In-vitro detection or cell imaging method for N4-acetylcytosine (ac4C) RNA

Abstract

The invention discloses an in-vitro detection or cell imaging method for N4-acetylcytosine (ac4C) RNA (Ribonucleic Acid), and belongs to the technical field of molecular biology and biological imaging. According to the method, ac4C RNA is marked through fluorine metabolism to generate F-ac4C RNA, an ac4C specific probe and an RNA sequence specific probe are introduced, and efficient and specific in-vitro detection and in-situ imaging of ac4C RNA loci of cells are realized by combining a signal amplification technology of rolling circle amplification reaction (RCA). The method is suitable for in-vitro detection and cell imaging of specific ac4C sites of multiple types of RNA (such as rRNA, mRNA, lncRNA and tRNA) and multiple types of cells. The invention is expected to provide a new way for revealing ac4C modified biological functions and mechanisms, and plays an important role in diagnosis and treatment of RNA related diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology and biological imaging, and in particular to a method for 4 -Acetylcytosine (ac 4 C) In vitro detection or cell imaging methods of RNA. Background Art

[0002] In recent years, the modification and function research of RNA molecules has attracted much attention. 4 -Acetylcytosine (ac 4 C) As an important RNA acetylation modification, it is widely present in the mRNA, tRNA and rRNA of eukaryotes and is highly conserved in mammals and other eukaryotes (Jin G, Xu M.Molecular Therapy-Nucleic Acids.2020,20,13-24.). 4 C modification plays a key role in regulating RNA stability, translation efficiency and cellular stress response. Early studies have found that ac in tRNA and rRNA 4 C modification can affect ribosome maturation and protein translation efficiency (Zhou Y, Chen C. Nucleic acids research. 2013, 41, 5669-78; Ito S, Akamatsu Y. Journal of Biological Chemistry. 2014, 289, 26201-12.).

[0003] Due to technical limitations, it was difficult to enrich ac from mRNA in the early stage. 4 Sinclair et al. developed an affinity reagent in vitro transcription (IVT) technique for screening for ac 4 C binding protein antibody (Sinclair WR, Arango D. ACS chemical biology. 2017, 12, 2922-6.). Subsequently, Arango et al. first discovered through acRIP-seq sequencing that ac 4 C is mainly enriched in the coding DNA sequence (CDS) region of the human transcriptome (Arango D, Sturgill D. Cell. 2018, 175, 1872-86.).

[0004] In recent years, studies have shown that mRNA acetylation promotes cancer and disease progression (Feng Z, Li K. Journal of hematology & oncology. 202, 15, 112; Larrieu D, Viré E, Robson S. Science signaling. 2018, 11, eaar5401.), and its reduction leads to cell cycle abnormalities and inflammatory responses (Cui L, MaR. Signal transduction and targeted therapy. 2022, 7, 334.).

[0005] In addition, ac catalyzed by NAT10 4 C modification is closely related to a variety of human diseases, especially cancers, such as liver cancer, colorectal cancer, prostate cancer, bladder cancer, multiple myeloma, pancreatic ductal adenocarcinoma and gastric cancer (Luo J, Cao J. Biochem Pharmacol. 2023, 213, 115628.). Therefore, a deeper understanding of ac 4 It is of great significance to study the dynamic process of C modification in cells to reveal its biological function and mechanism.

[0006] Currently, ac 4 C The detection methods of RNA modifications mainly rely on techniques such as mass spectrometry, nucleic acid hybridization and immunoprecipitation. Although these methods can detect the presence of RNA modifications or determine their sequences, they cannot provide precise localization information of the modifications in cells or tissues. In contrast, in situ imaging technology can directly display the specific location and distribution of RNA modifications in cells or tissues. Through in situ imaging, researchers can observe the distribution of modified bases in different cell types and subcellular structures (such as the nucleus, cytoplasm, nucleolus, etc.), so as to understand their role in different biological processes. In addition, in situ imaging technology can also monitor the dynamic changes of RNA modifications in cells in real time, revealing the formation and removal process of modifications, as well as their relationship with cell function and state. In a multicellular environment, in situ imaging can also show the differences in modifications between different cell types.

[0007] Rolling circle amplification (RCA) is a molecular biology technique that is widely used in molecular diagnosis, genomics research, and bioimaging due to its advantages such as high efficiency, specificity, and signal amplification. In RNA in situ imaging, rolling circle amplification can enhance the imaging signal by amplifying the amplified signal, improve the sensitivity and resolution of detection, and thus achieve efficient positioning and imaging of RNA modifications. Summary of the invention

[0008] The object of the present invention is to provide a method for N 4-Acetylcytosine (ac 4 C) RNA in vitro detection or cell imaging method. The present invention utilizes fluorine metabolic labeling precursor compounds and specific probes, combined with nucleic acid amplification and fluorescence detection technology, to efficiently and accurately detect and image ac 4 C RNA.

[0009] The purpose of the present invention is achieved through the following technical solutions:

[0010] The present invention provides a method for N 4 -Acetylcytosine (ac 4 C) RNA in vitro detection or cell imaging methods, the principle of which is as follows Figure 1 As shown, the following steps are included:

[0011] (1) Add the fluorine metabolic labeling precursor compound to the cell culture medium containing the cells to be tested and incubate the cells to metabolize the RNA to label the fluorine element to generate F-ac 4 C RNA.

[0012] The fluorine metabolic labeling precursor compound includes fluoroacetate and fluoroacetate ester compounds, preferably sodium fluoroacetate, ethyl fluoroacetate, etc. The incubation condition is preferably to culture the cells for 6-18 hours in a culture medium containing 0.1-5 mM fluorine metabolic labeling precursor compound.

[0013] (2) Add F-ac 4 C site-specific probe (Probe A), through the fluorothiol displacement reaction, Probe A and F-ac 4 cRNA reaction to generate ac with Probe A label 4 C RNA.

[0014] The fluorothiol replacement reaction is a reaction between the thiol in Probe A and F-ac 4 The fluorine atom in C reacts to form a stable chemical bond. The 5' end of the Probe A is modified with a thiol-containing compound, and the Probe A contains a spacer sequence, a sequence complementary to the 5' end sequence of Probe C2, and a sequence complementary to the 3' end sequence of Probe C1 from the 5' end to the 3' end. Preferably, the Probe A contains a 5-25nt spacer sequence, an 8-15nt sequence complementary to the 5' end sequence of Probe C2, and an 8-15nt sequence complementary to the 3' end sequence of Probe C1 from the 5' end to the 3' end.

[0015] Preferably, the thiol-containing compound modified at the 5' end of Probe A is obtained by reacting dibenzocyclooctene modified at the 5' end of Probe A with a compound containing an azide group and a thiol group through a copper-free click chemistry reaction. Among them, the compound containing an azide group and a thiol group is preferably

[0016] (3) Add RNA sequence-specific probe (Probe B) and make Probe B and F-ac complementally paired. 4 The RNA sequence adjacent to site C is hybridized. Two 5'-end phosphorylated DNA chains, Probe C1 and Probe C2, are introduced to complementarily pair with Probe A and Probe B to form a circular template precursor, which is then connected into a circle under the action of DNA ligase.

[0017] The Probe B contains, from the 5' end to the 3' end, a sequence complementary to the 5' end sequence of Probe C1, a sequence complementary to the 3' end sequence of Probe C2, a spacer sequence, a sequence complementary to the RNA ac 4 Preferably, the Probe B contains, from the 5' end to the 3' end, a 8-15 nt sequence complementary to the 5' end sequence of Probe C1, a 8-15 nt sequence complementary to the 3' end sequence of Probe C2, a 5-25 nt spacer sequence, a 5-25 nt spacer sequence complementary to the RNA ac 4 The C site contains a 15-30 nt sequence that is complementary to the adjacent sequence.

[0018] The Probe C1 contains, from the 5' end to the 3' end, a sequence complementary to the 5' end sequence of Probe B, a spacer sequence, a sequence identical to the middle part sequence or the entire sequence of the detection probe, a spacer sequence, and a sequence complementary to the 3' end sequence of Probe A. Preferably, the Probe C1 contains, from the 5' end to the 3' end, a 8-15 nt sequence complementary to the 5' end sequence of Probe B, a 5-25 nt spacer sequence, a 15-30 nt sequence identical to the middle part sequence or the entire sequence of the detection probe, a 5-25 nt spacer sequence, and a 8-15 nt sequence complementary to the 3' end sequence of Probe A.

[0019] The Probe C2 contains, from the 5' end to the 3' end, a sequence complementary to a partial sequence of Probe A, a spacer sequence, and a sequence complementary to a partial sequence of Probe B. Preferably, the Probe C2 contains, from the 5' end to the 3' end, a 8-15 nt sequence complementary to a partial sequence of Probe A, a 5-25 nt spacer sequence, and a 8-15 nt sequence complementary to a partial sequence of Probe B.

[0020] The spacer sequence is usually used to adjust the distance between different elements or avoid adverse interactions. The spacer sequence can contain various base combinations, such as AT-rich regions or GC-rich regions, but sequences that may form complex secondary structures are usually avoided; the sequence that can produce complementary pairing should avoid four or more consecutive arrangements of purines and pyrimidines, and the GC content is generally between 40% and 60%, preferably 45% to 55%. There should be no complementary sequence itself to avoid secondary structure.

[0021] (4) The product obtained in step (3) is extended by DNA polymerase starting from the 3' end of Probe A to generate a rolling circle amplification product (RCP).

[0022] (5) After adding the detection probe (DP) to the rolling circle amplification product and incubating in the dark, the fluorescence intensity of RCP is measured using a fluorescence detector, or the distribution of RCP in the cell is observed using a fluorescence microscope. The fluorescence detector includes a fluorescence spectrophotometer; the fluorescence microscope includes a laser confocal fluorescence microscope.

[0023] The detection probe (DP) comprises a fluorescently modified oligonucleotide chain or a molecular beacon, which can bind to the rolling circle amplification product RCP to generate a detectable fluorescent signal, and is any one of the following probes:

[0024] Detection probe 1: A molecular beacon modified with a fluorescent group and a quenching group at both ends, with complementary pairing sequences that can form a "hairpin" structure at both ends, and the middle part is the same sequence as the middle part of Probe C1.

[0025] Detection probe 2: an oligonucleotide chain modified with a fluorescent tag, with a fluorescent group modified at the 5' end, and the sequence is the same as the middle sequence of Probe C1.

[0026] Furthermore, the method is used for N 4 -Acetylcytosine (ac 4 C) The in vitro detection of RNA includes the following steps:

[0027] (1) Adding the fluorine metabolic labeling precursor compound to the cell culture medium containing the cells to be tested and incubating the mixture, and extracting the total RNA of the cells after incubation.

[0028] (2) Total cell RNA and Probe A are added to the reaction buffer and incubated to generate ac 4 CRNA.

[0029] The reaction buffer contains a reagent for maintaining the reduction state of the reaction system, such as tris(2-carboxyethyl)phosphine (TCEP); and a buffer for providing a buffer environment for the reaction, such as Tris-HCl; and may also contain an RNase inhibitor for inhibiting RNase activity to ensure the stability of RNA during the reaction. Preferably, the reaction buffer contains: 1-10mMTCEP, 50-150mM Tris-HCl pH 7.0-8.0, and 0.1-2U / μL RNase inhibitor.

[0030] (3) The ac with Probe A label obtained in step (2) 4 C RNA, Probe B, Probe C1, and Probe C2 are incubated in a system containing DNA ligase and DNA ligase buffer to generate a circular template.

[0031] The DNA ligase is preferably T4 DNA ligase. The incubation condition is preferably 25° C. for 1-4 hours.

[0032] (4) The product obtained in step (3) is subjected to rolling circle amplification reaction in a system containing dNTPs, DNA polymerase and DNA polymerase buffer to generate a rolling circle amplification product (RCP).

[0033] The DNA polymerase is preferably phi29 DNA polymerase. The rolling circle amplification reaction is preferably carried out at 30° C. for 2-8 hours.

[0034] (5) Add the detection probe (DP) to the rolling circle amplification product, incubate in the dark, and then use a fluorescence detector to detect the fluorescence signal.

[0035] The incubation condition is preferably 37° C. for 10-30 minutes.

[0036] Furthermore, the method is used for N 4 -Acetylcytosine (ac 4 C) RNA imaging of cells involves the following steps:

[0037] (1) Adding the fluorine metabolic labeling precursor compound to a cell culture medium containing cells to be tested and incubating; the incubated cells are fixed with paraformaldehyde and then permeabilized with Triton-X-100. The fixation is preferably performed using PBS containing 4% (w / v) paraformaldehyde, and the permeabilization is preferably performed using PBS containing 0.5% (v / v) Triton-X-100.

[0038] (2) Incubate the cells in a reaction buffer containing Probe A to generate ac 4 CRNA.

[0039] The reaction buffer preferably contains: 1-10 mM TCEP, 50-150 mM Tris-HCl pH 7.0-8.0, 5-15 μg / mL salmon sperm DNA, 0.1-2 U / μL RNase inhibitor, 0.1-0.5 mg / mL BSA. The incubation condition is preferably 37° C. for 12-16 hours.

[0040] (3) Ring template connection

[0041] 1) Place the cells in a binding buffer containing Probe B to allow Probe B to bind to the ac 4 C RNA is hybridized to achieve in situ hybridization of Probe B; the cells are then incubated in a binding buffer containing Probe C1 and Probe C2 to form a precursor of the circular template.

[0042] The binding buffer preferably comprises: 2×SSC buffer, 1-10 mM DTT, 0.1-5 mg / mL yeast tRNA, 0.1-2 U / μL RNase inhibitor, 5-15 μg / mL salmon sperm DNA, 0.1-0.5 mg / mL BSA. The hybridization condition is preferably incubated at 37° C. for 2-12 hours. The incubation condition is preferably incubated at 37° C. for 2-6 hours.

[0043] 2) Incubate the cells in ligation buffer to allow ligation of the circular template.

[0044] The ligation buffer comprises DNA ligase and ligase buffer, and the DNA ligase is preferably T4 DNA ligase; preferably, the ligation buffer comprises: 1×T4 DNA ligase buffer, 0.5-2U / μL T4 DNA ligase, 0.1-2U / μL RNase inhibitor. The incubation condition is preferably 37°C for 2-4 hours.

[0045] (4) Placing the cells in an amplification buffer for a rolling circle amplification reaction to generate RCPs.

[0046] The amplification buffer comprises dNTPs, DNA polymerase and polymerase buffer, and the DNA polymerase is preferably phi29 DNA polymerase; preferably, the amplification buffer comprises: 1×phi29 DNA polymerasereaction buffer, 0.1-0.5mM dNTPs, 0.1-2U / μL RNase inhibitor, 0.5-2U / μL phi29 DNA polymerase. The rolling circle amplification reaction is preferably carried out at 37°C for 8-16 hours.

[0047] (5) The cells were placed in a hybridization buffer containing the detection probe (DP) and incubated in the dark to achieve in situ hybridization of DP and RCP. Finally, the fluorescence signal was observed using a fluorescence microscope.

[0048] The hybridization buffer preferably comprises: 2×SSC buffer, 5-15 μg / mL salmon sperm DNA, 0.1-0.5 mg / mL BSA, 0.1-2 U / μL RNase inhibitor. The incubation condition is preferably 37° C. for 2-12 hours.

[0049] Furthermore, the method is used for N 4 -Acetylcytosine (ac 4 C) RNA imaging of cells involves the following steps:

[0050] (1) Add the fluorine metabolic labeling precursor compound to the cell culture medium containing the cells to be tested and incubate; the incubated cells are fixed in a PBS solution containing 4% (w / v) paraformaldehyde for 10-15 minutes and washed with PBS; then the cells are permeabilized with PBS containing 0.5% v / v Triton-X-100 for 5-10 minutes and washed with PBS.

[0051] (2) The cells were incubated in 100 μL reaction buffer containing 100-800 nM Probe A for 12-16 hours, and then washed with TBST buffer.

[0052] (3) Ring template connection

[0053] 1) The cells were incubated at 37°C for 2-12 hours in 150 μL binding buffer containing 50-200 nM Probe B, followed by washing with 2×SSC buffer containing 10% (v / v) formamide; the cells were then incubated at 37°C for 2-6 hours in 150 μL binding buffer containing 50-200 nM Probe C1 and Probe C2, followed by washing with 2×SSC buffer containing 10% (v / v) formamide.

[0054] 2) Incubate the cells in 100 μL of ligation buffer at 37°C for 2-4 hours, then wash with TBST.

[0055] (4) The cells were placed in 100 μL amplification buffer and reacted at 37°C for 8-16 hours, followed by washing with TBST.

[0056] (5) The cells were placed in 100 μL hybridization buffer containing 50-200 nM DP and incubated at 37°C for 2-12 hours, then washed with 2×SSC buffer containing 10% (v / v) formamide, and finally observed using a fluorescence microscope.

[0057] In the method described, the sequence of each probe is preferably as follows:

[0058] The sequence of Probe A is: AAAAAAAAAATATGACAGAACTAGACACTCTT (SEQ ID NO. 1);

[0059] The sequence of Probe B is: GACGCTAATAGTTAAGACGCTTAAAAAAAAAA (SEQ ID NO. 2) - and RNAac 4 The sequence that complements the adjacent sequence of the C site;

[0060] The sequence of Probe C1 is: CTATTAGCGTCCAGTGAATGCGAGTCTCGAGGTGCATTCATATCAGCAGCCGTCAAGAGT GTCTA (SEQ ID NO. 3);

[0061] The sequence of Probe C2 is: GTTCTGTCATATTTAAGCGTCTTAA (SEQ ID NO. 4);

[0062] The sequence of DP is: CGACGACTCGAGGTGCATTCATATTCGTCG (SEQ ID NO. 5), and its two ends are modified with a fluorescent group and a quenching group; or the sequence of DP is: CTCGAGGTGCATTCATAT (SEQ ID NO. 6), and its 5' end is modified with a fluorescent group.

[0063] The method of the present invention is applicable to various types of RNA, including rRNA, mRNA, lncRNA, snoRNA, and tRNA.

[0064] The method of the present invention is applicable to specific ac of various types of cells. 4 C site imaging, including HeLa, MCF-10A, HEK293T, U2OS.

[0065] The present invention also provides a method for ac 4 C RNA in vitro detection or cell imaging probe combination, which includes the above-mentioned F-ac 4 C site-specific probe Probe A, RNA sequence-specific probe Probe B, Probe C1, Probe C2, detection probe.

[0066] The present invention provides a highly efficient and specific ac 4 The present invention provides a reliable technical means for related research and is expected to reveal the ac 4 C modification provides new approaches to the biological functions and mechanisms and plays an important role in the diagnosis and treatment of RNA-related diseases.

[0067] The present invention has the following advantages and beneficial effects:

[0068] (1) High specificity: Through specific probes and fluorothiol replacement reaction, ac 4 C site is precisely labeled, and at the same time, the sequence-specific probe binds to the target RNA to achieve ac 4 Precise labeling of the C site.

[0069] (2) High sensitivity: Combining rolling circle amplification technology and fluorescence detection technology, it can sensitively detect low-abundance ac 4 CRNA.

[0070] (3) Realize intracellular imaging: Accurately locate intracellular AC through specific cell imaging technology 4 Distribution of C RNA.

[0071] (4) Wide applicability: It can be applied to a variety of cell types and RNA types and has strong versatility. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 The fluorine-assisted N 4 -Acetylcytosine (ac 4 C) Schematic diagram of RNA detection or cell imaging in vitro.

[0073] Figure 2 In vitro detection of F-ac 4 C RNA standard working curve.

[0074] Figure 3 For the present invention, imaging 18S rRNA ac4 Confocal microscopy results of viability verification of C1842 site.

[0075] Figure 4 Imaging 18S rRNA ac in multiple cell lines for this invention 4 C 1842 locus and ASPH mRNA ac 4 Confocal microscopy results of the C2692 locus. DETAILED DESCRIPTION

[0076] The technical scheme of the present invention is further described below with specific embodiments, but it should not be understood as limiting the present invention. In the absence of conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other. If not specifically indicated, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0077] Example 1: In vitro detection of 18S rRNA ac in HeLa cells 4 C 1842 position

[0078] 1. Fluorine metabolic labeling of ac 4 C RNA

[0079] When the HeLa cells were cultured to the logarithmic growth phase, 10 μL of ethyl fluoroacetate solution (2 M) was transferred to 10 mL of DMEM complete medium, and the cells were cultured for 12 hours using DMEM complete medium containing 2 mM ethyl fluoroacetate.

[0080] 2. Total RNA Extraction

[0081] After discarding the culture medium, add an appropriate amount of TRIzol reagent to blow the cells, and after blowing completely and evenly, transfer them to a 1.5mL centrifuge tube. Add 1 / 5 volume of chloroform, mix well and let stand for 2 minutes. Centrifuge at 12000g for 15 minutes in a low-temperature centrifuge, and set the temperature to 4°C. Take the supernatant and put it in a new 1.5mL centrifuge tube, add an equal volume of pre-cooled isopropanol, mix well and let stand for 10 minutes, then centrifuge at 12000g for 10 minutes in a low-temperature centrifuge, and set the temperature to 4°C. Discard the supernatant and a white precipitate of total RNA can be observed. Continue to wash the precipitate twice with 75% ice ethanol, each time centrifuging at 12000g for 3 minutes in a low-temperature centrifuge, and set the temperature to 4°C. After discarding the ethanol, open the centrifuge tube containing RNA for 5 minutes to allow the remaining ethanol to evaporate. Use an appropriate amount of DEPC water to dissolve the RNA in the tube to obtain F-ac 4 C RNA, after measuring RNA concentration, was stored at -80℃ until use.

[0082] 3. Design and synthesis of Probe A, Probe B, Probe C1, Probe C2 and detection probe sequence (DP)

[0083] The sequences of the designed and synthesized probe molecules Probe A, Probe B, Probe C1 and Probe C2 can be adjusted accordingly according to the different target RNA sites. 4 Specific sequence example of C 1842 site:

[0084] (1) The precursor of Probe A, DBCO-Oligo nucleic acid sequence is:

[0085]

[0086] The sequence is composed of three functional units. Among them, 5'-DBCO indicates that the 5' end of the oligonucleotide is modified with dibenzocyclooctene, which is a commonly used label group that can undergo copper-free click chemistry reaction (Click reaction) with azide (N3); the italic part of the sequence is the spacer sequence; the underlined part of the sequence can be complementary to the 5' end sequence of Probe C2 and the 3' end sequence of Probe C1.

[0087] Compound ADB with both azide and thiol groups:

[0088] The copper-free click chemistry reaction of DBCO-Oligo and ADB was carried out at 55°C for 10 minutes. The concentration of the obtained Probe A was measured after purification and stored at -20°C for future use.

[0089] (2) The nucleic acid sequence of Probe B-18S-1842 is:

[0090]

[0091] The sequence consists of three functional units. The underlined sequence can complement the 5' end of Probe C1 and the 3' end of Probe C2; ​​the italic sequence is the spacer sequence; the bold sequence can complement the 18S rRNA ac 4 The upstream sequence of the C1842 site is complementary.

[0092] (3) The nucleic acid sequence of Probe C1 is:

[0093]

[0094] The sequence consists of three functional units. The underlined sequence can be complementary to the partial sequence of Probe A and Probe B; the italic sequence is the spacer sequence; and the bold sequence is consistent with the bold sequence of the detection probe.

[0095] (4) The nucleic acid sequence of Probe C2 is:

[0096]

[0097] The sequence consists of two functional units. The underlined sequence can complement the partial sequence of Probe A and Probe B; the italicized sequence is the spacer sequence.

[0098] (5) The detection probe sequence is:

[0099]

[0100] DP-MB is a molecular beacon modified at both ends with a fluorescent group and a quenching group. The underlined sequences at both ends can spontaneously complement each other to form a "hairpin"-like structure to ensure a low fluorescence signal background before detecting the target.

[0101] The above sequences can be redesigned according to the specific requirements of different RNA sites to ensure efficient binding of the probe molecules.

[0102] 4.F-ac 4 Probe A labeling of C: 10 μg HeLa cell total RNA, 5 mM TCEP, 100 mM Tris-HCl pH 7.5, 1 U / μL RNase inhibitor, 2.5 μM Probe A, add DEPC water to make up to 40 μL total volume. Incubate at 37°C for 12 hours to obtain Proba A labeled ac 4 C RNA (Probe A-ac 4 C). After purification, the RNA concentration was measured and stored at -80°C for future use. In addition, a control group of RNA not labeled with fluorine was set up.

[0103] 5. Connect circular template: 50ng / μL Probe A-ac 4 C, 100nM Probe B, 100nM Probe C1, 100nM Probe C2, 1×T4 DNA ligase buffer, 1U / μL 1×T4 DNA ligase, 1U / μL RNase inhibitor, add DEPC water to make up to 10μL total volume, incubate at 25℃ for 2 hours to obtain PLA-mix. Prepare the corresponding volume multiple of the solution according to the amount of experimental sample.

[0104] 6. Rolling circle amplification: 10 μL PLA-mix, 0.5 mM dNTPs, 1× phi29 DNA polymerase buffer solution, 1 U / μL phi29 DNA polymerase, add DEPC water to make up to 20 μL total volume, incubate at 30°C for 2-6 hours, incubate at 65°C for 10 minutes to inactivate the ligase, and obtain FL-mix.

[0105] 7. Detect fluorescence signal: Add 100nM DP-MB to 20μL FL-mix and make up to 50μL total volume with DEPC water. Incubate at 37℃ in the dark for 30 minutes, and test using a fluorescence spectrometer with the excitation wavelength set to 488nm and the emission wavelength set to 500-600nm.

[0106] The fluorescence signal intensity generated by the experiment is related to the 18S rRNA ac 4 The relationship between the content of C 1842 site and the total RNA quality of HeLa cells treated with ethyl fluoroacetate was studied. After total RNA was extracted from HeLa cells, 0, 1.95, 3.91, 7.81, 15.63, 31.25, and 62.50 pg / μL total RNA quality experimental groups were set. The preferred experimental conditions were: 2 hours of circular template connection and 4 hours of rolling circle amplification reaction. In the linear range, the fluorescence intensity at a wavelength of 520 nm was related to the content of F-ac 4 The correlation coefficient of RNA concentration with C was 0.995, the linear equation was F = 7.22 × C + 24.74, and the detection limit was 0.87 pg / μL. Figure 2 As shown in the experimental data, the present invention can detect ac in vitro 4 The experimental method of C has the advantages of good linearity and low detection limit, and can realize the detection of trace RNA in living cells. 4 C detection.

[0107] Example 2: 18S rRNA ac 4 In situ imaging of C 1842 sites

[0108] 1. Fluorine metabolic labeling of ac 4 C RNA

[0109] (1) When HeLa cells reach the logarithmic growth phase, 10 μL of ethyl fluoroacetate solution (2 M) is added to 10 mL of DMEM medium and the cells are cultured for 12 hours in DMEM medium containing 2 mM ethyl fluoroacetate.

[0110] 2. Design and synthesis of Probe A, Probe B, Probe C1, Probe C2, Probe B-Random, 18S rRNA Block and detection probe sequence (DP)

[0111] (1) The design and synthesis of Probe A, Probe B, Probe C1 and Probe C2 refer to Example 1.

[0112] (2) The nucleic acid sequence of Probe B-Random is:

[0113]

[0114] The sequence consists of three functional units. The underlined sequence can complement the 5' end of Probe C1 and the 3' end of Probe C2; ​​the italic sequence is the spacer sequence; and the bold sequence is a random sequence that does not hybridize with the target RNA.

[0115] (3) The nucleic acid sequence of the 18S rRNA Block is:

[0116] 5'-GAAACCTTGTTACGACTTTTACTTCCTCTAGATAGTC.

[0117] This sequence can bind to the target RNA and, when used before Probe B binds to the target RNA, can block the binding of Probe B to the target RNA. It has a longer 37nt base complementary pairing region relative to the 22nt base complementary pairing region of Probe B and the target RNA.

[0118] 3. Cell Fixation and Permeabilization

[0119] The cell samples were fixed in PBS containing 4% (w / v) paraformaldehyde for 15 minutes at room temperature and then washed three times with PBS. Subsequently, the cells were permeabilized with PBS containing 0.5% (v / v) Triton-X-100 for 5 minutes and then washed twice with PBS.

[0120] 4. F-ac in cells 4 Probe A labeling of C RNA

[0121] The cell samples were incubated for 12 hours in 100 μL reaction buffer (consisting of 5 mM TCEP, 100 mM Tris-HCl pH 7.5, 10 μg / mL salmon sperm DNA, 1 U / μL RNase inhibitor, 0.25 mg / mL BSA) containing 400 nM Probe A. The cells were washed three times with TBST buffer.

[0122] 5. Ring template connection

[0123] (1) Cell samples were incubated at 37°C for 3 hours in 150 μL binding buffer (2×SSC buffer, 5 mM DTT, 1 mg / mL yeast tRNA, 1 U / μL RNase inhibitor, 10 μg / mL salmon sperm DNA, 0.25 mg / mL BSA) supplemented with 100 nM Probe B. The samples were then washed three times with 2×SSC buffer containing 10% (v / v) formamide.

[0124] (2) The cell samples were incubated at 37°C for 3 hours in 150 μL binding buffer (2×SSC buffer, 5 mM DTT, 1 mg / mL yeast tRNA, 1 U / μL RNase inhibitor, 10 μg / mL salmonsperm DNA, 0.25 mg / mL BSA) supplemented with 100 nM Probe C1 and 100 nM Probe C2. The samples were then washed three times with 2×SSC buffer containing 10% (v / v) formamide.

[0125] (3) The cell samples were incubated in 100 μL of ligation buffer (1×T4 DNA ligase buffer, 1 U / μL T4 DNA ligase, 1 U / μL RNase inhibitor) at 37°C for 2 hours. After the reaction, the cells were washed three times with TBST.

[0126] 6. Rolling circle amplification reaction

[0127] The cell samples were reacted in 100 μL amplification buffer (1× phi29 DNA polymerase reaction buffer, 0.25 mM dNTPs, 1 U / μL RNase inhibitor, 1 U / μL phi29 DNA polymerase) at 37°C for 16 hours, and then washed three times with TBST.

[0128] 7. Detection Probe Incubation

[0129] The cell samples were incubated at 37°C for 4 hours in 100 μL probe hybridization buffer (2×SSC buffer, 10 μg / mL salmon sperm DNA, 0.25 mg / mL BSA, 1 U / μL RNase inhibitor) with 100 nM DP-MB added, and then washed three times with 2×SSC buffer containing 10% (v / v) formamide. DP-MB can also be replaced by a fluorescent label-modified oligonucleotide chain (DP-FAM). In this example, its sequence is:

[0130]

[0131] Figure 3 The present invention is directed against 18S rRNA ac 4 The feasibility of in situ imaging of cells at the C1842 site was verified. The feasibility of the present invention was verified by setting up control groups with different component deficiencies. Among them, only the experimental group showed obvious dot-like fluorescence signals, which were mainly distributed in the cytoplasm and a small amount in the nucleus, which was consistent with the cellular localization of 18S rRNA. The control group with component deficiencies and the control group using 18S rRNA Block chain to block Probe B and target RNA binding sites both showed very small amounts of fluorescence signals. These confocal microscope imaging results show that the present invention can achieve specific ac in cells. 4 Imaging of the C site.

[0132] Example 3: ac of 18S rRNA and mRNA in various cell types 4 In situ imaging detection of C site

[0133] The steps of Example 3 differ from those of Example 2 in that:

[0134] (1) In step (1), three other cells are involved: MCF-10A, HEK293T, and U2OS.

[0135] (2) In step (2), the ASPH mRNA ac 4 The probe B at the C 2692 site was designed and synthesized, and its specific nucleic acid sequence is:

[0136]

[0137] The sequence consists of three functional units. The underlined sequence can complement the 5' end of Probe C1 and the 3' end of Probe C2; ​​the italic sequence is the spacer sequence; the bold sequence can complement the 2692 ac of ASPH mRNA. 4 The upstream sequence of the C site is complementary.

[0138] Figure 4 Imaging 18S rRNA ac in various cell lines for the present invention 4 C 1842 locus and ASPH mRNA ac 4 The confocal microscopy results of the C2692 site. The content of ASPH mRNA in cells is relatively low, and the modification level is not as high as that of 18S rRNA. Therefore, compared with the fluorescence signal of 18S rRNA, the fluorescence signal points of ASPH-2692 are fewer, and the content in different cells is different. These results show that the present invention can effectively detect the RNA ac 4 Universal applicability of C-site imaging.

[0139] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A method for ac 4 An in vitro detection or cell imaging method for C RNA, characterized in that The following steps are involved: (1) Add the fluorine metabolic labeling precursor compound to the cell culture medium containing the cells to be tested and incubate the cells to metabolize the RNA to label the fluorine element to generate F-ac 4 C RNA; (2) Add F-ac 4 C site-specific probe Probe A, through the fluorothiol displacement reaction, Probe A and F-ac 4 C RNA reaction to generate ac with Probe A label 4 C RNA; The 5' end of Probe A is modified with a thiol-containing compound, and Probe A contains a spacer sequence, a sequence complementary to the 5' end sequence of Probe C2, and a sequence complementary to the 3' end sequence of Probe C1 from the 5' end to the 3' end; (3) Add RNA sequence-specific probe Probe B, and make Probe B and F-ac complementarily paired 4 Hybridize with the RNA sequence adjacent to the C site; introduce two 5'-end phosphorylated DNA chains, Probe C1 and Probe C2, which complementarily pair with Probe A and Probe B to form a circular template precursor, which is then connected into a circle under the action of DNA ligase; The Probe B contains, from the 5' end to the 3' end, a sequence complementary to the 5' end sequence of Probe C1, a sequence complementary to the 3' end sequence of Probe C2, a spacer sequence, a sequence complementary to the RNA ac 4 The sequence that complements the adjacent sequence of the C site; The Probe C1 contains, from the 5' end to the 3' end, a sequence complementary to the 5' end sequence of Probe B, a spacer sequence, a sequence identical to the middle part or the entire sequence of the detection probe, a spacer sequence, and a sequence complementary to the 3' end sequence of Probe A; The Probe C2 contains, from the 5' end to the 3' end, a sequence complementary to a partial sequence of Probe A, a spacer sequence, and a sequence complementary to a partial sequence of Probe B; (4) The product obtained in step (3) is extended by DNA polymerase starting from the 3' end of Probe A to generate a rolling circle amplification product; (5) After adding the detection probe to the rolling circle amplification product and incubating in the dark, use a fluorescence detector to measure the fluorescence intensity of the rolling circle amplification product, or use a fluorescence microscope to observe the distribution of the rolling circle amplification product in the cell; The detection probe comprises a fluorescently modified oligonucleotide chain or a molecular beacon, which can combine with the rolling circle amplification product to generate a detectable fluorescent signal.

2. The method according to claim 1, characterized in that: The fluorine metabolic labeling precursor compounds include fluoroacetate and fluoroacetate ester compounds.

3. The method according to claim 1, characterized in that The method described is used for ac 4 The in vitro detection of C RNA includes the following steps: (1) adding a fluorine metabolic labeling precursor compound to a cell culture medium containing cells to be tested, and incubating the culture medium, and extracting total RNA from the cells after incubation; (2) Total cell RNA and Probe A are added to the reaction buffer and incubated to generate ac 4 C RNA; (3) The ac with Probe A label obtained in step (2) 4 C RNA, Probe B, Probe C1, and Probe C2 are incubated in a system containing DNA ligase and DNA ligase buffer to generate a circular template; (4) the product obtained in step (3) is subjected to a rolling circle amplification reaction in a system containing dNTPs, DNA polymerase and DNA polymerase buffer to generate a rolling circle amplification product; (5) Add detection probes to the rolling circle amplification product, incubate in the dark, and use a fluorescence detector to detect the fluorescence signal.

4. The method according to claim 3, characterized in that: In step (2), the reaction buffer comprises: 1-10 mM TCEP, 50-150 mM Tris-HCl pH 7.0-8.0, and 0.1-2 U / μL RNase inhibitor.

5. The method according to claim 1, characterized in that The method described is used for ac 4 C RNA cell imaging includes the following steps: (1) adding a fluorine metabolic labeling precursor compound to a cell culture medium containing cells to be tested and incubating the cells; fixing the incubated cells with paraformaldehyde and then permeabilizing them with Triton-X-100; (2) Incubate the cells in a reaction buffer containing Probe A to generate ac 4 C RNA; (3) Ring template connection 1) Place the cells in a binding buffer containing Probe B to allow Probe B to bind to the ac 4 C RNA hybridization; the cells are then incubated in a binding buffer containing Probe C1 and Probe C2 to form a precursor of the circular template; 2) incubating the cells in a ligation buffer to achieve ligation of the circular template; (4) placing the cells in an amplification buffer to perform a rolling circle amplification reaction to generate a rolling circle amplification product; (5) The cells are placed in a hybridization buffer containing the detection probe and incubated in the dark to achieve in situ hybridization of the detection probe and the rolling circle amplification product. Finally, the fluorescence signal is observed using a fluorescence microscope.

6. The method according to claim 5, characterized in that: In step (2), the reaction buffer comprises: 1-10 mM TCEP, 50-150 mM Tris-HCl pH 7.0-8.0, 5-15 μg / mL salmon sperm DNA, 0.1-2 U / μL RNase inhibitor, and 0.1-0.5 mg / mL BSA.

7. The method according to claim 5, characterized in that: In step (3), the binding buffer comprises: 2×SSC buffer, 1-10 mM DTT, 0.1-5 mg / mL yeast tRNA, 0.1-2 U / μL RNase inhibitor, 5-15 μg / mL salmon sperm DNA, and 0.1-0.5 mg / mL BSA.

8. The method according to claim 5, characterized in that: In step (5), the hybridization buffer comprises: 2×SSC buffer, 5-15 μg / mL salmon sperm DNA, 0.1-0.5 mg / mL BSA, and 0.1-2 U / μL RNase inhibitor.

9. The method according to any one of claims 1 to 8, characterized in that: The sequence of Probe A is: AAAAAAAATATGACAGAACTAGACACTCTT; The sequence of Probe B is: GACGCTAATAGTTAAGACGCTTAAAAAAAAAA - which is identical to RNA ac 4 The sequence that complements the adjacent sequence of the C site; The sequence of Probe C1 is: CTATTAGCGTCCAGTGAATGCGAGTCTCGAGGTGCATTCATATCAGCAGCCGTCAAGAGT GTCTA; The sequence of Probe C2 is: GTTCTGTCATATTTAAGCGTCTTAA; The sequence of the detection probe is: CGACGACTCGAGGTGCATTCATATTCGTCG, and both ends thereof are modified with a fluorescent group and a quenching group; or the sequence of the detection probe is: CTCGAGGTGCATTCATAT, and the 5' end thereof is modified with a fluorescent group.

10. A method for ac 4 A probe combination for in vitro detection of C RNA or cell imaging, characterized in that: Comprising the F-ac described in claim 1 4 C site-specific probe Probe A, RNA sequence-specific probe Probe B, Probe C1, Probe C2, detection probe.

Images