Application of reagents for detecting the expression of gene Aqp8 in the preparation of diagnostic products for TFEB rearranged renal cell carcinoma

Abstract

This application belongs to the field of biotechnology, and specifically relates to the use of reagents for detecting the expression of gene Aqp8 in the preparation of diagnostic products for TFEB rearranged renal cell carcinoma. This application constructs a mouse model of TFEB rearranged renal cell carcinoma, explores the key downstream target genes and signaling pathways of PTEC overexpressing Tfeb leading to renal carcinoma, screens out the top three genes with the highest multiple differences, Tyrp1, Aqp8, and Gpnmb, and establishes specific biomarkers and therapeutic targets for the diagnosis of TFEB rearranged renal cell carcinoma based on them, providing a new technical approach for clinical search for tumor biomarkers and therapeutic targets for TFEB rearranged renal cell carcinoma.

Description

[0001] This application is a divisional application. The application number of the original application is "2023115941098", the name of the invention is "Application of reagents for detecting gene expression levels in the preparation of TFEB rearranged renal cell carcinoma diagnostic products", and the application date is November 27, 2023. Technical Field

[0002] The present application belongs to the field of biotechnology, and specifically relates to the application of a reagent for detecting gene expression in the preparation of a diagnostic product for TFEB rearranged renal cell carcinoma. Background Art

[0003] TFEB-rearranged renal cell carcinoma is a subtype of renal cell carcinoma that is common in children and adolescents. Although TFEB-rearranged renal cell carcinoma is a low-grade non-invasive tumor, 17% of patients still show invasiveness clinically, and about 17% of children and adolescent patients relapse after surgery. Adult patients show stronger invasiveness, often metastases at the time of initial diagnosis, and patients with metastasis have a poor prognosis. Because of its wide range of morphological characteristics, it is difficult to accurately diagnose the disease by pathology. Currently, fluorescence in situ hybridization (FISH) testing is the gold standard for diagnosing the disease. However, since FISH testing is complex and expensive, in-depth research and clarification of the pathogenesis of TFEB-rearranged renal cell carcinoma, and the search for effective and lower-cost specific diagnostic markers and therapeutic targets are urgently needed for the current clinical diagnosis and treatment of the disease.

[0004] The "TFEB gene" in TFEB-rearranged renal cell carcinoma, namely transcription factor EB, is a member of the microphthalmia-associated transcription factor (MIT) family. The other three members are TFE3, TFEC and MiTF. The most common translocation form of this disease is the fusion of the TFEB gene on chromosome 6 and the Alph (MALAT1) gene on chromosome 11, forming the Alpha-TFEB fusion gene, which leads to the continuous overexpression of TFEB. In recent years, after the Cancer Genome Atlas (TCGA) database conducted a systematic molecular biological characteristic analysis of renal cell carcinoma, a variety of new translocation genes fused with TFEB were discovered, such as KHDRBS2, COL21A1, CADM2, CLTC, EWSR1, ACTB and PPP1R10, which further indicates that the incidence and missed diagnosis rate of this disease may be much higher than the current clinical cognition.

[0005] Currently, there are no diagnostic products for TFEB-rearranged renal cell carcinoma. Summary of the invention

[0006] Based on this, an embodiment of the present application provides an application of a reagent for detecting gene expression in the preparation of a diagnostic product for TFEB rearranged renal cell carcinoma.

[0007] On the one hand, the present application provides the use of a reagent for detecting the expression level of genes Tyrp1, Aqp8 or Gpnmb in the preparation of a diagnostic product for TFEB rearranged renal cell carcinoma.

[0008] In one embodiment, the reagent for detecting the expression level of gene Tyrp1, Aqp8 or Gpnmb includes one or both of a reagent for detecting the content of protein product expressed by gene Tyrp1, Aqp8 or Gpnmb and a reagent for detecting the content of transcribed mRNA.

[0009] In one embodiment, the reagents include primers for detecting the expression level of the gene Tyrp1, Aqp8 or Gpnmb using the PT-PCR principle.

[0010] In one embodiment, the primers include a detection primer pair as shown in SEQ ID NO.1 to SEQ ID NO.6.

[0011] The present application also provides reagents for promoting the expression of genes Tyrp1, Aqp8 or Gpnmb, transcription products of genes Tyrp1, Aqp8 or Gpnmb, or use of expression products of genes Tyrp1, Aqp8 or Gpnmb in the preparation of drugs for the prevention, treatment or prognosis of TFEB rearranged renal cell carcinoma.

[0012] The present application also provides a kit for detecting TFEB rearranged renal cell carcinoma, wherein the kit comprises a reagent for detecting the expression level of gene Tyrp1, Aqp8 or Gpnmb.

[0013] In one embodiment, the kit includes one or both of a reagent for detecting protein expression and a reagent for detecting mRNA expression of genes Tyrp1, Aqp8 or Gpnmb.

[0014] In one embodiment, the kit further comprises primers for detecting the expression level of gene Tyrp1, Aqp8 or Gpnmb using the PT-PCR principle.

[0015] In one embodiment, the primers include a detection primer pair as shown in SEQ ID NO.1 to SEQ ID NO.6.

[0016] In one embodiment, the kit further includes one or more of a negative control, a positive control and a quality control product.

[0017] On the other hand, the present application also provides a drug for preventing, treating or prognosing TFEB rearranged renal cell carcinoma, the active ingredients of which include one or more of an agent expressing gene Tyrp1, Aqp8 or Gpnmb, a transcription product of gene Tyrp1, Aqp8 or Gpnmb, or an expression product of gene Tyrp1, Aqp8 or Gpnmb.

[0018] In one embodiment, it also includes pharmaceutically acceptable excipients.

[0019] In one embodiment, the auxiliary material is selected from one or more of a diluent, a binder, a disintegrant, a lubricant and a wetting agent.

[0020] This application constructs a mouse model of TFEB-rearranged renal cell carcinoma, explores the key downstream target genes and signaling pathways that lead to renal carcinogenesis by overexpressing Tfeb in PTEC, screens out the top three genes with the highest difference folds, Tyrp1, Aqp8, and Gpnmb, and establishes specific biomarkers and therapeutic targets for the diagnosis of TFEB-rearranged renal cell carcinoma based on them, providing a new technical approach for the clinical search for tumor biomarkers and therapeutic targets for TFEB-rearranged renal cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0022] Figure 1 Develop strategies for gene-edited mice with conditional overexpression of TFEB;

[0023] Figure 2 For Tfeb fl / + , genotype identification and gene overexpression efficiency verification of Ggt1-cre mice;

[0024] Figure 3 The effect of conditional overexpression of Tfeb in PTEC on the survival curve and renal function of mice;

[0025] Figure 4 The effect of conditional overexpression of Tfeb in PTEC on the kidney size of mice;

[0026] Figure 5 The effect of conditional overexpression of Tfeb in PTEC on the morphology and structure of mouse kidney;

[0027] Figure 6Conditional overexpression of Tfeb in PTEC mice led to renal carcinogenesis;

[0028] Figure 7 Analysis of transcriptomic sequencing results of PTEC conditionally overexpressing Tfeb mice;

[0029] Among them, targeting strategy is the targeting strategy; wild type allele is the wild type allele; targeting vector is the positioning vector; percent survival is the survival rate, transcriptional stopelement is the transcription stop; kidney weight is the kidney weight; body weight is the body weight. DETAILED DESCRIPTION

[0030] Below in conjunction with embodiment and example, the application is further described in detail.It should be understood that these embodiments and examples are only used to illustrate the application and are not used to limit the scope of the application, and the purpose of providing these embodiments and examples is to make the understanding of the disclosure of the application more thorough and comprehensive.It should also be understood that the application can be implemented in many different forms, is not limited to the embodiment and example described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the application, and the equivalent form obtained also falls within the protection scope of the application.In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the application, and it should be understood that the application can be implemented without one or more of these details.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0032] the term

[0033] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the application purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0034] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0035] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the any and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in the present application, the technical solution undoubtedly includes technical solutions connected by "logical and", and also undoubtedly includes technical solutions connected by "logical or".

[0036] The term "conditional overexpression" In mice, the Cre-lox system was originally used to turn on gene expression in specific cell populations. The Flox mice required for conditional gene expression generally carry a silent transgene, that is, there is a "stop box" (lox-stop-lox) between the target gene and the promoter. This "stop box" is usually composed of a strong polyA signal and / or a splice donor sequence, which can prevent the transcription of the transgene. In the offspring mice obtained after mating these Flox mice with transgenic mice that express Cre in a cell type-specific manner, the stop box is excised by Cre in each cell expressing the Cre recombinase, so the desired transgene is expressed only in these cells.

[0037] The term "transcriptome sequencing" Transcriptome sequencing (mRNA Sequencing, mRNA-Seq) is a technology that uses high-throughput sequencing technology to reveal a snapshot of the existence and quantity of RNA from a genome at a given moment, providing a new perspective for life science research. It can be used to predict gene structure, alternative splicing and other transcriptional modifications, and can quantitatively measure changes in the expression level of each transcript during growth and under different conditions.

[0038] Studies have found that AQP8 regulates esophageal cancer cell migration through the EGFR-ERK1 / 2 signaling pathway. Knockdown of AQP8 on the inner membrane of mitochondria in human liver cancer HepG2 cells leads to ROS-induced mitochondrial depolarization and loss of activity, ultimately leading to tumor cell death. Glycoprotein nonmelanosoma protein B (GPNMB) is a highly glycosylated type I transmembrane glycoprotein that is localized to the cell membrane or stored in endosomes and lysosomes. GPNMB is highly expressed in various tumor tissues (prostate cancer, breast cancer, lung cancer, etc.), promoting tumor cell proliferation and metastasis. Knockdown of GPNMB can inhibit the growth, proliferation, metastasis and invasion of cancer cells. The above shows that high expression of TYRP1, AQP8 and GPNMB may be the key mechanism mediating the occurrence of TFEB rearranged renal cell carcinoma.

[0039] TFEB binds to the CLEAR element (the so called coordinated lysosomal expression and regulation motif) in the promoter region of its target gene through the bHLH-ZL (basic helix-loop-helix-leucine-zipper) domain, thereby activating the transcription of its downstream genes. This is the main way for TFEB to regulate the expression of its target genes.

[0040] On the one hand, the present application provides the use of a reagent for detecting the expression level of genes Tyrp1, Aqp8 or Gpnmb in the preparation of a diagnostic product for TFEB rearranged renal cell carcinoma.

[0041] In one embodiment, the reagent for detecting the expression level of gene Tyrp1, Aqp8 or Gpnmb includes one or both of a reagent for detecting the content of the protein product expressed by gene Tyrp1, Aqp8 or Gpnmb and a reagent for detecting the content of the transcribed mRNA.

[0042] Optionally, the reagents for detecting protein expression include reagents used in the following methods: protein blotting, enzyme-linked immunosorbent assay, radioimmunoassay, sandwich assay, immunohistochemical staining, mass spectrometry, immunoprecipitation analysis, complement fixation analysis, flow cytometry fluorescence separation technology and protein chip method.

[0043] In a specific example, the reagents for detecting the mRNA expression amount include reagents used in the following methods: PCR-based detection methods, Southern hybridization methods, Northern hybridization methods, dot hybridization methods, fluorescence in situ hybridization methods, DNA microarray methods, ASO methods, and reagents used in high-throughput sequencing platform methods.

[0044] The mRNA expression level auxiliary detection reagents include but are not limited to: reaction reagents that visualize the amplicon corresponding to the primer, such as reagents that visualize the amplicon by agarose gel electrophoresis, enzyme-linked gel electrophoresis, chemiluminescence, in situ hybridization, fluorescence detection, etc., RNA extraction reagents, reverse transcription reagents, cDNA amplification reagents, standard substances used to prepare standard curves, positive controls, and negative controls.

[0045] Optionally, the protein expression amount auxiliary detection reagents include but are not limited to: blocking solution, antibody diluent, washing buffer, color development stop solution, and standard substances for preparing standard curve.

[0046] In a specific example, the reagents for detecting protein expression include reagents used in the following methods: protein blotting, enzyme-linked immunosorbent assay, radioimmunoassay, sandwich assay, immunohistochemical staining, mass spectrometry, immunoprecipitation analysis, complement fixation analysis, flow cytometry fluorescence separation technology and protein chip method.

[0047] It can be understood that the reagents include primers for detecting the expression of genes Tyrp1, Aqp8 or Gpnmb using the PT-PCR principle, and the primers include detection primer pairs as shown in SEQ ID NO.1 to SEQ ID NO.6.

[0048] The present application also provides reagents for promoting the expression of genes Tyrp1, Aqp8 or Gpnmb, transcription products of genes Tyrp1, Aqp8 or Gpnmb, or use of expression products of genes Tyrp1, Aqp8 or Gpnmb in the preparation of drugs for the prevention, treatment or prognosis of TFEB rearranged renal cell carcinoma.

[0049] On the other hand, the present application provides a kit for detecting TFEB rearranged renal cell carcinoma, the kit comprising a reagent for detecting the expression level of gene Tyrp1, Aqp8 or Gpnmb.

[0050] In a specific example, the kit includes one or both of a reagent for detecting protein expression and a reagent for detecting mRNA expression of genes Tyrp1, Aqp8 or Gpnmb.

[0051] Optionally, the kit further comprises a detection primer pair as shown in SEQ ID NO.1 to SEQ ID NO.6. It is understood that the following primer sequences are designed for the homologous fragments of Tyrp1, Aqp8 and Gpnmb genes in mice and humans, have cross-species universality, and can be used to detect the expression level of related marker genes in deep renal cell carcinoma tissues of TFEB rearranged renal cell carcinoma patients and model mice.

[0052] Tyrp1 primer F1:ctcacatggcacaggtacca(5'-3')(SEQ ID NO.1)

[0053] Tyrp1 primer R1:ctggatcccatcaagtcatc(5'-3')(SEQ ID NO.2)

[0054] Aqp8 primer F1: gctctcttcatcttcatcgg(5'-3')(SEQ ID NO.3)

[0055] Aqp8 primer R1: gcagggttgaagtgtccacc(5'-3')(SEQ ID NO.4)

[0056] Gpnmb primer F1: gagaagttcgatggcaac(5'-3')(SEQ ID NO.5)

[0057] Gpnmb primer R1: catgcttgtcacgaagca(5'-3')(SEQ ID NO.6)

[0058] Further optionally, the kit also includes one or more of a negative control, a positive control and a quality control product.

[0059] The present application also provides a drug for treating TFEB rearranged renal cell carcinoma, the active ingredients of which include one or more of an agent expressing gene Tyrp1, Aqp8 or Gpnmb, a transcription product of gene Tyrp1, Aqp8 or Gpnmb, or an expression product of gene Tyrp1, Aqp8 or Gpnmb.

[0060] Optionally, the dosage form of the drug is one or more of tablets, capsules, granules, pills, injections and sustained-release preparations.

[0061] Further optionally, the pharmaceutically acceptable excipient is selected from one or more of a diluent, a binder, a disintegrant, a lubricant and a wetting agent.

[0062] Wherein, the diluent is selected from at least one of starch, dextrin, sucrose, glucose, lactose, mannitol, sorbitol, xylitol, microcrystalline cellulose, calcium sulfate, calcium hydrogen phosphate and calcium carbonate.

[0063] The binder is selected from at least one of starch slurry, dextrin, syrup, honey, glucose solution, microcrystalline cellulose, acacia slurry, gelatin slurry, sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, acrylic resin, carbomer, polyvinyl pyrrolidone and polyethylene glycol.

[0064] The disintegrant is selected from at least one of starch, microcrystalline cellulose, low-substituted hydroxypropyl cellulose, cross-linked polyvinyl pyrrolidone, cross-linked sodium carboxymethyl cellulose, sodium carboxymethyl starch, polyoxyethylene, sorbitol, fatty acid ester and sodium dodecyl sulfate.

[0065] Wherein, the lubricant is selected from at least one of talc, silicon dioxide, stearate, tartaric acid, liquid paraffin and polyethylene glycol.

[0066] The wetting agent is selected from at least one of water, ethanol and isopropanol.

[0067] Optionally, the drug is an injection, and the pharmaceutically acceptable excipient is selected from at least one of a solubilizer, a pH regulator and an osmotic pressure regulator.

[0068] Further optionally, the solubilizing agent is selected from at least one of ethanol, isopropanol, propylene glycol, polyethylene glycol, poloxamer, lecithin and hydroxypropyl-β-cyclodextrin.

[0069] Among them, the pH regulator is selected from at least one of citrate, phosphate, carbonate, acetate, hydrochloric acid and hydroxide, and the osmotic pressure regulator is selected from at least one of sodium chloride, mannitol, glucose, phosphate, citrate and acetate.

[0070] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0071] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0072] Example 1: Construction and characterization of a mouse model of TFEB-rearranged renal cell carcinoma

[0073] 1. Genotyping of PTEC mice with conditional overexpression of Tfeb and verification of gene overexpression efficiency

[0074] In the present application, the commonly used cre-loxP system is selected as the gene editing scheme of conditional gene editing mice, and a gene editing mouse with a Tfeb conditional overexpression sequence (CAG-loxP-STOP-loxP-Tfeb) inserted at the Rosa26 locus is constructed, and the gene editing mouse is hybridized with a Ggt1-cre mouse that can specifically express the cre recombinase in proximal tubule epithelial cells (PTEC), thereby successfully obtaining a mouse that conditionally overexpresses Tfeb in PTEC (Tfeb fl / + , Ggt1-cre mice), and the construction strategy was as Figure 1 shown.

[0075] Ggt1-cre mice were crossed with Tfeb fl / + or Tfeb fl / fl Mouse hybridization successfully obtained Tfeb fl / + , Ggt1-cre mice, such as Figure 2 As shown in A, mice conditionally overexpressing Tfeb in PTEC. Tfeb was detected by RT-PCR and immunoblotting fl / + , the overexpression efficiency of Ggt1-cre mice, as Figure 2 The results showed that compared with Ggt1-cre mice, Tfeb fl / + , Tfeb mRNA and TFEB protein levels in Ggt1-cre mice were significantly increased (P<0.0001 and P<0.01). At the same time, to further verify that TFEB protein was specifically overexpressed in PTEC, TFEB and LTL (a marker of PTEC) were co-stained by immunofluorescence staining, and the results showed that Tfeb fl / + In the renal tissue of Ggt1-cre mice, LTL-positive tubules (i.e., proximal tubules) all expressed TFEB. Figure 2 As shown in FIG. E, the above results indicate that the present application successfully achieved conditional overexpression of Tfeb in mouse PTEC.

[0076] in, Figure 2 A in the figure is the genotype of mice detected by PCR, Tfeb fl / + , Ggt1-cre mice had bands at both 500 bp and 248 bp. Figure 2 B in the figure is the RT-PCR method to detect the Tfeb mRNA level in mouse kidney tissue. Figure 2 C in the figure shows the protein expression level of TFEB in mouse kidney tissue detected by immunoblotting. Figure 2 D in the figure is the statistical result of the average relative gray value of TFEB protein. Figure 2 E in the figure shows the expression and localization of TFEB and LTL in mouse kidney tissue detected by immunofluorescence.

[0077] 2. Conditional overexpression of Tfeb in PTEC leads to decreased survival and abnormal renal function in mice

[0078] This study found that compared with Ggt1-cre mice, Tfeb fl / + The survival rate of Ggt1-cre mice was significantly reduced (P<0.0001), and the survival rate decreased with the increase of age. Figure 3 As shown in A (Tfeb was also found fl / + The renal function indicators of Ggt1-cre mice, serum creatinine and blood urea nitrogen, increased significantly at 3 and 4 weeks after birth (P<0.001 and P<0.05). Figure 3 In addition, no obvious abnormalities were found in other organs during autopsy. These results suggest that the death of mice may be related to the failure of their renal function.

[0079] in, Figure 3 A in the figure is the mouse survival curve. Note: The horizontal axis represents the number of days after the mouse is born. Figure 3 B in the figure is the detection of blood urea nitrogen in mice of different ages. Figure 3 C in the figure is the blood creatinine detected in mice of different ages.

[0080] 3. Conditional overexpression of Tfeb in PTEC leads to polycystic kidney disease in mice

[0081] (1) The applicant found that compared with Ggt1-cre mice, Tfeb fl / + Ggt1-cre mice showed significant kidney enlargement. Figure 4 As shown in AB in Figure 1, kidney weight began to increase from 1 week after birth (P<0.01), and kidney weight and kidney weight / body weight increased significantly 3 weeks after birth (P<0.0001). Figure 4 as shown in the CD.

[0082] in, Figure 4 AB in the figure represents the size change of mouse kidney, and the circled part refers to the kidney. Figure 4 C in FIG. 1 is a line graph of kidney weights of mice at different ages. Figure 4 D in the figure is a line graph of kidney weight / body weight of mice at different ages.

[0083] (2) Effects of conditional overexpression of Tfeb in PTEC on the morphology and structure of mouse kidney

[0084] Ultrasound examination of the kidneys of mice 3 weeks after birth revealed that Tfeb fl / + The kidneys of Ggt1-cre mice showed many cysts of different sizes. Figure 4As shown in A. Similarly, HE staining revealed that Tfeb fl / + As the age of Ggt1-cre mice increases, the size of the kidneys gradually increases, and the number of cysts increases. Figure 4 As shown in B, the incidence of renal lesions was 100%.

[0085] in, Figure 5 Figure A shows the kidney morphology of a living mouse 3 weeks after birth, as examined by ultrasound. The arrow on the left side of Figure A refers to the kidney of a control mouse, and the arrow on the right side of Figure A refers to the cystic cavity in the mouse kidney. Figure 5 B is the HE-stained pathological image of the whole kidney cross section of mice of different ages.

[0086] (3) Conditional overexpression of Tfeb by PTEC leads to renal cancer in mice

[0087] In-depth observation of the renal lesions in mice revealed that the lesions in the kidneys of PTEC-overexpressing Tfeb mice initially manifested as enlargement of the renal tubular lumen, with the tubular wall gradually changing from a single-layer cell structure to a multi-layer structure, losing the single-layer distribution characteristics of the proximal tubular epithelial cells, and the appearance of cell cancer nests in some cystic cavities. Finally, the cells in the cystic cavity fell off and became transparent, such as Figure 6 As shown in A.

[0088] Immunofluorescence results showed that compared with Ggt1-cre mice, Tfeb fl / + TFEB was overexpressed in the renal lesions of Ggt1-cre mice, and PTEC gradually lost LTL, suggesting that PTEC may have undergone transdifferentiation, such as Figure 6 As shown in B. Immunohistochemistry revealed Tfeb fl / + , CD10 and PAX8, the renal cancer indicators of Ggt1-cre mice, were positively expressed, and Vimentin and P504S were focally positively expressed, such as Figure 6 As shown in C. The above results indicate that PTEC overexpression of Tfeb leads to the occurrence of renal cancer.

[0089] in, Figure 6 A in the figure is the HE staining pathological image of the kidneys of mice of different ages. Figure 6 B in the figure shows the changes and localization of TFEB and LTL in renal tissues of mice of different ages detected by immunofluorescence. Figure 6 C in the figure is the immunohistochemical method to detect Tfeb fl / + , renal cancer markers CD10, PAX8, Vimentin and P504S in the renal tissue of Ggt1-cre mice.

[0090] Example 2

[0091] Analysis of transcriptomic sequencing results of PTEC conditionally overexpressing Tfeb mice

[0092] In order to explore the specific mechanism of renal cancer induced by overexpression of Tfeb and screen specific tumor biomarkers, the applicant selected Ggt1-cre mice and Tfeb at 1, 2, and 3 weeks after birth. fl / + , Ggt1-cre mice, 3 mice in each group, a total of 18 kidney tissue samples were sequenced. First, the correlation test results of the sequencing results showed that the differences within each group were small and the repeatability of the samples was good, such as Figure 7 As shown in A. Then, 4 differentially expressed genes that were significantly upregulated (high upregulation fold) at 1 week, 2 weeks, and 3 weeks were selected from the sequencing results for RT-PCR verification.

[0093] The results showed that compared with Ggt1-cre mice, Tfeb fl / + The differentially expressed genes in the kidney tissue of Ggt1-cre mice were significantly increased (P<0.05). Figure 7 As shown in B, the sequencing results are reliable. Then the differentially expressed genes were divided into 9 clusters according to their expression patterns. The gene expression trends in each cluster were similar, and Tfeb was selected. fl / + , the differentially expressed genes in Ggt1-cre mice were analyzed in the clusters that were upregulated at 3 weeks of age, i.e., Cluster 3, e.g. Figure 7 As shown in C. For genes in Cluster 3, Tfeb fl / + , a total of 24 genes were screened under the condition that the gene abundance of Ggt1-cre mice was >100, such as Figure 7 Then the top three genes with the highest fold difference, Tyrp1, Aqp8, and Gpnmb, were selected for PT-PCR verification. The results showed that compared with Ggt1-cre mice, Tfeb fl / + The mRNA levels of Tyrp1, Aqp8, and Gpnmb in Ggt1-cre mice were significantly increased (P<0.05), and the results were consistent with the sequencing results. Figure 7 As shown in E. At the same time, the website predicted that Tyrp1, Aqp8, and Gpnmb are all possible downstream target genes of TFEB, such as Figure 7 As shown in F.

[0094] in, Figure 7 A in the figure is the correlation analysis diagram of each sample. CON represents Ggt1-cre mice, OE represents Tfeb fl / +, Ggt1-cre mice; P6 represents mice 6 days after birth (1 week), P14 represents mice 14 days after birth (2 weeks), and P21 represents mice 21 days after birth (3 weeks). Figure 7 B in the figure shows the RT-PCR method for detecting the mRNA levels of Tfeb, Maoa, Sox9 and Pmel in sequencing samples of mice of different ages. Figure 7 C in the figure is a cluster in which the differentially expressed genes of Tfeb-overexpressing mice were upregulated at 3 weeks of age.

[0095] Example 3: Design of RT-PCR primers for three genes common to humans and mice: Tyrp1, Aqp8 and Gpnmb

[0096] The following primer sequences are designed for the homologous fragments of Tyrp1, Aqp8 and Gpnmb genes in mice and humans, and are cross-species universal, and can be used to detect the expression levels of related marker genes in deep renal cell carcinoma tissues of TFEB rearranged renal cell carcinoma patients and model mice, as shown in Table 1:

[0097] Table 1

[0098]

[0099] Product sequence information:

[0100] Tyrp1 primer F1:ctcacatggcacaggtacca(5'-3')(SEQ ID NO.1)

[0101] Tyrp1 primer R1:ctggatcccatcaagtcatc(5'-3')(SEQ ID NO.2)

[0102] Synthetic fragment mouse (146 bp) (5'-3'):

[0103] ctcacatggcacaggtaccatctgctgcagctggagagagacatgcaggagatgctgcaggagccttctttctcccttccttactggaattttgca actgggaaaaacgtctgcgatgtctgcactgatgacttgatggggatccag(SEQ ID NO.7)

[0104] Synthetic fragment human (146bp) (5'-3'):

[0105] ctcacatggcacaggtaccacctcctgcgtctggagaaagacatgcaggaaatgttgcaagagccttctttctcccttccttactggaattttgcaa cggggaaaaatgtctgtgatatctgcacggatgacttgatgggatccag(SEQ ID NO.8)

[0106] Aqp8 primer F1: gctctcttcatcttcatcgg(5’-3’)(SEQ ID NO.3)

[0107] Aqp8 primer R1: gcagggttgaagtgtccacc(5’-3’)(SEQ ID NO.4)

[0108] Synthetic fragment mouse(146bp)(5’-3’):

[0109] gctctcttcatcttcatcggatgtctatcggtcattgagaatagtccgaatactgggctcctgcagcctgccttggctcatgggctggccttggggct catcattgctaccttggggaacatcagcggtggacacttcaaccctgc(SEQ ID NO.9)

[0110] Synthetic fragment human(146bp)(5’-3’):

[0111] gctctcttcatcttcatcgggtgcctgtcggtcattgagaatgggacggacactgggctgctgcagccggccctggcccacgggctggctttgg ggctcgtgattgccacgctggggaatatcagtggtggacacttcaaccctgc(SEQ ID NO.10)

[0112] Gpnmb primer F1: gagaagttcgatggcaac(5’-3’)(SEQ ID NO.5)

[0113] Gpnmb primer R1: catgcttgtcacgaagca(5’-3’)(SEQ ID NO.6)

[0114] Synthetic fragment mouse(123bp)(5'-3'):

[0115] gagaagttcgatggcaaccctgacatgctgggcatgcctttcatgtatcagtgccagctcttcatggaaaagagcaccagagatttctcagttgac cgcatccgtgtgtgcttcgtgacaagcatg (SEQ ID NO. 11)

[0116] Synthetic fragment human(123bp)(5'-3'):

[0117] gagaagttcgatggcaacccagacatgctggctcctttcatggcccagtgccagatcttcatggaaaagagcaccagggatttctcagttgatcg tgtccgtgtctgcttcgtgacaagcatg (SEQ ID NO. 12)

[0118] Example 4 Sensitivity and specificity verification

[0119] The performance of TFEB rearranged renal cell carcinoma samples was detected by PT-PCR method using the PT-PCR primers of Tyrp1, Aqp8 and Gpnmb genes common to humans and mice in Example 3.

[0120] Fifteen samples of TFEB rearranged renal cell carcinoma verified by FISH detection and 21 samples of common renal clear cell carcinoma with low expression of TFEB and TFE3 by immunohistochemistry were collected. The primer pairs in Example 3 were used to perform PT-PCR to detect the expression levels of the three genes Tyrp1, Aqp8 and Gpnmb. The adjacent tissues were used as controls. The target gene expression levels that were more than 3 times higher than the control group were recorded as high expression. The test results can effectively distinguish TFEB rearranged renal cell carcinoma samples from common renal clear cell carcinoma samples. The details are shown in Table 2:

[0121] Table 2

[0122]

[0123] The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. Application of a reagent for detecting the expression of gene Aqp8 in the preparation of a diagnostic product for TFEB rearranged renal cell carcinoma.

2. The use according to claim 1, characterized in that: The reagent for detecting the expression amount of the gene Aqp8 includes one or both of a reagent for detecting the content of the protein product expressed by the gene Aqp8 and a reagent for detecting the content of the transcribed mRNA.

3. The use according to any one of claims 1 to 2, characterized in that: The reagents include primers for detecting the expression level of gene Aqp8 using the PT-PCR principle.

4. The use according to claim 3, characterized in that: The primers include the detection primer pairs shown as SEQ ID NO.3 to SEQ ID NO.

4.

5. The use according to claim 3, characterized in that: The reagents also include one or more of a negative control, a positive control and a quality control product.

Images