka B to obtain F1 seeds;
[0064] (2) Plant F1, and after heading, backcross with the recurrent parent, Wild Fragrance B, to obtain BC1F1 seeds;
[0065] (3) Plant BC1F1 seedlings and use the molecular marker ZIRDR3 to screen for those containing OsRDR3 Single plants. After heading, select a single plant of the recurrent parent, Wild Fragrance B, and backcross it with Wild Fragrance B to obtain BC2F1 seeds;
[0066] (4) From BC2F1 to BC5F1, the method in step (3) is used to screen for those containing OsRDR3 Single plants were backcrossed with wild jasmine B; until BC5F2 was harvested;
[0067] (5) Plant BC5F2 and screen for those containing the molecular marker ZIRDR3. OsRDR3 The homozygous single plants; when mature, fresh rice panicles are taken for panicle germination resistance identification (the specific steps are the same as step (3) in Example 1).
[0068] The results are as follows Figure 5 As shown, the germination rate of the ear of the near-isogenic line of Yexiang B resistant to ear germination (Yexiang B-RDR3) was significantly lower than that of the susceptible ear germination variety (Yexiang B) observed in Shaxian County in 2023, Hainan in 2024, and Shaxian County in 2024.
[0069] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.
Claims
1. The application of an InDel-marked primer pair for identifying rice panicle germination resistance / susceptibility, or a kit containing said primer pair, in rice panicle germination resistance / susceptibility-assisted breeding, characterized in that: The nucleic acid sequences of the primer pair are as follows: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3'; ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3'.
2. The application according to claim 1, characterized in that: Includes the following steps: (1) Extract genomic DNA from the rice to be tested; (2) Using genomic DNA as a template, PCR amplification of the genomic DNA was performed using the ZIRDR3-F / R primer pair. The rice panicle germination resistance / susceptibility was analyzed based on the agarose gel electrophoresis results. The nucleic acid sequences of the primer pair are as follows: ZIRDR3-F: 5'- TCAATTTTCTCAATATGCTTGCCA-3'; ZIRDR3-R: 5'-AGAAATGGACCAGCTACCCG-3'.
3. The application according to claim 2, characterized in that: When the agarose gel electrophoresis result is 556bp, it indicates that the rice sample carries the virus. OsRDR3 The Nipponbare gene allele type; when the agarose gel electrophoresis result is 417bp, it indicates that the rice sample does not carry the gene. OsRDR3 Gene Japanese allele type.