A SNP molecular marker related to yak immune traits, detection method and application thereof

By detecting SNP molecular markers in the yak reference genome, the problem of lack of scientific basis for disease resistance in yak breeding is solved, scientific guidance on yak immunity detection and breeding is achieved, and the health level of yaks and the benefits of animal husbandry are improved.

CN119162339BActive Publication Date: 2025-08-22LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411588349.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2025-08-22
Estimated Expiration
2044-11-08

AI Technical Summary

Technical Problem

The existing technology cannot effectively use the genetic material of yaks to study their disease resistance, resulting in a lack of scientific basis for yak disease prevention and treatment and breeding, affecting the health of yaks and the development of animal husbandry.

Method used

A SNP molecular marker is provided, located at base 163684421 on chromosome 1, LU_Bosgru_v3.0 version 3.0. By detecting the genotype of this site, it correlates the content of immunoglobulins A, G and M in yaks, and is used to assist breeding and detect yak immunity.

Benefits of technology

By detecting the SNP molecular marker, the immunity level of yaks can be accurately judged, providing a scientific basis for yak breeding, improving the immunity of yaks, reducing the occurrence of diseases, and promoting the development of animal husbandry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119162339B_ABST
    Figure CN119162339B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of molecular biological detection technology, and in particular to a SNP molecular marker associated with yak immune traits and its application. The present invention screens and obtains a SNP molecular marker associated with yak immune traits, located at position 163684421 on chromosome 1 of the yak reference genome LU_Bosgru_v3.0, with the mutated base being C or T. The present invention utilizes this SNP molecular marker to determine the levels of immunoglobulin A, immunoglobulin G, and immunoglobulin M in individual yaks, providing a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and providing a basis for breeding yaks with high immunity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biological detection technology, and in particular to a SNP molecular marker related to yak immune traits, a detection method and application thereof. Background Art

[0002] Livestock diseases not only pose significant risks to the animals themselves but also significantly impact the development of the livestock industry. Traditionally, livestock disease prevention and control relies primarily on vaccinations or drug treatments, but these efforts have not fundamentally eliminated or controlled the occurrence and spread of diseases. The resistance or susceptibility of livestock to diseases is influenced by both genetics and environmental factors, and disease resistance varies among different livestock species. Therefore, studying the relationship between disease-resistance genes and diseases is crucial for the prevention and control of livestock diseases.

[0003] Immunoglobulins (Ig) are a class of globulins that exhibit antibody activity or have a chemical structure similar to antibodies. They are the primary reactants of the humoral immune response. They possess antibacterial and antiviral properties, enhance cellular phagocytosis, and synergistically kill or dissolve pathogenic microorganisms, making them a crucial component of the body's defenses against disease.

[0004] The yak (Bos grunniens), nicknamed the "ship of the plateau," is a vital native mammal found in the plateau, primarily distributed in my country's Qinghai-Tibet Plateau and its adjacent high-altitude, low-oxygen regions. Through long periods of natural selection, yaks have adapted to the high-altitude, low-oxygen environment and possess a remarkably strong resilience. Oxidative stress in mammalian cells can damage macromolecules and cause organ dysfunction, reducing productivity and even leading to various diseases. Furthermore, immune stress can cause behavioral, metabolic, and neurological changes in livestock, ultimately inhibiting growth. Under traditional grazing practices, which rely on the weather for livestock production, yaks' nutritional intake is affected by seasonal fluctuations in forage yields and nutrients. Insufficient forage supply or low nutrient levels can lead to chronic nutritional deficiencies in pregnant cows and newborn calves, resulting in delayed or even stagnant growth and development. The harsh environment in the plateau pastoral areas leads to a high incidence of disease in yak calves. Calves in sub-healthy conditions are prone to stunted growth and development. Yaks are important livestock for local herders in terms of economy and agriculture. Several diseases pose a serious threat to the health of yaks and cause significant economic losses to local herders.

[0005] The combined effects of genes and the environment determine an organism's phenotypic traits, and genetic diversity determines an organism's basic immune function. Understanding immune-related factors is crucial for studying immune responses and pathological changes in yaks during infectious and non-infectious diseases. Summary of the Invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to yak immune traits and its application.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 163684421st base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0009] Preferably, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the content of immunoglobulin A and immunoglobulin G in yak individuals with the CC genotype is higher than the content of immunoglobulin A and immunoglobulin G in yak individuals with the genotype CT or TT; the content of immunoglobulin M in yak individuals with the CC genotype is higher than the content of immunoglobulin M in yak individuals with the genotype TT.

[0010] The present invention provides the use of the SNP molecular marker in preparing a product for detecting yak immunity or a product for yak assisted breeding.

[0011] The present invention provides a primer pair for amplifying the SNP molecular markers described in the claims, and the sequences of the primer pair are shown in SEQ ID NOs: 1-2.

[0012] The present invention provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak assisted breeding.

[0013] The present invention provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0014] The present invention provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extracting yak genomic DNA;

[0017] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0018] (3) performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M.

[0019] Preferably, the amplification system in step (2) comprises 25 μL in total, 12.5 μL of 2×L-Exp TaqMasterMix (dye plus), 8.5 μL of RNase-free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0020] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0021] By adopting the above technical solution, the present invention has the following beneficial effects:

[0022] The present invention provides a SNP molecular marker related to yak immune indicators and its role in breeding. Through research, the present invention found that the SNP site related to yak immunity is located at the 163684421st base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, the variation type is C / T, and there are three genotypes. When the 163684421st base on chromosome 1 is C, the genotype is CC or CT; when the 163684421st base on chromosome 1 is T, the genotype is TT.

[0023] Through the association analysis between different genotypes and the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it was found that the contents of immunoglobulin A and immunoglobulin G in yak individuals with the CC genotype were higher than those in yak individuals with the CT or TT genotypes (p<0.05); the content of immunoglobulin M in yak individuals with the CC genotype was higher than that in yak individuals with the TT genotype (p<0.05).

[0024] By detecting the base at the 163684421st nucleotide site on chromosome 1 of the yak, the present invention can obtain the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of individual yaks. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, and provides a basis for breeding yaks with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0026] Figure 1 is the PCR amplification product: M represents Marker; 1, 2, and 3 represent three groups of repeats;

[0027] Figure 2 The peak diagram and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION

[0028] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 163684421st base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0029] In the present invention, the genotype of the yak with the mutant base C is CC or CT; the genotype of the yak with the mutant base T is TT; the contents of immunoglobulin A and immunoglobulin G in the yak individuals with the CC genotype are higher than those in the yak individuals with the CT or TT genotypes; the content of immunoglobulin M in the yak individuals with the CC genotype is higher than that in the yak individuals with the TT genotype.

[0030] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or products for yak assisted breeding.

[0031] The present invention also provides a primer pair for amplifying the SNP molecular markers described in the claims, and the sequence of the primer pair is shown in SEQ ID NOs: 1-2.

[0032] In the present invention, the sequence SEQ ID NO: 1 in the primer pair is the upstream primer, and the specific sequence is 5'-GCAGCAGGTCCGTCCACAT-3'; the sequence SEQ ID NO: 2 in the primer pair is the downstream primer, and the specific sequence is 5'-GTAGCCCATCCAGGCCACA-3'.

[0033] The present invention provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak assisted breeding.

[0034] The present invention provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0035] The present invention provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0036] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0037] (1) Extracting yak genomic DNA;

[0038] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0039] (3) performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M.

[0040] In the present invention, the amplification system described in step (2) comprises 25 μL in total, 12.5 μL of 2×L-Exp TaqMasterMix (dyeplus), 8.5 μL of RNase-free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0041] In the present invention, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0042] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1

[0044] 1. Sample collection

[0045] The invention uses the Niangya yak breed as the detection object, collects 5mL of blood samples from 188 fasting yaks from the Jiali County pasture in Nagqu City, Tibet Autonomous Region, and puts them into clean pro-coagulant vacuum blood collection tubes. The samples are allowed to stand for 30 minutes, then centrifuged at 3500r / min for 10 minutes, and the supernatant is aspirated into a PE tube, which is sealed and stored in a -20℃ low-temperature refrigerator. Another 5mL of blood sample is collected and added to a blood collection tube containing EDTA-K2 anticoagulant. After the blood sample is collected, it is quickly mixed and temporarily placed in a sampling box containing an ice pack. After being transported back to the laboratory, it is frozen in a -20℃ refrigerator for DNA extraction.

[0046] 2 Main reagents and instruments

[0047] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; a blood genome extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; a Nano Drop 2000 spectrophotometer was purchased from Thermo Fisher Scientific (USA); DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp TaqMasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; an electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; and a PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0048] 3 Methods

[0049] 3.1 Immunoglobulin IgA, IgG, and IgM testing

[0050] The double-antibody one-step sandwich assay was performed using the IgA, IgG, and IgM detection kits from Jiangsu Enzyme Biotechnology Co., Ltd. First, remove the desired strips from the aluminum foil pouch after equilibration at room temperature for 20 minutes. The remaining strips were sealed in ziplock bags and returned to 4°C. Standard and sample wells were set up, with 50 μL of standard solution of varying concentrations added to each well. Sample wells were first loaded with 10 μL of the sample to be tested, followed by 40 μL of sample diluent. No sample was added to the blank wells. In addition to the blank wells, 100 μL of horseradish peroxidase (HRP)-labeled detection antibody was added to each well. The wells were sealed with sealing film and incubated at 37°C in a waterbath or incubator for 60 minutes. The liquid was discarded and patted dry on absorbent paper. Wash solution was then filled to the top of each well, left for 1 minute, then the wash solution was discarded and patted dry on absorbent paper. This process was repeated five times (a plate washer can also be used). Substrates A and B were added to each well, each with 50 μL each, and incubated at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: In an Excel worksheet, plot the standard concentration as the horizontal axis and the corresponding OD value as the vertical axis. Draw a linear regression curve for the standard. Calculate the IgA, IgG, and IgM concentrations of each sample according to the curve equation.

[0051] 3.2 Extraction of genomic DNA from blood

[0052] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20 ng / μL and the OD 260 / OD 280A value between 1.7 and 1.9 meets the experimental needs and can be stored at -20°C for future use.

[0053] 3.3 Primer design

[0054] With reference to the chromosome 1 gene sequence of the yak genome LU_Bosgru_v3.0 version (Ensemble accession number: ENSBGRG00000003372), specific primers were designed using Primer5 software, including the g163684421C>T SNP site.

[0055] Primer sequences

[0056] F: 5'-GCAGCAGGTCCGTCCACAT-3' (SEQ ID NO: 1);

[0057] R: 5'-GTAGCCCATCCAGGCCACA-3' (SEQ ID NO: 2).

[0058] The amplified fragment was 496 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0059] 3.4 PCR amplification and sequencing

[0060] PCR amplification system 25 μL: 2×L-Exp Taq MasterMix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template 2 μL.

[0061] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, and 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0062] The PCR products were detected by 1% agarose gel electrophoresis. After the PCR products were qualified by agarose gel electrophoresis, they were sequenced by direct sequencing. The sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. Figure 1 shown. Figure 1 The PCR-amplified sequence was 496 bp in length, and sequencing revealed a C / T mutation at nucleotide position 280 (base 163,684,421 on chromosome 1 in the LU_Bosgru_v3.0 genome). The amplified product showed clear bands without any other bands, demonstrating good specificity.

[0063] This site was initially identified as a SNP marker site in yaks and designated g163684421C>T SNP. The sequence amplified by PCR is shown in SEQ ID NO:3, with a C mutation at position 280. The size of the PCR amplified product matched expectations, allowing for further experiments.

[0064] SEQ ID NO:3

[0065] GCAGCAGGTCCGTCCACATCTCTATTTGTTTCTAACTGTGTTTCCTTTTAGGATTTGTTTTTGTCAACCATTTCTTAAAAGAAATCTTAAACCTCTTAAATCATTCAAAAATAAGGTCAGTATAAGATGATATATTCAG AAAGTCTCATTCCTACCTCTTCTTATATCCTATTTCCACCTACTTCCTATATGTAGCCATGTTCATTACTTTCTGCTTTACCTCCTGTTTTCTTTTGTAAAATAAGCCAACATAGACATGCAGACACTTATTTCTCATT C TGACCCTACGGAGGGCATGTATTTCAGGACAGGAAGCTGCATGATGATTTCCTCATGCTAGAGTAATTTGGAATCTCTGGATGTGCTCATTTCTTATTGTCACAGAATCCATAGTCTCCATAGTGATACAGTGGGGCAACAGTCTGGGCTGGAGGCAGACAGGCCCAGGCTGGCATCTGGGTTGCCCAGAGTCTCCTTGTGGCCTGGATGGGCTAC

[0066] The bioanalysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graphs, and complete the typing.

[0067] 4 Statistical analysis

[0068] According to the genotyping results, the number of individuals with different genotypes at each locus was counted. The Popgen32 software was used to calculate the gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g163684421C>T gene, and the polymorphism information content (PIC) was calculated using the PIC (polymorphism information content) calculation software. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0069] 5 Results

[0070] 5.1 PCR Amplification and Sequencing Results

[0071] The amplification products of the g163684421C>T SNP locus on chromosome 1 of yaks were detected using 1% agarose gel (see Figure 1 ). The bands were clear without heterozygous bands, and the specificity was good. The size of the PCR product fragment was 496bp, which was consistent with the expected size, and the next experiment could be carried out.

[0072] The peak map and sequence obtained after purification and sequencing of the PCR product are shown in Figure 2 . As can be seen from Figure 2 , a C-T mutation occurred at the g163684421C>T SNP locus, and there were three genotypes: CC, CT, and TT.

[0073] 5.2 Statistical Analysis Results

[0074] The genotypes and allele frequencies of the g163684421C>T SNP locus on chromosome 1 of yaks were analyzed from the perspective of population genetics. As shown in Table 1, at the g163684421C>T SNP locus, the CT genotype frequency was the highest, which was the dominant genotype, and the T allele frequency was 54.8%, showing a dominant allele. The χ 2 adaptive test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.495, and the PIC was 0.373. 0.25<PIC<0.50, which belonged to moderate polymorphism.

[0075] Table 1 Polymorphism of the g163684421C>T SNP Locus on Chromosome 1 of Yaks

[0076]

[0077] 5.3 Association analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0078] General linear models in IBM SPSS Statistics 26 were used to analyze the association between different yak genotypes and immunoglobulin (IgA), IgG, and IgM levels. The results showed that yak individuals with the CC genotype had significantly higher levels of IgA and IgG than those with the CT and TT genotypes (p < 0.05), while no significant differences in IgA and IgG were observed between individuals with the CT and TT genotypes (p > 0.05). Yaks with the CC genotype had significantly higher levels of IgM than those with the TT genotype (p < 0.05), while no significant differences in IgM were observed between individuals with the CT and CC or TT genotypes (p > 0.05). This suggests that the g163684421C>T SNP on chromosome 1 is significantly associated with IgA, IgG, and IgM in yaks, making it a SNP marker associated with IgA, IgG, and IgM in yaks. The results are shown in Table 2.

[0079] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0080]

[0081] Note: Data in the same row with different lowercase letters indicate significant differences (P<0.05).

[0082] The SNP molecular marker described in the present invention is located at the 163684421 base on chromosome 1 of the yak genome LU_Bosgru_v3.0 version; the variation type is C / T, named g163684421C>T, and there are three genotypes. When the 163684421 base on chromosome 1 is C, the genotype is CC or CT; when the 163684421 base on chromosome 1 is T, the genotype is TT; by comparing different genotypes with immunoglobulins IgA, IgA Correlation analysis of the levels of IgA and IgG in yak individuals with the CC genotype revealed that these individuals had significantly higher levels of immunoglobulins IgA and IgG than those with the CT and TT genotypes (p<0.05), and that there was no significant difference in immunoglobulin IgA and IgG between individuals with the CT and TT genotypes (p>0.05). The levels of immunoglobulin IgM in yak individuals with the CC genotype were significantly higher than those with the TT genotype (p<0.05), and there was no significant difference in immunoglobulin IgM between individuals with the CT and CC and TT genotypes (p>0.05). The present invention can determine the levels of immunoglobulins IgA, IgG, and IgM in yak individuals by detecting the bases at the 163,684,421st nucleotide position on chromosome 1 of the yak. ​​This invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in detecting yak immunity or yak assisted breeding methods, characterized in that: The reagent is a primer, and the sequence of the primer is shown in SEQ ID NO: 1-2; The SNP molecular marker is located at base 163684421 on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the base is C or T; The levels of immunoglobulin A and immunoglobulin G in yaks with CC genotype were higher than those in yaks with CT or TT genotype.

2. A method for marker-assisted selection of immune traits in yaks for non-diagnostic purposes, characterized in that: The steps include: (1) Extracting yak genomic DNA; (2) using the yak genomic DNA obtained in step (1) as a template, and amplifying using the primers shown in SEQ ID NOs: 1-2 to obtain an amplified product; (3) performing genotyping analysis on the SNP molecular markers of the amplified products to obtain yaks with different genotypes; and correlating the genotypes of the yaks with immune indicators; The SNP molecular marker is located at base 163684421 on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the base is C or T; The levels of immunoglobulin A and immunoglobulin G in yaks with CC genotype were higher than those in yaks with CT or TT genotype.

3. The method according to claim 2, characterized in that The amplification system described in step (2) consists of 25 μL, 12.5 μL of 2×L-ExpTaq MasterMix, 8.5 μL of RNase-free ultrapure water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

4. The method according to claim 2, characterized in that The amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.