Gene editing method for preparing full-retention form of selective splicing sites by utilizing single nucleotide position transfer

Abstract

The invention discloses a gene editing method for preparing a selective splicing site full-retention form by utilizing single nucleotide position transfer. According to the gene editing method, on the basis that a gene nucleotide sequence is not changed, mononucleotide at the junction of a single selective splicing exon and an adjacent exon on any side of the single selective splicing exon is transferred, so that splicing factor binding sites are damaged, and the purpose that the selective splicing exon is not spliced in all mRNA is achieved. The gene editing method specifically targets a single selective splicing site of the gene, makes up for the vacancy of a gene editing method in a selective splicing site full-retention form, and is suitable for preparing a transgenic mouse model in a selective splicing exon full-retention form.

Description

Technical Field

[0001] The present invention relates to a gene editing method for preparing a fully retained form of selective splicing sites by utilizing single nucleotide position transfer, and belongs to the technical field of gene editing methods. Background Art

[0002] Alternative splicing (AS) of mRNA is a key mechanism for transcriptional regulation, the generation of transcriptional diversity, and the modification of protein structure and function. Different splicing isoforms of the same gene may exist in different tissues, developmental stages, or under specific conditions, which means that these splicing isoforms have unique temporal and spatial effects, thus linking AS to normal physiological functions and some diseases. Therefore, the preparation of mutant animal models targeting a single AS site is crucial for studying the function or pathogenic mechanism of the gene.

[0003] The outcome of AS (i.e., the relative abundance of different alternatively spliced ​​isoforms) is influenced by several factors: first, the strength of the splice site. Strong splice sites contain a consensus sequence recognized by the spliceosomal machinery and usually result in “constitutive splicing”: that is, the exon in question is included in all mRNA molecules synthesized by the cell. Weak splice sites differ from the consensus sequence, and their recognition by the spliceosome is highly dependent on the presence of cis-acting sequences and the cellular environment, such as the expression level of splicing factors. Second, cis-regulatory sequences in pre-mRNAs that favor or disfavor exon recognition. Third, the expression levels of trans-acting factors (RNA-binding proteins and splicing factors).

[0004] Thanks to the continuous improvement of transgenic technology, it is relatively easy to prepare gene mutant mice with a complete deletion of a single AS site. However, there are few reports on the preparation and research of gene mutant mice with a complete retention of a single AS site. The complete retention of the AS site means that the AS exon will not be cut off during the processing of precursor mRNAs, and will eventually exist in all mRNA molecules synthesized by the cell. To achieve this goal, Aoto and his colleagues used homologous recombination to change the 6 nucleotides in the intron adjacent to the 5' end of exon 20 of the mouse Neurexin 3 gene in a study published in Cell in 2013, thereby changing its splice acceptor sequence, thereby preparing transgenic mice with a complete retention of exon 20 of the Neurexin 3 gene. The core of this method is to replace the original abnormal purine splicing acceptor sequence of the gene with the classical consensus sequence, that is, to replace the original weak splicing site with a strong splicing site, so as to achieve full retention of the AS site (Aoto, J. and D. C. Martinelli, et al. (2013). "Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking." Cell 154 (1): 75-88.). However, the use of this scheme to prepare transgenic mice with a fully retained form of Neurexin 3 gene exon 9 was not successful, and contrary to the expected results, the proportion of Neurexin 3 transcripts with a retained form of exon 9 was reduced by nearly 1 / 3 compared with the wild type, and its success rate could not be guaranteed. Summary of the invention

[0005] The purpose of the present invention is to provide a gene editing method for preparing a fully retained form of an alternative splicing site by using single nucleotide position transfer, which can more efficiently and concisely prepare transgenic mice with fully retained forms of AS sites.

[0006] The technical solution for achieving the purpose of the present invention is as follows:

[0007] A gene editing method for preparing a fully preserved form of an alternative splicing site by using a single nucleotide position transfer, on the basis of not changing the gene nucleotide sequence, a single nucleotide at the junction of a single alternative splicing exon and an adjacent exon on either side is transferred, specifically: exon x is an alternative splicing exon that needs to be fully preserved in gene editing, and a Donor vector is constructed by any of the following methods: 1) transferring the last nucleotide in exon x-1 to the first nucleotide in exon x; 2) transferring the first nucleotide in exon x to the last nucleotide in exon x-1; 3) transferring the last nucleotide in exon x to the first nucleotide in exon x+1; 4) transferring the first nucleotide in exon x+1 to the last nucleotide in exon x.

[0008] The second object of the present invention is to provide a method for constructing a transgenic mouse model with all alternative splicing sites retained, which method constructs a transgenic mouse model with all alternative splicing sites retained based on the above-mentioned gene editing method, and specifically comprises the following steps:

[0009] S1. Determine the selective splicing exon exon x that needs to be fully retained in gene editing, select two single nucleotide sites that need to be positionally transferred, and construct in vitro gRNA plasmids targeting the vicinity of the two single nucleotide sites that are respectively transferred, wherein the two single nucleotide sites that need to be positionally transferred are selected from any one of the following groups: 1) the last nucleotide in exon x-1 and the first nucleotide in exon x; 2) the first nucleotide in exon x and the last nucleotide in exon x-1; 3) the last nucleotide in exon x and the first nucleotide in exon x+1; 4) the first nucleotide in exon x+1 and the last nucleotide in exon x;

[0010] S2. Construct a Donor vector corresponding to step S1, carrying a homologous region of the target site and a position transfer site, wherein the Donor vector is constructed by one of the following methods: 1) transferring the last nucleotide in exon x-1 to the first nucleotide in exon x; 2) transferring the first nucleotide in exon x to the last nucleotide in exon x-1; 3) transferring the last nucleotide in exon x to the first nucleotide in exon x+1; 4) transferring the first nucleotide in exon x+1 to the last nucleotide in exon x;

[0011] S3, microinjecting the CRISPR-Cas9 system and the Donor vector into the fertilized eggs of recipient mice to obtain F0 generation mice;

[0012] S4. The F0 generation positive mice verified by PCR and sequencing are mated with recipient mice to obtain a stable heritable F1 generation positive mouse model.

[0013] Furthermore, in a specific embodiment of the present invention, Neurexin 3exon9 is taken as an example of the selectively spliced ​​exon that needs to be fully retained in gene editing.

[0014] Furthermore, in step S3, the recipient mice are C57BL / 6JGpt mice.

[0015] A third object of the present invention is to provide an application of the transgenic mouse model constructed by the above construction method in the preparation of an animal model of neurodevelopmental disorders.

[0016] Furthermore, neurodevelopmental disorders include but are not limited to autism, schizophrenia, etc.

[0017] Furthermore, the key point of constructing the gRNA plasmid is to specifically target the two sides of the two single nucleotide sites where the position transfer occurs. When exon x is a selective splicing exon that needs to be fully retained in gene editing, such as selecting to transfer the last nucleotide in exon x-1 to the first nucleotide in exon x, the gRNA can be designed by selecting appropriate sequences in exon x-1 and exon x. After the CRISPR-Cas9 system thus constructed is microinjected into the fertilized eggs of recipient mice, DNA can be cut at exon x-1 and exon x, so that the constructed Donor vector can repair DNA and prepare transgenic mice.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] 1) The vector construction is more concise, involving only the conversion of a single nucleotide at the genomic position, introducing minimal modification to the genome; 2) The sequence of the gene itself will not be changed, avoiding the occurrence of unknown biological events in the body that may be caused by changes in the nucleotide sequence; 3) Transgenic mice with a fully retained AS site can be efficiently and successfully prepared. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the principle of gene editing method using single nucleotide position shift to prepare a fully preserved form of alternative splicing sites;

[0021] Figure 2 Schematic diagram of genotyping of F0 and F1 generation mice;

[0022] Figure 3The PCR results of the genomic DNA of F1 mice, where the numbers are the mouse tail numbers, WT is C57BL / 6JGpt, N is the blank control, and M is the DNA marker;

[0023] Figure 4 The sequencing results of the F1 generation mouse genomic DNA, where the blue boxes indicate the nucleotides with shifted positions, and the red boxes indicate the corrections made to the incorrectly annotated bases in the original sequencing results;

[0024] Figure 5 The RT-PCR verification results of the Neurexin 3 (Nrxn3) gene of homozygous mice obtained by mating F1 positive mice, where WT: wild type; KI: Nrxn3 exon 9 fully retained mouse gene knock-in mouse; SS3+: splicing site 3+, that is, Nrxn3 contains exon 9 transcripts; SS3-: splicing site 3-, that is, Nrxn3 does not contain exon 9 transcripts; β-actin: internal reference gene. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with specific embodiments and drawings.

[0026] The test reagents used in the following examples, unless otherwise specified, are all conventional biochemical reagents; the experimental methods described, unless otherwise specified, are all conventional methods or are performed in accordance with the instructions of the kits.

[0027] Example 1

[0028] In this example, a gene knock-in mouse with a fully preserved form of Neurexin 3 exon9 was prepared. The schematic diagram of the principle of the preparation scheme of the gene knock-in mouse model is shown in FIG. Figure 1 shown.

[0029] 1. In this example, the mouse Neurexin 3 (Nrxn3) transcript Nrxn3-205 (ENSMUST00000163134.8) encoding the longest amino acid was selected for gene editing. The transcript contains 20 exons, the translation start site ATG is located in exon 1, and the translation termination site TAA is located in exon 20, encoding 1571aa. In this experiment, the first base G of exon 10 was deleted and the base G was inserted after the last base of exon 9. The specific sequence information is as follows:

[0030] Wild type sequence:

[0031] ACTGTATCAGGATAAACTGTAACTCCA gtaagtttttcctcaagttt ...... / / ...... tgacacttaccaccattctt agG CAAAGGACCTGAGACCCTGTATGCAGGGCAGAAGCTCAATGACAATGAGTGGCACACCG TCCGGGTAGTGCGGAGAGGAAAAAGCCTTAAGCTAACAGTGGATGATGATGTGGCTGAG G (SEQ ID No. 1);

[0032] Theoretical sequence after hitting the target:

[0033] ACTGTATCAGGATAAACTGTAACTCCAG gtaagtttttcctcaagttt ...... / / ...... tgacacttaccaccattctt ag CAAAGGACCTGAGACCCTGTATGCAGGGCAGAAGCTCAATGACAATGAGTGGCACACCG TCCGGGTAGTGCGGAGAGGAAAAAGCCTTAAGCTAACAGTGGATGATGATGTGGCTGAG G (SEQ ID No. 2).

[0034] Note: The uppercase bases are exon 9 and exon 10; the lowercase bases are partial sequences of intron 9-10, which are not fully displayed; the uppercase bold bases are bases that have undergone position shift; the underlined lowercase bases are gRNA sequences.

[0035] 2. Specific process:

[0036] (1) Design gRNA target sequences for the two sites involved in single nucleotide transfer (the specific operation was completed by the company). The gene sequences of gRNA are shown in Table 1.

[0037] Table 1 Gene sequences of gRNA

[0038] gRNA name gRNA sequence (5'→3') PAM GJS022023044205-01-Nrxn3-5S1 AAACTTGAGGAAAAACTTAC(SEQ ID No.3) TGG GJS022023044205-01-Nrxn3-3S1 TGACACTTACCACCATTCTT(SEQ ID No.4) AGG

[0039] (2) Using C57BL / 6JGpt mouse genomic DNA as a template, the sequences near the two sites involved in the single nucleotide transfer were amplified, and mutations were introduced on this basis to construct a recombinant Donor vector.

[0040] (3) The CRISPR-Cas9 system and the Donor vector were microinjected into the fertilized eggs of C57BL / 6JGpt mice. The fertilized eggs that survived the injection were transplanted into pseudopregnant female mice and waited for them to become pregnant and give birth.

[0041] (4) The F0 generation mice born by the recipient mice were tail-clipped and toe-clipped at 5-7 days old and numbered. Genomic DNA was extracted for PCR and sequencing to confirm the genotype.

[0042] (5) After the correct F0 generation positive mice are sexually mature, they are mated with C57BL / 6JGpt background mice; the F1 generation mice born are tail-clipped and toe-clipped on days 5-7, and numbered. Genomic DNA is extracted for PCR and sequencing to confirm the genotype. The PCR results are as follows: Figure 3 The sequencing results are shown in Figure 4 shown.

[0043] Schematic diagram of genotyping of F0 and F1 generation mice Figure 2 The information of PCR primers used is shown in Table 2.

[0044] Table 2 PCR primer information

[0045] Table 3 PCR reaction conditions

[0046]

[0047] (6) After mating the F1 generation positive mice to obtain homozygous mice, the Nrxn3 gene was verified by RT-PCR. The upstream primers spanned exon 7 and 8, and the downstream primers spanned exon 10 and 11.

[0048] Table 4 PCR primer information

[0049]

[0050] Table 5 PCR reaction conditions

[0051]

[0052] Depend on Figure 5 It can be seen that the cerebellum tissue of wild-type mice expresses two forms of Nrxn3, one containing exon 9 (SS3+) and the other not containing exon 9 (SS3-); however, in the cerebellum tissue of the prepared gene knock-in mice, only the form of the Nrxn3 gene containing exon 9 can be detected, proving that the transgenic mice were successfully prepared.

Claims

1. A gene editing method for preparing a fully preserved form of alternative splicing sites using single nucleotide position transfer, characterized in that: Without changing the gene nucleotide sequence, a single nucleotide at the junction of a single alternative splicing exon and its adjacent exon on either side is transferred. Specifically, exon x is the alternative splicing exon that needs to be fully retained in gene editing, and the Donor vector is constructed by any of the following methods: 1) Transfer the last nucleotide in exon x-1 to the first nucleotide in exon x; 2) Transfer the first nucleotide in exon x to the last nucleotide in exon x-1; 3) Transfer the last nucleotide in exon x to the first nucleotide in exon x+1; 4) Transfer the first nucleotide in exon x+1 to the last nucleotide in exon x.

2. A method for constructing a transgenic mouse model with all alternative splicing sites preserved based on the gene editing method of claim 1, characterized in that: The following steps are involved: S1. Determine the selective splicing exon exon x that needs to be fully retained in gene editing, select two single nucleotide sites that need to be positionally transferred, and construct in vitro gRNA plasmids that target the vicinity of the two single nucleotide sites that are respectively transferred, wherein the two single nucleotide sites that need to be positionally transferred are selected from any one of the following groups: 1) the last nucleotide in exon x-1 and the first nucleotide in exon x; 2) the first nucleotide in exon x and the last nucleotide in exon x-1; 3) the last nucleotide in exon x and the first nucleotide in exon x+1; 4) the first nucleotide in exon x+1 and the last nucleotide in exon x; S2, constructing a Donor vector carrying a target site homology region and a position transfer site corresponding to step S1, wherein the Donor vector is constructed by one of the following methods: 1) transferring the last nucleotide in exon x-1 to the first nucleotide in exon x; 2) transferring the first nucleotide in exon x to the last nucleotide in exon x-1; 3) transferring the last nucleotide in exon x to the first nucleotide in exon x+1; 4) transferring the first nucleotide in exon x+1 to the last nucleotide in exon x; S3, microinjecting the CRISPR-Cas9 system and the Donor vector into the fertilized eggs of recipient mice to obtain F0 generation mice; S4. The F0 generation positive mice verified by PCR and sequencing are mated with recipient mice to obtain a stable heritable F1 generation positive mouse model.

3. The construction method according to claim 2, characterized in that: In steps S1 and S2, the alternatively spliced ​​exons that need to be fully preserved in gene editing are Neurexin 3 exon9.

4. The construction method according to claim 2, characterized in that: In step S3, the recipient mice are C57BL / 6JGpt mice.

5. Use of the transgenic mouse model constructed according to any one of claims 2 to 4 in preparing an animal model of neurodevelopmental disorders.

6. The use according to claim 5, characterized in that: The neurodevelopmental disorder is autism or schizophrenia.

Images