A SNP molecular marker associated with duck cervical vertebra length and its application

Through whole-genome association analysis, a SNP molecular marker on the NC_040050.1 chromosome of Loumen duck was discovered, and specific primers were designed for PCR and sequencing, which solved the shortcomings of existing breeding methods in improving the cervical vertebrae length of Loumen duck and achieved significant breeding progress and rapid identification.

CN119162334BActive Publication Date: 2025-10-14JIANGSU INST OF POULTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411447592.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-16
Publication Date
2025-10-14
Estimated Expiration
2044-10-16

AI Technical Summary

Technical Problem

Existing breeding methods are becoming less effective in increasing the cervical vertebrae length of Loumen ducks, making it difficult to achieve rapid and significant genetic progress through conventional methods.

Method used

Through genome-wide association analysis, a SNP molecular marker (T/C mutation) associated with the cervical vertebra length of Loumen duck was discovered. Specific primers were designed for PCR amplification and Sanger sequencing to quickly identify individuals with the CC genotype to achieve molecular marker-assisted selection.

Benefits of technology

The results significantly improved the cervical vertebra length of Loumen ducks at 10 weeks of age, providing a reliable way to quickly identify and breed local shelduck breeds with longer cervical vertebra lengths, thereby improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119162334B_ABST
    Figure CN119162334B_ABST
Patent Text Reader

Abstract

The present application relates to a SNP molecular marker related to the length of duck cervical vertebra and its application, and belongs to the technical field of molecular biology. The present application uses whole genome association analysis to first find that there is a SNP site on the PBH1.5 version NC_040050.1 chromosome of Loumen duck reference genome which is related to the length of meat duck cervical vertebra, and the site significantly affects the length of cervical vertebra of Loumen duck at 10 weeks old, and the CC genotype shows excellent genotype. Therefore, the present application provides a pair of upstream and downstream primers for amplifying the flanking sequence of the molecular marker, genotypes the molecular marker through the flanking sequence, and implements molecular marker assisted selection according to the genotyping result, and the beneficial effect is that the length of cervical vertebra of duck can be quickly identified, a reliable way is provided for breeding or cultivating local scabby duck breeds with longer length of cervical vertebra, and the breeding process of meat duck is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a SNP molecular marker related to the length of the cervical vertebra of duck and its application, and belongs to the technical field of molecular biology. BACKGROUND

[0002] Loumen duck is famous for its excellent meat quality, and it is a fast-growing breed among multi-purpose mule ducks. Its development and utilization prospect is large. In addition to duck meat, other parts of duck, such as duck neck, are also important processing raw materials. The processing benefit of cooked duck neck is generally related to the length of the duck neck, and the longer the length of the cervical vertebra, the higher the benefit. Therefore, quickly increasing the length of the duck neck of Loumen duck is an effective method to increase the benefit of the by-products of Loumen duck. At present, the conventional breeding method is to calculate the breeding value through pedigree and phenotype, and to select and mate according to the breeding value. This method has a certain effect in breeding practice, but when breeding to a certain stage, the genetic progress will gradually decrease, and the breeding effect will gradually deteriorate. At present, with the development of molecular biology technology, individuals can be genotyped from the genome level, and combined with the phenotype to mine molecular markers that significantly affect the specific phenotype. In breeding, these important molecular markers can be used for molecular marker assisted selection combined with pedigree and phenotype value to improve the selection effect. For a specific breed and a specific trait, it is necessary to find a molecular marker that has an important influence on the phenotype and can be quickly identified. SUMMARY

[0003] The purpose of the present application is to overcome the defects in the prior art, and to provide a SNP molecular marker related to the length of the cervical vertebra of duck and its application, to provide a reliable way for breeding or cultivating local mule duck breeds with longer cervical vertebra length.

[0004] The present application first provides a SNP molecular marker related to the length of the cervical vertebra of duck, the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the SNP molecular marker is a T→C single nucleotide polymorphism (SNP) mutation, located at position 15321792 on the chromosome of Loumen duck reference genome PBH1.5 version NC_040050.1, the base is T or C, and the genotype is TT, TC or CC. The mutation site significantly affects the length of the cervical vertebra of Loumen duck, and the length of the cervical vertebra of an individual with CC genotype is significantly longer than that of individuals with TT genotype and TC genotype.

[0005] The present application determines the length of the cervical vertebra of a Loumen duck population on the market day (10 weeks old), and collects blood and genome resequencing from each individual, finds a molecular marker significantly associated with the length of the cervical vertebra by GWAS method, and statistically analyzes the molecular marker and the phenotype. The length of the cervical vertebra is significantly different between different genotypes at this site.

[0006] The present invention further provides an application of a SNP molecular marker associated with duck cervical vertebra length, wherein the detection method comprises the following steps:

[0007] Step 1: extract the total genomic DNA of the duck to be tested;

[0008] Step 2: Using the total genomic DNA of the duck to be tested as a template, PCR amplification is performed using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to obtain an amplified product;

[0009] Step 3: Sanger sequencing of the PCR product;

[0010] Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

[0011] In step 1, the final concentration of the reaction system in 25 μl is:

[0012] 50 ng of duck DNA to be tested

[0013] 2 x Accurate Taq Master Mix 12.5μl

[0014] Upstream primer 1 μl

[0015] Downstream primer 1 μl

[0016] Add sterile water to 25 μl.

[0017] The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the downstream primer R

[0018] The sequence is shown in SEQ ID NO: 2;

[0019] The reaction conditions of the PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

[0020] In step 4, the judgment standard is the cervical vertebra length of individuals with CC genotype at the SNP site.

[0021] The cervical vertebra length of the individuals with TT genotype was significantly higher than that of the individuals with TC genotype.

[0022] The above method can be applied to the breeding of Loumen ducks. Loumen duck breeding involves the breeding of a core group of Loumen ducks. The core group is a group of individuals within the Loumen duck breed that participate in breeding and are ranked in the top 20% of performance phenotypic values ​​related to the breeding objectives.

[0023] The research of the present application uses whole genome association analysis to first find that there is a SNP site (T / C) on NC_040050.1 chromosome of Loumen duck which is related to the cervical vertebra length trait of meat duck, the site significantly affects the cervical vertebra length of 10-week-old Loumen duck, and the CC genotype shows excellent genotype. Therefore, the present application provides a pair of upstream and downstream primers (SEQ ID NO: 1 and SEQ ID NO: 2) for amplifying the flanking sequence (SEQ ID NO: 3 or SEQ ID NO: 4) of the molecular marker, genotyping the molecular marker through the flanking sequence, and implementing molecular marker assisted selection according to the genotyping result, and the beneficial effects are that the cervical vertebra length of duck can be quickly identified, a reliable way is provided for breeding or cultivating local fuzzy duck breeds with longer cervical vertebra length, and the breeding process of meat duck is accelerated. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a Manhattan plot of genome association analysis, and the abscissa in the figure is the chromosome, showing that a site on NC_040050.1 chromosome is significantly related to the cervical vertebra length of 10-week-old.

[0025] Figure 2 It is a peak shape chart of three genotypes TT type, TC type and CC type. DETAILED DESCRIPTION

[0026] EMBODIMENT

[0027] Identification of SNP molecular marker

[0028] The cervical vertebra length of 500 individuals of 10-week-old Loumen duck was measured, and the genomic DNA was extracted after blood collection from the wing vein, and the whole genome individual resequencing was performed by using the Hiseq X-Ten sequencing platform of Illumina company, and the sequencing depth of each individual was 10x. After quality control of the off-machine data, BWA and GATK software were used for sequence alignment and genotype extraction. Combined with the cervical vertebra length of 10-week-old and the genotyping data, rMVP software was used for GWAS analysis of mixed linear model. The results are shown in Figure 1 The results show that the site of 15321792 on chromosome 5 (NC_040050.1) (T to C mutation) is significantly related to the cervical vertebra length of 10-week-old Loumen duck, wherein the cervical vertebra length of TT genotype is 21.58±1.63 cm, the cervical vertebra length of TC genotype is 21.82±1.39 cm, and the cervical vertebra length of CC genotype is 23.21±1.66 cm, and the cervical vertebra length of CC genotype is significantly higher than that of TT genotype (P<0.05). The number of individuals of TT genotype, TC genotype and CC genotype is 150, 248 and 102 respectively, which accords with Hardy-Weinberg equilibrium law (P value is close to 1).

[0029] Primer design for identifying the nucleotide polymorphism of NC_040050.1:15321792:

[0030] Based on the whole genome sequencing results, primers for identifying the nucleotide polymorphism of the NC_040050.1:15321792 site on the duck genome were designed as follows:

[0031] Upstream primer: CCAAACTTTACGACAGCGGC (SEQ ID NO: 1)

[0032] Downstream primer: GGACAGCAGATTGCAAACCC (SEQ ID NO: 2)

[0033] The amplified product bands are:

[0034] CCAAACTTTACGACAGCGGCTCTTGACCCCACAATCTCTAAAAGTATCAACTTTAAATCAGGAGAATAATTAGCAATGCTCTTAAGCCCTGACAGCTGCGAAGGTTTCCCAGTGCAGTTTTCCTTAGCGCAGGATGCGTTTTGGTAATG GGGAGAAGTGCAAACACGGCAGAATATCCATTCCCAGTCTCTGTGCTCCCGATATTTCTGCTCCAGAATTCCCTGGCAGGAAGGTAACACCCAACATTTCGCTGAGAAATGAGCTCGAGTTAAAAGGGTTTGCAATCTGCTGTCC (SEQID NO:3)

[0035] CCAAACTTTACGACAGCGGCTTCTTGACCCCACAATCTCTAAAAGTATCAACTTTAAATCAGGAGAATAATTAGCAATGCTCTTAAGCCCTGACAGCTGCGAAGGTTTCCCAGTGCAGTTTTCCTTAGCGCAGGATGCGTTCTGGTA ATGGGGAGAAGTGCAAACACGGCAGAATATCCATTCCCAGTCTCTGTGCCCGATATTTCTGCTCCCAGAATTCCCTGGCAGGAAGGTAACACCCAACATTTCGCTGAGAAATGAGCTCGAGTTAAAAGGGTTTGCAATCTGC (SEQ IDNO:4)

[0036] Note: The 141st base is a mutant base.

[0037] Genotyping verification of Loumen duck population

[0038] Experimental materials: The population other than the genome resequencing at the Kunshan Loumen Duck Conservation Farm (a total of 600 ducks)

[0039] The first step is to obtain the genotype of each individual

[0040] 1. Measure the cervical vertebrae length of 600 ducks at 10 weeks of age;

[0041] 2. Blood sample collection: Blood was collected from the wing vein of each duck using EDTA2K vacuum blood collection tubes and stored at -20℃ for later use;

[0042] 3. Whole blood genomic DNA extraction;

[0043] 4. Genotype determination: Take the genomic DNA of each duck to be tested as a template and perform PCR amplification using the primers designed in Example 2. The obtained product is sequenced by Sanger sequencing to obtain the following sequence: Figure 2 The three genotypes shown are TT, TC, and CC, and the genotype of each individual is determined.

[0044] The second step is SNP site and phenotype association analysis verification

[0045] 1. Grouping by genotyping information: The genotypes of the mutation sites were examined based on the sequence information. The genotypes were divided into TT, TC, and CC genotype groups, with 182, 303, and 115 individuals in each group, respectively. The genotype distribution conformed to the Hardy-Weinberg equilibrium (P value was 0.5568).

[0046] 2. The cervical vertebra lengths at 10 weeks of age were 20.93±1.59 cm, 20.79±1.82 cm, and 23.47±1.77 cm for the TT, TC, and CC genotype groups, respectively. Analysis of variance for 10-week cervical vertebra length across genotype groups revealed a significant correlation between genotype differences and 10-week cervical vertebra length. The CC genotype had significantly higher cervical vertebra length at 10 weeks of age than the TT and TC genotype groups. The C allele is a superior allele, significantly increasing cervical vertebra length at 10 weeks of age in Loumen ducks.

[0047] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. An application of a SNP molecular marker associated with duck cervical vertebra length, characterized by: Used for molecular detection of cervical vertebra length of 10-week-old Loumen duck breed, the nucleotide sequence of the duck DNA-specific primer pair required for the molecular marker detection is shown in SEQ ID NO: 1 and SEQ ID NO: 2, the SNP molecular marker is located at position 15321792 on chromosome NC_040050.1 of the Loumen duck reference genome PBH1.5 version, the base is T or C, and the genotype is TT, TC or CC.

2. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 1, characterized in that: The detection method comprises the following steps, Step 1: extract the total genomic DNA of the duck to be tested; Step 2: Using the total genomic DNA of the duck to be tested as a template, PCR amplification is performed using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to obtain an amplified product; Step 3: Sanger sequencing of the PCR product; Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

3. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 2, characterized in that: In step 1, the final concentration of the reaction system in 25 μl is: 50 ng of duck DNA to be tested 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

4. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 3, characterized in that: The sequence of the upstream primer is shown in SEQ ID NO: 1, and the sequence of the downstream primer is shown in SEQ ID NO: 2; the reaction conditions for PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, and extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

5. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 2, characterized in that: In the step 4, the judgment criterion is that the cervical vertebra length of individuals with CC genotype at the SNP site is significantly longer than that of individuals with TT genotype and TC genotype.

6. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 1, characterized in that: The breeding of Loumen duck breed is the breeding of the core group of Loumen duck.

7. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 6, characterized in that: The Loumen duck core group is a group composed of the top 20% of individuals in the Loumen duck breed that participated in breeding and measurement of performance phenotypic values ​​related to breeding goals.

Citation Information

Patent Citations

  • Molecular marker related to carnosine content in duck meat and application of molecular marker

    CN116042862A

  • Molecular marker for identifying duck body weight character based on LYN gene and application

    CN118516472A