Application of slprr5 gene in regulating chlorophyll synthesis and photosynthetic efficiency of tomato
By constructing transgenic tomatoes with SlPRR5 gene overexpression and knockout, and using CRISPR/Cas9 technology to regulate tomato chlorophyll synthesis and photosynthetic efficiency, the unknown regulatory mechanism of the SlPRR5 gene in tomatoes was solved, and significant regulation of photosynthetic efficiency and changes in growth status were achieved.
Patent Information
- Application Number
- CN202411503257.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-25
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2044-10-25
AI Technical Summary
In the current technology, the function of the SlPRR5 gene in regulating tomato chlorophyll synthesis and photosynthetic efficiency has not been fully studied, which affects the improvement of tomato photosynthetic efficiency and yield.
By constructing transgenic tomatoes that overexpress and edit the SlPRR5 gene, and using CRISPR/Cas9 technology to knock out or overexpress the SlPRR5 gene, the chlorophyll content and photosynthetic rate of tomatoes can be regulated, thereby achieving the regulation of tomato photosynthetic efficiency.
Successfully regulating tomato chlorophyll synthesis significantly increases or decreases photosynthetic efficiency and alters plant growth status, providing technical support for plant functional gene research and agricultural breeding.
Smart Images

Figure CN119162236B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, plant physiology and molecular biology, and particularly relates to application of SlPRR5 gene in regulating chlorophyll synthesis and photosynthetic efficiency of tomato. BACKGROUND
[0002] Tomato (Solanum lycopersicum) is an important economic crop with a wide planting area worldwide, and its yield and quality are directly affected by photosynthetic efficiency. Photosynthesis is a process in which plants convert light energy into chemical energy by absorbing light, and chlorophyll is an indispensable core pigment in this process, directly participating in the capture and conversion of light energy. Therefore, the content of chlorophyll largely determines the photosynthetic efficiency and yield of plants. It is of great significance to study the mechanism of affecting tomato chlorophyll content and photosynthetic efficiency, and to excavate key genes for regulating tomato chlorophyll synthesis and improving photosynthetic efficiency, so as to promote the growth and development of tomato and improve yield. This research direction has been one of the focuses in agricultural breeding and crop improvement.
[0003] In higher plants, biological clock controls a wide range of cellular processes, such as photosynthesis and stress response. Studies have shown that PSEUDO-RESPONSE REGULATOR 5 (PRR5) directly targets genes encoding transcription factors involved in flowering time regulation, hypocotyl elongation and cold stress response by binding to target DNA in vivo through CCT motif binding, thereby affecting plant growth and development and its resistance to adversity (Norihito N, Takatoshi K, Mari K, et al. Transcriptional repressor PRR5 directly regulates clock-output pathways. PNAS, 2012, 109(42): 17123-8.).
[0004] However, so far, there has been no relevant research report on the function of SlPRR5 gene in regulating tomato chlorophyll synthesis and photosynthetic efficiency, and further exploration of its specific regulation mechanism in tomato is still needed. SUMMARY
[0005] The present application provides application of SlPRR5 gene in regulating chlorophyll synthesis and photosynthetic efficiency of tomato, aiming to regulate the chlorophyll content and photosynthetic rate of tomato by regulating the expression level of SlPRR5 gene.
[0006] The specific technical solutions are as follows:
[0007] The application of SlPRR5 gene in regulating the synthesis of chlorophyll in tomato, wherein the nucleotide sequence of the SlPRR5 gene is shown as SEQ ID NO. 1.
[0008] The application of SlPRR5 gene in regulating the photosynthetic efficiency in tomato, wherein the nucleotide sequence of the SlPRR5 gene is shown as SEQ ID NO. 1.
[0009] The amino acid sequence of the protein encoded by the SlPRR5 gene is shown as SEQ ID NO. 2. The present application finds that the SlPRR5 gene can regulate the chlorophyll content and photosynthetic rate of tomato plants, and further regulate the photosynthetic efficiency of tomato plants by constructing transgenic tomato with overexpression and gene editing of SlPRR5 gene.
[0010] Further, the application of genetically engineered bacteria in regulating the synthesis of chlorophyll and / or photosynthetic efficiency in tomato, characterized in that the genetically engineered bacteria comprises a vector for editing SlPRR5 gene; the nucleotide sequence of the SlPRR5 gene is shown as SEQ ID NO. 1; the editing includes knockout and overexpression of the gene.
[0011] Further, the regulation method is one of the following:
[0012] (1) increasing the expression level of S1PRR5 gene by gene overexpression technology, reducing the chlorophyll content and photosynthetic rate of tomato plants, and thus reducing the photosynthetic efficiency;
[0013] (2) increasing the chlorophyll content and photosynthetic rate of tomato plants by knocking out S1PRR5 gene, and thus increasing the photosynthetic efficiency.
[0014] Further, the method for constructing a mutant overexpressing SlPRR5 gene is:
[0015] (1) constructing an overexpression vector containing the CDS sequence of tomato SlPRR5 gene, wherein the CDS sequence is shown as SEQ ID NO. 3;
[0016] (2) transforming the vector into competent cells of Agrobacterium to obtain Agrobacterium containing the SlPRR5 gene overexpression vector;
[0017] (3) using the Agrobacterium to infect the cotyledon of common wild-type tomato, and obtaining seedlings by tissue culture, and screening to obtain positive transgenic plants overexpressing SlPRR5 gene.
[0018] Further, the knockout means is CRISPR / Cas9 gene editing technology.
[0019] Further, the method for knocking out SlPRR5 gene is:
[0020] (1) design two target sequences sgRNA of SlPRR5 gene, construct CRISPR / Cas9 vector for gene editing of tomato SlPRR5;
[0021] (2) transform the vector into Agrobacterium competent cells to obtain Agrobacterium of CRISPR / Cas9 vector;
[0022] (3) use Agrobacterium containing SlPRR5 gene editing vector to infect cotyledon of common wild type tomato, obtain seedlings by tissue culture, and screen mutant plants with SlPRR5 gene deletion.
[0023] Further, the vector is pAC004-HA with 35S promoter; and the host cell is Agrobacterium GV3101.
[0024] Further, in step (1), the two target sequences sgRNA are shown as SEQ ID NO. 4 and SEQ ID NO. 5.
[0025] Compared with the prior art, the present application has the following beneficial effects:
[0026] (1) The transgenic tomato plants with overexpression and gene knockout of SlPRR5 gene are obtained by the present application, and by observing the chlorophyll content and photosynthetic capacity of tomato, it is found that SlPRR5 gene can effectively regulate the synthesis of chlorophyll of tomato and significantly regulate the photosynthetic efficiency of tomato plants, so as to change the growth state of the plants.
[0027] (2) The present application successfully realizes the targeted regulation of SlPRR5 gene by CRISPR / Cas9 gene editing technology and Agrobacterium-mediated transgenic technology. These methods not only have high efficiency and precision, but also can be applied to the improvement of other crops, and provide important technical support for plant functional gene research and agricultural breeding. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 Gene editing site and amino acid change of homozygous mutant plant of SlPRR5 gene in Example 1;
[0029] Wherein, WT is common wild type tomato variety Condine Red, prr5-2# and prr5-9# are two strains of SlPRR5 gene knockout mutants, the prr5-2# strain has an insertion of 1 base at the gene editing target site, resulting in premature termination of translation; the prr5-9# strain has a deletion of 1 base at the gene editing target site, also resulting in premature termination of translation.
[0030] Figure 2The results of Western Blot and gene expression detection of the transgenic protein in the SlPRR5 gene overexpression tomato lines in Example 2; wherein A is the level of SlPRR5 protein content, and B is the level of SlPRR5 gene expression;
[0031] Figure 3 The chlorophyll content and phenotype of wild type tomato plants, SlPRR5 gene knockout mutants and SlPRR5 gene overexpression plants in Example 3; wherein A is the leaf color phenotype of the plants, and B is the chlorophyll content of the plants; WT is the wild type tomato; prr5-2# and prr5-9# are SlPRR5 gene knockout mutants; OE-SlPRR5-8# and OE-SlPRR5-14# are SlPRR5 overexpression plants.
[0032] Figure 4 The photosynthetic efficiency of the leaves of SlPRR5 gene knockout mutants and SlPRR5 gene overexpression plants in Example 3; A is the phenotype of the plants, B is the maximum photochemical efficiency of photosystem II (ΦPSII), and C is the photosynthetic rate (Pn). DETAILED DESCRIPTION
[0033] The application will be further described below in conjunction with the drawings and specific examples. It should be understood that these examples are only used to illustrate the application and not to limit the scope of the application. The operation methods not specified in the following examples are usually performed according to the conventional conditions or the conditions recommended by the manufacturers.
[0034] SEQ ID NO. 1:
[0035]
[0036] SEQ ID NO. 2:
[0037] MGEVVVSSEGDLEVIGGGDMVIETEAGGNMKETGAGAAVAAASSSILKWERFLPKMVFRVLLVESDDSTRQIVAALLRKCSYRVAAVSDGLKAWELLKGRPHNVDLILTEVDLPSISGYALLSLIMEHDICKNIPVIMMSSNDSVSTVYRCMLRGAADFLVKPVRKNELRNLWQHVWRRRAASGSSQGPVDESVAQQKVEATAENNACSNHSSGYKACVQRNRECIEKGSDAQSSCTKPELENEEENAENLPESVQPNREASLPNAADLVKELLHEANNRLRISENDGRAPTTDANAMTRGEDINSDDNWGHGRTIGQTSDEHPGPPTKQAIDLIGAFDNYLKCNSKSSGSDTRINKGDSSPLLDLSLTRSHPSGSVNQFTNEKRRLNHSDTSAFTRYVNRAMQSGQSTSSRTYNLQEYETDSDKQLCGHAIDYNSDTRGPMTRPQSVAPPSYAEPGPAEIGFPSPQQRVTPLPISVRGIRFEGPSSAYCSMIAPILRMPSGISPLQSPGSATPGESSYQANPFLALNCESRSSQKFHSQSDQNNSDSSAYNEGKRGHMSEPTTDCERFPSATDQTINSICCNGDLNHVHLSYGSNGNISLPPGKTPAEYWKEESLHTTDGNSQRSQREAALTKFRMKRKDRCFEKKVRYESRKKLAEQRPRVKGQFVRHVPSESSPGNS.
[0038] SEQ ID NO. 3:
[0039]
[0040] Obtaining of SlPRR5 gene knockout plants
[0041] 1. Construction of SlPRR5 gene CRISPR / Cas9 gene editing vector
[0042] The gene sequence of tomato SlPRR5 was obtained by searching the database of website NCBI (http: / / www.ncbi.nlm.nih.gov / ). The sgRNA (small guide RNA) of SlPRR5 gene was designed using CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR);
[0043] sgRNA1: TGGAAATATGAAGGAAACAG (SEQ ID NO. 4), sgRNA2: CTTAGGAAATGCAGTTACAG (SEQ ID NO. 5).
[0044] Figure 1 The positions and sequences of the two sgRNAs on the tomato SlPRR5 gene.
[0045] The specific construction process of the vector is as follows: first, the PCR amplification primers containing sgRNA1 and sgRNA2, respectively, were designed, and the PCR fragments of the two target points were amplified with plasmid Y0014472-1 as the template, and the specific primer sequences are shown in Table 1.
[0046] The two PCR products after amplification were connected to the pAEE401 plasmid containing the endonuclease BbsI site by Golden Gate assembly kit (BsaI-HFv2) (NEB, E1601). The obtained vector pAEE401-SlPRR5 was sequenced to confirm whether it was successfully constructed.
[0047] Table 1 PCR primer sequences for constructing CRISPR / Cas9 vector
[0048]
[0049]
[0050] 2. Obtaining of SlPRR5 gene CRISPR / Cas9 gene editing plants
[0051] The agrobacterium into which the recombinant plasmid pHEE401-SlPRR5 was transferred was obtained by heat shock, the agrobacterium competence was GV3101, the wild type tomato cotyledon was infected by the agrobacterium, and the infected cotyledon was developed into a complete transgenic tomato plant through plant tissue culture.
[0052] Subsequently, the primers were designed according to the target position, which were as follows:
[0053] 401-Y-P5-F: AAACATAAGTAGGAATCGAAGAAAT (SEQ ID NO. 10);
[0054] 401-Y-P5-R: ATTAAGCCACAACTAACTC (SEQ ID NO. 11).
[0055] The DNA of the transgenic plant was extracted, amplified by PCR technology, and verified by sequencing. The obtained mutant types were hybrid T0 generation plants prr5-2# and prr5-9# with 1 base insertion and 1 base deletion, respectively, and then self-crossed to obtain T1 generation homozygous prr5-2# and prr5-9# plants. Figure 1
[0056] Example 2: Obtaining of SlPRR5 gene overexpression plant
[0057] In order to clarify the regulation mechanism of the biological clock on the synthesis of chlorophyll in tomato plants, the total RNA of tomato leaves was extracted, and cDNA was obtained by reverse transcription. The SlPRR5 gene was cloned from the tomato genome using the cDNA as a template.
[0058] According to the coding region sequence of SlPRR5, the multiple cloning site of the overexpression vector pAC004-HA and the sequence near it, the restriction enzyme cutting sites (AscI and BamHI) were selected and the homologous arms were designed, and the specific primers SlPRR5-F (ttacaattaccatggggcgcgccATGGGTGAGGTTGTTGTGAGTAGTG) and SlPRR5-R (aacatcgtatgggtaggtaccTGAGTTACCTGGCGAAGACTCA) were generated by using the software CE Design V1.03, and the sequences were shown in SEQ ID NO. 12 and SEQ ID NO. 13, respectively.
[0059] The SlPRR5 fragment was amplified by KOD high-fidelity enzyme PCR and the PCR product was purified and recovered. The pAC004-HA vector was double-digested and the linearized vector was purified and recovered. Then, the SlPRR5 fragment was ligated to the pAC004-HA using the Novalgen homologous recombination enzyme Exnase II to obtain the plant overexpression vector pAC004-SlPRR5-HA. The expression vector successfully expressed SlPRR5-HA fusion protein in plants. The recombinant plasmid was sent to the company for sequencing confirmation. The nucleotide sequence of the obtained gene SlPRR5 is shown in SEQ ID NO. 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO. 2.
[0060] The results showed that the cloned sequence was consistent with the sequence published in the database, and the positive plasmid was extracted for future use.
[0061] 2. Obtaining of SlPRR5 gene overexpression plant
[0062] The positive overexpression vector plasmid pAC004-SlPRR5-HA was transformed into Agrobacterium GV3101 by heat shock. The ordinary tomato variety Condine Red was used as the wild type (WT), and the Agrobacterium infection was performed by the cotyledon infection method. Then, callus induction, bud differentiation and rooting were induced by adjusting the hormone ratio, and finally the T0 generation of tissue culture seedlings was obtained. Western Blot was used to verify the SlPRR5 overexpression positive transgenic plant, and the results showed that there was no protein band in WT, but there was a SlPRR5-HA band in the overexpression strain. Figure 2 ).
[0063] Example 3
[0064] 1. Detection of chlorophyll content and photosynthetic efficiency of SlPRR5 gene knockout plant and SlPRR5 gene overexpression plant Wild type tomato WT, SlPRR5 gene knockout plant and SlPRR5 gene overexpression plant were used as experimental materials.
[0065] The seeds were soaked at about 50°C for 15 min, and then cultured at 28°C on a constant speed shaker (200 rpm / min) for about 2 days. The water was changed about once every 12 h during the period. After the radicle of the seed was white, the seeds were sown in a 72-hole tray filled with a mixture of grass charcoal: vermiculite: perlite at a volume ratio of 4:2:1. The tray seedlings were grown in a plant factory with a light period of 12h / 12h, an environmental temperature of 21°C / 19°C, a relative humidity of about 75%, and an average light intensity of 250 μmol·m -2 s -1, and the nutrient solution was 1 / 2 Hoagland nutrient solution. When the seedlings grew to three leaves and one heart, the single plant was transplanted into a plastic pot for culture, and the culture conditions were the same as above. When the WT plant grew to five leaves and one heart, the chlorophyll content, the maximum photochemical efficiency of photosystem II and the photosynthetic rate were detected, and each group of treatment had 10 biological repeats.
[0066] Results: Compared with the wild type tomato (WT), the chlorophyll content of the SlPRR5 gene knockout tomato mutant was obviously increased, and at the same time, the ΦPSII and Pn of the tomato plant were also significantly increased; on the contrary, the chlorophyll content, ΦPSII and Pn of the SlPRR5 gene overexpression plant were significantly less than those of the wild type (WT) tomato. Figure 3 and Figure 4 ).
[0067] In summary, the present application found that knocking out the tomato SlPRR5 can promote the synthesis of chlorophyll in plants, and at the same time, the maximum photochemical efficiency of photosystem II and the photosynthetic rate of the plant are also improved, and the present application provides a new genetic regulation strategy for optimizing the photosynthetic capacity of tomato and improving the yield.
[0068] Furthermore, it is to be understood that even though numerous characteristics and advantages of various aspects of the present application have been set forth in the foregoing description, many modifications and changes to aspects of the application will occur to those skilled in the art once they learn of the basic principles of the application. The disclosures and the descriptions herein are intended to be illustrative only and not in a limiting sense. Thus, various only and not in a limiting sense. Thus, various modifications of the application will be apparent to those skilled in the art, and this application is to be limited only by the scope of the appended claims.
Claims
1. Knockout SlPRR5 The application of genes in improving tomato photosynthetic efficiency is characterized by, The SlPRR5 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the photosynthetic efficiency is the maximum photochemical efficiency and photosynthetic rate of photosystem II.
2. The application of genetically engineered bacteria in regulating tomato photosynthetic efficiency, characterized in that, The genetically engineered bacteria contain editing... SlPRR5 The vector of genes; SlPRR5 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the editing includes gene knockout and overexpression.
3. The application as described in claim 2, characterized in that, The regulation method is one of the following: (1) Improve the expression of genes through gene overexpression technology. SlPRR5 The expression level of genes is reduced, which lowers the chlorophyll content and photosynthetic rate of tomato plants, thereby reducing photosynthetic efficiency. (2) By knocking out SlPRR5 Genes can increase the chlorophyll content and photosynthetic rate of tomato plants, thereby improving photosynthetic efficiency.
4. The application as described in claim 2, characterized in that, Construct overexpression SlPRR5 The method for identifying gene mutants is as follows: (1) Construct a structure containing tomatoes SlPRR5 An overexpression vector of the gene CDS sequence, the CDS sequence of which is shown in SEQ ID NO.3; (2) The vector was transferred into Agrobacterium competent cells to obtain cells containing... SlPRR5 Agrobacterium-mediated gene overexpression; (3) Using the Agrobacterium to infect the cotyledons of common wild-type tomatoes, seedlings were re-obtained through tissue culture, and overexpressing strains were screened. SlPRR5 A positive transgenic plant.
5. The application as described in claim 3, characterized in that, The knockout method is CRISPR / Cas9 gene editing technology.
6. The application as described in claim 3, characterized in that, The knockout SlPRR5 The genetic approach is as follows: (1) Design SlPRR5 Two target sequences of the gene, sgRNA, were used to construct the tomato. SlPRR5 Gene-editing CRISPR / Cas9 vectors; (2) The vector was transferred into Agrobacterium competent cells to obtain Agrobacterium with CRISPR / Cas9 vector; (3) Utilizing SlPRR5 Agrobacterium-mediated gene editing was used to infect the cotyledons of common wild-type tomatoes. Seedlings were then regenerated through tissue culture and selected. SlPRR5 Mutant plants with missing genes.
7. The application as described in claim 6, characterized in that, The vector is pAC004-HA with a 35S promoter; the host cell is Agrobacterium GV3101.
8. The application as described in claim 6, characterized in that, In step (1), the two target sequence sgRNAs are shown as SEQ ID NO.4 and SEQ ID NO.5.
Citation Information
Patent Citations
PbPRR2 and PbPRR3 genes of pears and application of PbPRR2 and PbPRR3 genes
CN113278631A